Query Select Filtering Terms: OMOP:1001490 - IRF-PAI v4.0 - Health conditions - admission during assessment period [CMS Assessment] OMOP:1001606 - ABO and Rh group post transfusion reaction panel - Blood OMOP:1001616 - Creatinine [Mass/volume] in Serum or Plasma --2 hours post dose vasopressin OMOP:1001679 - p-Fluorofentanyl [Mass/volume] in Urine by Confirmatory method OMOP:1001716 - XR Middle phalanx of fifth finger Bone development stage OMOP:1001729 - XR Scaphoid Bone development stage OMOP:1001845 - LCDS v5.00 - Special treatments, procedures, and programs - admission during assessment period [CMS Assessment] OMOP:1001904 - Total score [Quality of Working Life Questionnaire for Cancer Survivors] OMOP:1001962 - During the past 4 weeks, I have the feeling I am taken seriously by people in my working environment [Quality of Working Life Questionnaire for Cancer Survivors] OMOP:1001995 - Left atrial End-systolic volume/Body surface area [Volume/Area] by US.2D.A4C+Calculated by single plane method of disks OMOP:1002013 - Ceramide panel - Plasma OMOP:1002140 - Home accessibility modification responsible party OMOP:1002159 - D Ag [Presence] on Red Blood Cells --post hematopoietic stem cell transplant OMOP:1002189 - Bacterial pncA gene drug resistance mutation [Identifier] by Molecular method OMOP:1002235 - Do you have trouble finding or paying for transportation [WellRx] OMOP:1002312 - Potassium [Moles/volume] in Serum or Plasma --2 hours post dose vasopressin OMOP:1002317 - Busulfan [Mass/volume] in Plasma --4 hours post busulfan infusion completion OMOP:1126253 - Documentation of medical reason(s) for not administering td or tdap vaccine (e.g., prior anaphylaxis due to the td or tdap vaccine or history of encephalopathy within seven days after a previous dose of a td-containing vaccine) OMOP:1126255 - Grade 2 or above diarrhea and/or grade 2 or above colitis OMOP:1126256 - Documentation of immune checkpoint inhibitor therapy held and corticosteroids or immunosuppressants prescribed or administered OMOP:1126257 - Documentation of medical reason(s) for not prescribing or administering corticosteroid or immunosuppressant treatment (e.g., allergy, intolerance, infectious etiology, pancreatic insufficiency, hyperthyroidism, prior bowel surgical interventions, celia... OMOP:1175141 - Unicode Emoji skin tone modifier OMOP:1175178 - Eculizumab [Mass/volume] in Serum OMOP:1175203 - Rhinovirus RNA [Presence] in Lower respiratory specimen by NAA with probe detection OMOP:1175248 - I have trouble keeping track of what I am doing if I get interrupted in past 4 weeks [PROMIS.PEDS] OMOP:1175291 - Response section information [CDC Emergency Operations Centers] OMOP:1175293 - HBB gene full mutation analysis in Amniotic fluid or Chorionic villus sample by Sequencing OMOP:1175374 - Microorganism preliminary growth [Presence] in Blood by Aerobe culture OMOP:1175465 - Your child forgets things easily in past 4 weeks - frequency [PROMIS.PARENTPROXY] OMOP:1175510 - PROMIS parent proxy short form - peer relationship 7a - version 2.0 raw score OMOP:1175516 - Severe traumatic deviations impacting orthodontic condition OMOP:1175580 - Event status [CDC Emergency Operations Centers] OMOP:1175631 - Thinking about the past 4 weeks, my life was going very well [PROMIS] OMOP:1175717 - My child could walk up stairs without holding on to anything in past 7 days [PROMIS.PARENTPROXY] OMOP:1175764 - Mycobacterium sp identified in Specimen by Sequencing OMOP:1175767 - Considering your shortness of breath over the past 7 days, rate the amount of difficulty you had when putting on socks or stockings [PROMIS] OMOP:1175939 - Thinking about the past 4 weeks, I felt positive about my life [PROMIS] OMOP:1175947 - It is hard for your child to find the right words to say what he or she means in past 4 weeks - frequency [PROMIS.PARENTPROXY] OMOP:1175954 - Thinking about the past 4 weeks, my child felt very good about his/her life [PROMIS.PARENTPROXY] OMOP:1176092 - Bacteria identified in Lower respiratory specimen by Anaerobe culture OMOP:1176125 - Organization Emergency response capabilities OMOP:1176170 - Maximum amplitude activator F induced [Length] in Blood by Resonance TEG OMOP:1176279 - My child missed school when he or she had pain in past 7 days [PROMIS.PARENTPROXY] OMOP:1176286 - Status of waste water systems Narrative OMOP:1176296 - Methamphetamine+Methylenedioxymethamphetamine [Presence] in Meconium by Screen method OMOP:1176374 - Thinking about the past 4 weeks, my life was better than most kids' lives [PROMIS] OMOP:1176395 - PROMIS pediatric short form - life satisfaction 4a - version 1.0 raw score OMOP:1176435 - PROMIS parent proxy item bank - peer relationships - version 2.0 OMOP:1176448 - Pathology case identifier [Identifier] OMOP:1176491 - PROMIS parent proxy short form - mobility 8a - version 2.0 raw score OMOP:1242297 - Penicillium solitum OMOP:1242323 - Urethral surgical margin OMOP:1242398 - Qualitative distribution of primary malignant neoplasm of nasal cavity and/or nasal sinus in excised tissue specimen OMOP:1242404 - Anatomic location directly invaded by Ewing's sarcoma OMOP:1242782 - Premature Infant Pain Profile OMOP:1242875 - Volcanic lava flow OMOP:1242960 - Acid rain OMOP:1243003 - FIGO (International Federation of Gynecology and Obstetrics) grading system grade 2 OMOP:1243230 - Seromucinous inflammatory morphology OMOP:1243253 - Periosteal chondroma OMOP:1243280 - Plexiform solitary circumscribed neuroma OMOP:1243601 - At increased risk of exposure to Leptospira OMOP:1243734 - Thermomyces lanuginosus OMOP:1243777 - Pregnancy risk level OMOP:1243861 - Suspected genetic overgrowth syndrome OMOP:1243868 - Multi-cancer early detection signal detected OMOP:1243977 - Family history of hereditary diffuse gastric cancer OMOP:1244102 - Chryseobacterium aquaticum OMOP:1244119 - Malignant melanoma of skin of left hand OMOP:1244154 - Postpartum mood disorder OMOP:1244171 - Primary nonseminomatous germ cell neoplasm of left descended testis OMOP:1244250 - Central cord syndrome of cervical spinal cord due to closed dislocation of cervical spine OMOP:1244341 - Well-differentiated neuroendocrine tumor of appendix OMOP:1244368 - Eruption of skin caused by Salmonella Paratyphi OMOP:1244380 - Eruption of skin caused by Salmonella Paratyphi C OMOP:1244381 - Abrasion of skin of external genitalia OMOP:1244387 - Photo-induced Stevens-Johnson syndrome OMOP:1244398 - Abrasion of skin of perineum OMOP:1244422 - Neonatal focal automatism epileptic seizure OMOP:1244423 - Neonatal focal myoclonic epileptic seizure OMOP:1244503 - Bilateral posterior communicating artery occlusion OMOP:1244534 - Enterochromaffin cell tumor of small intestine OMOP:1244591 - Neuroendocrine neoplasm of large intestine OMOP:1244600 - Growth hormone releasing factor-secreting tumor of pancreas OMOP:1244655 - Synovial popliteal cyst of bilateral knees OMOP:1244680 - Disorder of tendon of hand OMOP:1244694 - Misophonia OMOP:1244759 - Osteochondritis dissecans of bone of ankle OMOP:1244770 - Dislocation of joint of lunate OMOP:1244789 - Secondary osteosarcoma following treatment or disease OMOP:1244792 - High-grade surface osteosarcoma OMOP:1244804 - Biphasic synovial sarcoma OMOP:1244834 - Desmoplastic fibroma OMOP:1244860 - Angiomatoid fibrous histiocytoma OMOP:1244862 - Calcium deposit in bursa of knee OMOP:1244931 - Arthritis of joint of wrist region caused by Streptococcus OMOP:1244936 - Atypical hemolytic uremic syndrome with complement gene abnormality OMOP:1244949 - Plexiform solitary circumscribed neuroma OMOP:1244957 - Poorly differentiated chordoma OMOP:1244966 - Microcystic/reticular schwannoma OMOP:1244984 - Factor H antibody OMOP:1245069 - Ocular hypertension of left eye due to ocular surgery OMOP:1245079 - Intraocular pressure of left eye below reference range OMOP:1245193 - Epiphyseal arrest of femur OMOP:1245318 - Common red raspberry specific IgE OMOP:1245323 - Miller classification for gingival recession class IV OMOP:1245327 - Adult-onset progressive leukoencephalopathy, early-onset deafness OMOP:1245330 - Congenital dysplasia of joint of foot OMOP:1245347 - Acoustic neuritis due to infectious disease OMOP:1245412 - True congenital shoulder dislocation OMOP:1245439 - Fracture of bone of left elbow joint region OMOP:1245476 - Left Sorsby pseudoinflammatory fundus dystrophy OMOP:1245481 - Subependymoma of spinal cord OMOP:1245489 - Pigmented villonodular synovitis of bilateral ankles OMOP:1245510 - Rheumatoid nodule of subcutaneous tissue of bilateral feet OMOP:1245521 - Chorioretinitis of right eye caused by Cytomegalovirus humanbeta5 OMOP:1245542 - Seronegative rheumatoid arthritis of bilateral hip joints OMOP:1245547 - Bilateral mycobacterial keratitis OMOP:1245580 - Recurrent dislocation of bilateral knee joints OMOP:1245591 - Osteophyte of bilateral carpi OMOP:1245624 - Dislocation of joint of right knee due to congenital dysplasia of joint of right knee OMOP:1245658 - Mass of bilateral hip joints OMOP:1245718 - Cervicothoracic myelopathy due to disc disorder OMOP:1245721 - Congenital anomaly of ossicles of bilateral ears OMOP:1245730 - Supernumerary eye muscle of left eye OMOP:1245752 - Glaucoma of right eye due to plateau iris OMOP:1245780 - Congenital trigger finger of bilateral hands OMOP:1245783 - Bilateral congenital arteriovenous malformation of upper limbs OMOP:1245791 - Exostosis of bilateral fibulas OMOP:1245822 - Systemic onset juvenile idiopathic arthritis of right knee OMOP:1245831 - Nasal step visual field defect of right eye OMOP:1245857 - Medial tibial stress syndrome of right lower leg OMOP:1245893 - Melanocytic nevus of left upper eyelid OMOP:1245896 - Pigmented hairy epidermal nevus of right lower eyelid OMOP:1245926 - Ingestion of magnetic foreign body OMOP:1246041 - Neoplasm of uncertain behavior of smooth muscle OMOP:1246070 - Solitary bone cyst of ankle joint region OMOP:1246078 - Staphylococcal arthritis of foot OMOP:1246110 - Flail joint of right wrist OMOP:1246147 - Osteitis deformans of left tibia and fibula OMOP:1246154 - Partial epiphyseal arrest of right distal tibia OMOP:1246185 - Rheumatoid nodule of left knee OMOP:1246186 - Rheumatoid nodule of left wrist OMOP:1246269 - Right keratomalacia OMOP:1246342 - Discoid lupus erythematosus of right lower eyelid OMOP:1246346 - Discoid lupus erythematosus of left eyelid OMOP:1246360 - Bilateral ophthalmia nodosa OMOP:1246394 - Acquired coloboma of optic disc of right eye OMOP:1246405 - Benign neoplasm of left bronchus OMOP:1246438 - Provision of written information about emergency contraception OMOP:1246449 - Traumatic amputation of left third toe OMOP:1246487 - Cellulitis of right second toe OMOP:1246498 - Puncture wound of left lower limb OMOP:1246507 - Puncture wound of right lower eyelid OMOP:1246530 - Bursitis of right elbow OMOP:1246541 - Abrasion of left conjunctiva OMOP:1246577 - Contusion of left eye region OMOP:1246623 - At increased risk of arterial thromboembolus OMOP:1246668 - Infective arthritis of joint of vertebral column OMOP:1246717 - Primary malignant fibrous histiocytoma of face OMOP:1246786 - Postpartum disorder of breast OMOP:1246929 - Mayo-Portland Adaptability Inventory version 4 total score OMOP:1247081 - Glucose in blood one hour postprandial OMOP:1259476 - Pregabalin [Presence] in Serum or Plasma OMOP:1259499 - B cell non hodgkin Lymphoma multigene analysis in Blood or Tissue by Molecular genetics method OMOP:1259520 - Polio virus 1 Ab [Titer] in Serum by Immunoassay --2nd specimen OMOP:1259556 - 4-Hydroxyatomoxetine [Mass/volume] in Urine by Confirmatory method OMOP:1259592 - Recall - bed during assessment period [CMS Assessment] OMOP:1259595 - We cannot trust scientists because they are biased in their perspectives OMOP:1259609 - Staphylococcus aureus MLVA type in Isolate or Specimen by Molecular genetics method OMOP:1259734 - Scientists ignore evidence that contradicts their work OMOP:1259828 - Were you obliged to wear masks in closed public areas in last 2 weeks OMOP:1259835 - We should trust the work of scientists OMOP:1259870 - ABCG2 gene.p.Q141K [Presence] in Blood or Tissue by Molecular genetics method OMOP:1259887 - Borrelia recurrentis DNA [Presence] in Cerebral spinal fluid by NAA with probe detection OMOP:1259925 - Paroxetine metabolite III [Mass/volume] in Urine by Confirmatory method OMOP:1259975 - Breast Cancer recurrence risk multigene analysis [Presence] in Tissue by Molecular genetics method OMOP:1260086 - Diphtheria toxin DNA [Presence] in Specimen by NAA with probe detection OMOP:1314437 - Patient has been treated with a systemic medication for psoriasis vulgaris OMOP:1314519 - Patients who died from cancer OMOP:132277 - Neoplasm of uncertain behavior of endocrine glands and nervous system OMOP:132449 - Transient limb paralysis OMOP:132466 - Lumbar sprain OMOP:132724 - Congenital anomaly of hair OMOP:132772 - Arthus type urticaria OMOP:132832 - Primary malignant neoplasm of inner aspect of lip OMOP:133280 - Alopecia OMOP:133610 - Open fracture scapula, coracoid OMOP:1340208 - History of event longer than 10 years ago OMOP:1340211 - History of event longer than 3 months ago OMOP:1340232 - Aspirin-exacerbated disorder of respiratory system OMOP:1340277 - Exacerbation of chill OMOP:1340280 - Exacerbation of chronic active hepatitis OMOP:1340326 - Exacerbation of erythematous rash OMOP:1340334 - Exacerbation of fibromyalgia OMOP:1340376 - Exacerbation of infection of skin OMOP:1340448 - Exacerbation of psoriatic arthritis OMOP:1340452 - Exacerbation of pulmonary tuberculosis OMOP:134597 - Chronic leukemia in remission OMOP:134879 - Mycosis fungoides of intrathoracic lymph nodes OMOP:135766 - Leukemia in remission OMOP:135858 - Disorder of lip OMOP:135934 - Abdominal rigidity of periumbilical region OMOP:136937 - Benign neoplasm of endocrine gland OMOP:137005 - Tracheostomy complication OMOP:137111 - Closed fracture scapula, coracoid OMOP:137425 - Nonvenomous insect bite of trunk with infection OMOP:138864 - Congenital anomaly of nail OMOP:139200 - Crushing injury of forearm OMOP:139955 - Open wound of palate without complication OMOP:140020 - Viral exanthem OMOP:140487 - Dermatitis herpetiformis OMOP:140885 - Partial thickness burn of nose OMOP:140966 - Benign neoplasm of skin of face OMOP:141243 - Hodgkin's disease, lymphocytic depletion of intrathoracic lymph nodes OMOP:141411 - Scalp injury OMOP:141498 - Cutaneous infectious disease caused by Mycobacteria OMOP:141917 - Balanitis xerotica obliterans OMOP:1552734 - Rehabilitative support for musculoskeletal care mips value pathway OMOP:1616284 - Varicella zoster virus IgM Ab index [Units/volume] in Serum and CSF OMOP:1616448 - Health confidence score [R-Outcomes] OMOP:1616503 - How are we doing: listen and explain OMOP:1616525 - Mean score [CRBS] OMOP:1616528 - Stay at home to avoid social contact OMOP:1616548 - Social determinants of health score [R-Outcomes] OMOP:1616551 - Coronavirus anxiety scale OMOP:1616623 - SARS-CoV-2-related socioeconomic questionnaire for adults OMOP:1616625 - Level of spine surgery measures OMOP:1616653 - Measures used during spine surgery OMOP:1616668 - Shipping date OMOP:1616676 - Right eye Prism far by Phoropter OMOP:1616790 - Postoperative therapeutic goals or measures that were partially achieved OMOP:1616809 - Postoperative complication timing OMOP:1616820 - Signal Recognition Particle (SRP) IgG Ab [Titer] in Serum or Plasma by Immunofluorescence OMOP:1616843 - 2-Hydroxyethylflurazepam [Mass/volume] in Urine by Confirmatory method OMOP:1616867 - Type of C3-L5 or S1 AO fracture OMOP:1616871 - How helpful has cooking or baking been as a coping strategy to your child during the COVID-19 outbreak OMOP:1616898 - Social contact panel [R-Outcomes] OMOP:1616901 - How are you feeling in general: I was not anxious yesterday OMOP:1616909 - How helpful has cleaning or doing household chores been as a coping strategy during the COVID-19 outbreak OMOP:1616937 - Barmah forest virus RNA [Presence] in Specimen by NAA with probe detection OMOP:1616990 - Cyanocobalamin IgE Ab [Units/volume] in Serum OMOP:1617002 - Thinking about your friends and family: I do things with others OMOP:1617028 - How helpful was your coping strategy during the COVID-19 outbreak OMOP:1617041 - Reduction in kaolin induced clot strength [Length fraction] in Blood by Resonance TEG --30 minutes post maximum clot amplitude OMOP:1617082 - Effect of friends, family or neighbors as source of information on mental health OMOP:1617125 - Household job or income loss due to the COVID-19 outbreak OMOP:1617134 - Stayed home all day OMOP:1617147 - Right eye Horizontal prism - out far by Phoropter OMOP:1617216 - Effect of Facebook as source of information on mental health OMOP:1617253 - Manage weight well OMOP:1617263 - How often have you used illegal or recreational drugs in past 12 months OMOP:1617311 - Time to thrombin peak in Platelet poor plasma by Chromogenic method OMOP:1617327 - Cocaine [Presence] in Cord tissue by Screen method OMOP:1617398 - Homogenous nuclear Ab pattern [Titer] in Cerebral spinal fluid by Immunofluorescence OMOP:1617426 - Sindbis virus RNA [Presence] in Specimen by NAA with probe detection OMOP:1617491 - Number of days cut down on usual activities because of health condition in past 4 weeks OMOP:1617522 - Additional procedure after spine surgery OMOP:1617547 - Number of days did not go to work because of health condition in past 4 weeks OMOP:1617603 - Total vaccine doses distributed per 100,000 population OMOP:1617605 - Used marijuana in past 3 months OMOP:1617616 - Thinking about your current social habits, in the last 5 days: I have attended social gatherings outside my home of less than 10 people OMOP:1617658 - Protocol used for examination of sentinel lymph nodes OMOP:1761327 - Frequency of feeling alone OMOP:1761442 - Volatile Organic Compounds associated with SARS-CoV-2 infection [Presence] in Exhaled gas by Gas chromatography-mass spectrometry OMOP:1761471 - Have help with finances AndOr financial decisions OMOP:1761556 - Aspergillus terreus DNA [Presence] in Blood by NAA with probe detection OMOP:1761573 - Expect surgery to relieve pain OMOP:1761655 - Pseudocowpox virus DNA [Presence] in Specimen by NAA with probe detection OMOP:1761675 - Feeling hopeful about the future OMOP:1761687 - Had dreams about adverse event OMOP:1761717 - Basidiobolus sp [Presence] in Specimen OMOP:1761838 - Curd cheese IgG Ab [Units/volume] in Serum OMOP:1761852 - Oligoclonal bands [Interpretation] in Cerebral spinal fluid by Isoelectric focusing OMOP:1800964 - APC transcript: Deletion in position 3317 measurement OMOP:1801435 - ERCC2 transcript: Substitution in position 934 of G replaced by A measurement OMOP:1801743 - ATR transcript: Substitution in position 632 of T replaced by C measurement OMOP:1802146 - APC transcript: Substitution in position 423-16 of A replaced by T measurement OMOP:1802205 - BRAF transcript: Substitution in position 1397 of G replaced by A measurement OMOP:1802964 - BRCA1 transcript: Substitution in position 2596 of C replaced by T measurement OMOP:1804076 - APC transcript: Substitution in position 1982 of G replaced by A measurement OMOP:1804220 - ATP7B transcript: Substitution in position 2672 of G replaced by A measurement OMOP:1804232 - STAT3 transcript: Substitution in position 1846 of G replaced by A measurement OMOP:1804395 - PIK3CA transcript: Substitution in position 1634 of A replaced by T measurement OMOP:1804880 - ERBB2 transcript: Substitution in position 2596 of C replaced by A measurement OMOP:1805583 - APC transcript: Substitution in position 3445 of G replaced by A measurement OMOP:1805927 - CDKN2A transcript: Substitution in position 194-1 of G replaced by T measurement OMOP:1806362 - APC transcript: Deletion in position 4701 measurement OMOP:1807005 - STAT3 transcript: Substitution in position 1847 of A replaced by G measurement OMOP:1807351 - NOTCH1 transcript: Substitution in position 1511 of G replaced by A measurement OMOP:1809237 - EGFR transcript: Substitution in position 2572 of C replaced by A measurement OMOP:1809364 - MTOR transcript: Substitution in position 5662 of T replaced by C measurement OMOP:1810565 - RET transcript: Substitution in position 1799 of G replaced by A measurement OMOP:1812152 - CDKN2A transcript: Substitution in position 6 of G replaced by A measurement OMOP:1813013 - TP53 transcript: Substitution in position 329 of G replaced by T measurement OMOP:1813234 - FAT4 transcript: Substitution in position 14935 of G replaced by A measurement OMOP:1814175 - NRAS transcript: Substitution in position 183 of A replaced by T measurement OMOP:1814433 - CDH1 transcript: Substitution in position 2076 of T replaced by C measurement OMOP:1815216 - ATR transcript: Substitution in position 5460 of T replaced by C measurement OMOP:1815459 - JAK2 on GRCh38 chr9: Substitution in position 5054679 of A replaced by G measurement OMOP:1815629 - POLD1 transcript: Substitution in position 1433 of G replaced by A measurement OMOP:192261 - Overlapping malignant neoplasm of pancreas OMOP:192362 - Nephrotic syndrome with membranoproliferative glomerulonephritis OMOP:192364 - Nephrotic syndrome associated with another disorder OMOP:192440 - Ureterocele OMOP:192549 - Abdominal actinomycosis OMOP:193240 - Acute generalized peritonitis OMOP:193493 - Benign hypertensive renal disease OMOP:194077 - Chronic ulcerative enterocolitis OMOP:194088 - Hypertrophic elongation of cervix OMOP:19475950 - CDKN2A transcript: Deletion in position 34 measurement OMOP:19475984 - BCOR transcript: Deletion in position 4462 measurement OMOP:19476017 - TP53 on GRCh38 chr17: Substitution in position 7675178 of A replaced by T measurement OMOP:19476031 - del(12)(q13q14) measurement OMOP:19476033 - del(12)(q14q14) measurement OMOP:19476093 - SPEN transcript: Deletion in position 10966 measurement OMOP:19476124 - BCOR transcript: Deletion in position 856 measurement OMOP:19476281 - dup(8)(q22q24) measurement OMOP:19476325 - i(14)(q10) measurement OMOP:19476342 - del(9)(q12q21) measurement OMOP:19476387 - t(5;17)(q33;p13) measurement OMOP:19476531 - t(17;17)(q21;q21) measurement OMOP:19476554 - t(3;11)(q12;q23) measurement OMOP:19476582 - t(5;6)(q33;q23) measurement OMOP:19476615 - t(8;13)(q24;q14) measurement OMOP:19476815 - BCL9L transcript: Deletion in position 3972 measurement OMOP:19476858 - ARID1A transcript: Deletion in position 6669 measurement OMOP:19476891 - SETD2 transcript: Deletion in position 2625 measurement OMOP:19477014 - NOTCH1 transcript: Deletion in position 6532 measurement OMOP:19477119 - VHL protein: Frameshift substitution in position 178 of L replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19477127 - PTEN transcript: Deletion in position 68 measurement OMOP:19477137 - ACVR2A protein: Frameshift substitution in position 182 of P replaced by H followed by a new reading frame extending for 6 amino acids measurement OMOP:19477168 - KMT2D on GRCh38 chr12: Substitution in position 49034419 of C replaced by A measurement OMOP:19477333 - GATA3 on GRCh38 chr10: Substitution in position 8073883 of A replaced by T measurement OMOP:19477448 - TBL1XR1 on GRCh38 chr3: Insertion in position 177051672 to 177051673 of AGGGTAGC measurement OMOP:19477586 - FAT1 transcript: Deletion in position 5773 measurement OMOP:19477628 - SMARCD1 on GRCh38 chr12: Substitution in position 50087378 of C replaced by T measurement OMOP:19477663 - APC transcript: Substitution in position 5098 of G replaced by A measurement OMOP:19477725 - PTPN11 on GRCh38 chr12: Substitution in position 112489084 of G replaced by A measurement OMOP:19477858 - GPC3 protein: Substitution in position 199 of R replaced by an early stop codon measurement OMOP:19477935 - MED12 protein: Substitution in position 81 of L replaced by an early stop codon measurement OMOP:19477979 - NF1 on GRCh38 chr17: Deletion in position 31200552 to 31200553 measurement OMOP:19477988 - JAK2 on GRCh38 chr9: Substitution in position 5077625 of T replaced by A measurement OMOP:19478216 - ELF3 protein: Frameshift substitution in position 211 of D replaced by R followed by a new reading frame extending for 6 amino acids measurement OMOP:19478336 - CDH11 transcript: Substitution in position 613 of C replaced by T measurement OMOP:19478451 - POLE on GRCh38 chr12: Substitution in position 132673583 of G replaced by A measurement OMOP:19478481 - ATM protein: Frameshift substitution in position 569 of S replaced by R followed by a new reading frame extending for 4 amino acids measurement OMOP:19478498 - KMT2C protein: Frameshift substitution in position 3147 of Q replaced by T followed by a new reading frame extending for 15 amino acids measurement OMOP:19478537 - FLT3 on GRCh38 chr13: Substitution in position 28018491 of A replaced by T measurement OMOP:19478552 - SOCS1 protein: Frameshift substitution in position 76 of A replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19478578 - FGFR1 on GRCh38 chr8: Substitution in position 38414771 of G replaced by A measurement OMOP:19478705 - KCNJ5 protein: Substitution in position 168 of L replaced by R measurement OMOP:19478720 - BRCA2 transcript: Substitution in position 7681 of C replaced by T measurement OMOP:194788 - Open wound of anterior abdominal wall with complication OMOP:19478847 - FAT1 transcript: Substitution in position 10679 of C replaced by G measurement OMOP:19479141 - ASXL1 on GRCh38 chr20: Substitution in position 32435101 of G replaced by T measurement OMOP:19479156 - TERT on GRCh38 chr5: Substitution in position 1293663 of A replaced by G measurement OMOP:19479279 - BCOR on GRCh38 chrX: Duplication of position 40054284 measurement OMOP:19479300 - STAG1 on GRCh38 chr3: Substitution in position 136472479 of G replaced by C measurement OMOP:19479312 - APC on GRCh38 chr5: Substitution in position 112839775 of A replaced by G measurement OMOP:19479359 - CCNB1IP1 protein: Substitution in position 261 of E replaced by an early stop codon measurement OMOP:19479607 - APC on GRCh38 chr5: Substitution in position 112840759 of A replaced by G measurement OMOP:19479920 - APC on GRCh38 chr5: Substitution in position 112840354 of C replaced by A measurement OMOP:19479961 - ATRX on GRCh38 chrX: Substitution in position 77633684 of A replaced by T measurement OMOP:19480113 - SPEN transcript: Substitution in position 7240 of G replaced by T measurement OMOP:19480233 - BRIP1 transcript: Substitution in position 484 of C replaced by T measurement OMOP:19480255 - MSH2 transcript: Substitution in position 1384 of C replaced by T measurement OMOP:19480261 - EGFR on GRCh38 chr7: [Deletion in position 55174772 to 55174786; 55174789C=] OMOP:19480269 - FGFR1 transcript: Substitution in position 449-8 of C replaced by A measurement OMOP:19480275 - TCF3 protein: Substitution in position 148 of Q replaced by an early stop codon measurement OMOP:19480292 - CREBBP transcript: Substitution in position 3494 of G replaced by A measurement OMOP:19480389 - ERBB2 on GRCh38 chr17: Substitution in position 39707176 of T replaced by A measurement OMOP:19480390 - CTCF transcript: Substitution in position 538 of C replaced by T measurement OMOP:19480555 - TET2 on GRCh38 chr4: Substitution in position 105235872 of C replaced by T measurement OMOP:19480666 - BARD1 protein: Substitution in position 744 of N replaced by D measurement OMOP:19480668 - EPAS1 on GRCh38 chr2: Deletion in position 46382539 measurement OMOP:19480734 - PRKAR1A transcript: Substitution in position 124 of C replaced by T measurement OMOP:19480739 - BAP1 protein: Substitution in position 454 of E replaced by an early stop codon measurement OMOP:19480967 - FAT4 protein: Frameshift substitution in position 3557 of T replaced by P followed by a new reading frame extending for 6 amino acids measurement OMOP:19481040 - SOCS1 protein: Frameshift substitution in position 164 of A replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19481084 - SH2B3 protein: Substitution in position 417 of S replaced by an early stop codon measurement OMOP:19481090 - MAP3K1 transcript: Substitution in position 742 of C replaced by T measurement OMOP:19481321 - MAX on GRCh38 chr14: Substitution in position 65077922 of C replaced by A measurement OMOP:19481427 - KMT2D on GRCh38 chr12: Deletion in position 49037441 to 49037457 measurement OMOP:19481527 - CDKN2A protein: Frameshift substitution in position 89 of G replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19481541 - ARID1A on GRCh38 chr1: Substitution in position 26774782 of C replaced by T measurement OMOP:19481561 - RECQL4 on GRCh38 chr8: Deletion in position 144513234 measurement OMOP:19481592 - TNFAIP3 protein: Frameshift substitution in position 662 of C replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19481774 - TSC2 transcript: Substitution in position 4864 of G replaced by A measurement OMOP:19481865 - FAT1 on GRCh38 chr4: Substitution in position 186600288 of G replaced by A measurement OMOP:19481884 - CHD2 on GRCh38 chr15: Substitution in position 92944464 of G replaced by T measurement OMOP:19481910 - PTEN protein: Frameshift substitution in position 233 of R replaced by P followed by a new reading frame extending for 20 amino acids measurement OMOP:19482056 - CDH11 transcript: Substitution in position 2044 of C replaced by T measurement OMOP:19482159 - KMT2D on GRCh38 chr12: Substitution in position 49049800 of G replaced by C measurement OMOP:19482184 - KMT2D protein: Frameshift substitution in position 4596 of G replaced by E followed by a new reading frame extending for 21 amino acids measurement OMOP:19482358 - CDH1 on GRCh38 chr16: Substitution in position 68810236 of G replaced by T measurement OMOP:19482395 - CNOT3 protein: Substitution in position 85 of E replaced by an early stop codon measurement OMOP:19482437 - CDH1 on GRCh38 chr16: Substitution in position 68833359 of G replaced by T measurement OMOP:19482486 - NF1 on GRCh38 chr17: Substitution in position 31200476 of C replaced by T measurement OMOP:19482544 - KMT2D transcript: Substitution in position 5263 of C replaced by T measurement OMOP:19482611 - CASZ1 transcript: Substitution in position 3817 of G replaced by C measurement OMOP:19482715 - TERT on GRCh38 chr5: Substitution in position 1295046 of T replaced by A measurement OMOP:19482768 - LRRC61 on GRCh38 chr7: Substitution in position 150337289 of A replaced by G measurement OMOP:19482782 - CTNNA1 protein: Frameshift substitution in position 357 of R replaced by V followed by a new reading frame extending for 12 amino acids measurement OMOP:19482830 - ARID2 transcript: Substitution in position 787 of G replaced by T measurement OMOP:19482953 - ARID1B transcript: Deletion in position 1293 to 1317 measurement OMOP:19483020 - CEBPA protein: Frameshift substitution in position 16 of S replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19483027 - APC protein: Frameshift substitution in position 1441 of P replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:194831 - Foreign body in stomach OMOP:19483155 - COL4A5 protein: Substitution in position 475 of G replaced by S measurement OMOP:19483275 - PTCH1 transcript: Substitution in position 3889 of C replaced by T measurement OMOP:19483588 - TET2 transcript: Duplication of position 2962 to 2965 measurement OMOP:19642994 - t(9;13)(q31;q14) measurement OMOP:19483620 - RET protein: Substitution in position 783 of N replaced by S measurement OMOP:19483661 - NF1 transcript: Insertion in position 662 to 663 of T measurement OMOP:19483662 - ACVR2A transcript: Insertion in position 289 to 290 of C measurement OMOP:19483665 - NF1 protein: Substitution in position 798 of K replaced by Q measurement OMOP:19483792 - MSH6 transcript: Substitution in position 2695 of G replaced by T measurement OMOP:19483955 - DNMT3A transcript: Deletion in position 2253 measurement OMOP:19484069 - MSH6 on GRCh38 chr2: Deletion in position 47804987 to 47804988 measurement OMOP:19484128 - TET2 protein: Substitution in position 1758 of S replaced by an early stop codon measurement OMOP:19484176 - ELF3 on GRCh38 chr1: Duplication of position 202011977 measurement OMOP:19484294 - ATR on GRCh38 chr3: Substitution in position 142459026 of C replaced by A measurement OMOP:19484325 - CDKN2A protein: Frameshift substitution in position 80 of R replaced by D followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19484432 - ZNF480 on GRCh38 chr19: Substitution in position 52322086 of G replaced by T measurement OMOP:19484452 - ZMYM3 transcript: Substitution in position 199 of G replaced by T measurement OMOP:19484490 - AXIN1 on GRCh38 chr16: Deletion in position 346239 measurement OMOP:19484555 - KMT2C protein: Substitution in position 2550 of Q replaced by an early stop codon measurement OMOP:19484579 - GATA3 transcript: Deletion in position 1092 to 1109 and Insertion of G measurement OMOP:19484663 - ROS1 transcript: Substitution in position 5349-693 of G replaced by A measurement OMOP:19484713 - GATA3 transcript: Duplication of position 999 measurement OMOP:19484923 - POLE protein: Substitution in position 1426 of V replaced by I measurement OMOP:19484940 - BUB1B protein: Substitution in position 192 of Q replaced by an early stop codon measurement OMOP:19484960 - PTCH1 protein: Frameshift substitution in position 1055 of I replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19484963 - SMARCA4 protein: Frameshift substitution in position 1085 of L replaced by Q followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19485026 - TMPRSS2 protein: Substitution in position 119 of E replaced by an early stop codon measurement OMOP:19485066 - GATA1 transcript: Deletion in position 664 to 670 measurement OMOP:19485069 - RBM10 on GRCh38 chrX: Deletion in position 47182284 measurement OMOP:19485165 - PTEN on GRCh38 chr10: Substitution in position 87957942 of G replaced by T measurement OMOP:19485195 - FAT1 on GRCh38 chr4: Substitution in position 186708888 of C replaced by A measurement OMOP:19485238 - NOTCH2 on GRCh38 chr1: Deletion in position 119923687 to 119923688 measurement OMOP:19485277 - EP300 on GRCh38 chr22: Deletion in position 41177330 to 41177334 measurement OMOP:19485281 - KDM6A protein: Substitution in position 584 of S replaced by an early stop codon measurement OMOP:19485427 - ARID2 on GRCh38 chr12: Substitution in position 45891889 of C replaced by T measurement OMOP:19485492 - ARID2 transcript: Deletion in position 200 measurement OMOP:19485551 - VHL protein: Frameshift substitution in position 133 of T replaced by M followed by a new reading frame extending for 26 amino acids measurement OMOP:19485588 - STAT3 on GRCh38 chr17: Substitution in position 42323045 of T replaced by C measurement OMOP:19485726 - PTEN transcript: Deletion in position 389 to 395 measurement OMOP:19485748 - KMT2D protein: Substitution in position 2438 of S replaced by an early stop codon measurement OMOP:19485845 - EP300 protein: Substitution in position 341 of Q replaced by an early stop codon measurement OMOP:19485865 - POLD1 transcript: Substitution in position 1240 of A replaced by T measurement OMOP:19485959 - STAG2 protein: Frameshift substitution in position 221 of L replaced by W followed by a new reading frame extending for 4 amino acids measurement OMOP:19485982 - TENT5C protein: Frameshift substitution in position 170 of V replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19485987 - CDKN2A protein: Frameshift substitution in position 57 of A replaced by F followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19486068 - FAS on GRCh38 chr10: Duplication of position 89014167 measurement OMOP:19486077 - TET2 transcript: Substitution in position 4748 of C replaced by A measurement OMOP:19486089 - MEN1 on GRCh38 chr11: Deletion in position 64804516 measurement OMOP:19486150 - ARID1A protein: Substitution in position 172 of Q replaced by an early stop codon measurement OMOP:19486202 - CDKN2A transcript: Duplication of position 286 measurement OMOP:19486246 - VHL on GRCh38 chr3: Deletion in position 10142177 to 10142178 and Insertion of T measurement OMOP:19486489 - APC protein: Frameshift substitution in position 1439 of P replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19486591 - BCL9L protein: Substitution in position 713 of Q replaced by an early stop codon measurement OMOP:19486593 - KMT2D transcript: Duplication of position 3596 measurement OMOP:19486668 - DENND4B protein: Substitution in position 908 of Q replaced by E measurement OMOP:19486674 - PHF6 on GRCh38 chrX: Insertion in position 134377697 to 134377698 of G measurement OMOP:19486752 - TSC1 on GRCh38 chr9: Duplication of position 132902692 measurement OMOP:19486832 - ZNRF3 protein: Frameshift substitution in position 121 of V replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19486970 - PRDM1 transcript: Deletion in position 575 to 581 measurement OMOP:19487010 - PTPRD transcript: Substitution in position 1093 of G replaced by T measurement OMOP:19487020 - BRCA2 transcript: Deletion in position 2200 to 2209 measurement OMOP:19487026 - KDM6A transcript: Duplication of position 1804 measurement OMOP:19487030 - KDM6A on GRCh38 chrX: Substitution in position 45063443 of C replaced by T measurement OMOP:19487101 - TET2 on GRCh38 chr4: Substitution in position 105235633 of G replaced by A measurement OMOP:19487202 - WT1 protein: Frameshift substitution in position 375 of R replaced by D followed by a new reading frame extending for 6 amino acids measurement OMOP:19487223 - CDH1 protein: Frameshift substitution in position 166 of N replaced by K followed by a new reading frame extending for 2 amino acids measurement OMOP:19487231 - PLCG1 protein: Substitution in position 1165 of D replaced by V measurement OMOP:19487258 - ARHGEF10 protein: Substitution in position 614 of R replaced by an early stop codon measurement OMOP:19487422 - DAXX protein: Frameshift substitution in position 86 of P replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19487464 - ACVR1B on GRCh38 chr12: Substitution in position 51976533 of C replaced by T measurement OMOP:19487648 - CDH1 on GRCh38 chr16: Deletion in position 68822042 measurement OMOP:19487679 - APC protein: Substitution in position 1065 of Q replaced by an early stop codon measurement OMOP:19487735 - SMARCA4 transcript: Substitution in position 4624 of G replaced by T measurement OMOP:19487742 - DDX3X on GRCh38 chrX: Substitution in position 41342522 of C replaced by G measurement OMOP:19487845 - HNF1A transcript: Duplication of position 189 to 198 measurement OMOP:19487960 - ATM transcript: Deletion in position 8534 to 8535 and Insertion of AA measurement OMOP:19488154 - TP53 transcript: Duplication of position 216 to 217 measurement OMOP:19488227 - CDH1 protein: Frameshift substitution in position 793 of S replaced by C followed by a new reading frame extending for 13 amino acids measurement OMOP:19488240 - CSMD3 transcript: Substitution in position 10525 of G replaced by T measurement OMOP:19488258 - TP53 transcript: Deletion in position 481 measurement OMOP:19488262 - CDKN2A transcript: Duplication of position 18 measurement OMOP:19488319 - WRN on GRCh38 chr8: Substitution in position 31081129 of G replaced by T measurement OMOP:19488432 - BAP1 transcript: Substitution in position 133 of G replaced by T measurement OMOP:19488461 - MAP3K13 transcript: Deletion in position 1164 to 1165 measurement OMOP:19488501 - TP53 on GRCh38 chr17: Deletion in position 7673717 measurement OMOP:19488521 - DDX3X on GRCh38 chrX: Duplication of position 41337442 measurement OMOP:19488541 - ASXL2 transcript: Substitution in position 974 of C replaced by A measurement OMOP:19488613 - VHL on GRCh38 chr3: Deletion in position 10142015 to 10142025 measurement OMOP:19488661 - KMT2D transcript: Deletion in position 1966 measurement OMOP:19488718 - APC protein: Substitution in position 1317 of E replaced by an early stop codon measurement OMOP:19489012 - WNK2 protein: Substitution in position 540 of Q replaced by an early stop codon measurement OMOP:19489035 - PTCH1 protein: Frameshift substitution in position 904 of K replaced by L followed by a new reading frame extending for 21 amino acids measurement OMOP:19489047 - BCOR protein: Frameshift substitution in position 1050 of D replaced by G followed by a new reading frame extending for 4 amino acids measurement OMOP:19489070 - KMT2D transcript: Substitution in position 4291 of G replaced by T measurement OMOP:19489117 - BAP1 protein: Frameshift substitution in position 699 of R replaced by A followed by a new reading frame extending for 17 amino acids measurement OMOP:19489302 - CUL3 on GRCh38 chr2: Deletion in position 224478255 measurement OMOP:19489395 - CIC protein: Frameshift substitution in position 1687 of V replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19489474 - TNFAIP3 on GRCh38 chr6: Substitution in position 137871471 of A replaced by T measurement OMOP:19489488 - KMT2D on GRCh38 chr12: Substitution in position 49032524 of C replaced by A measurement OMOP:19489520 - SOCS1 protein: Frameshift substitution in position 139 of G replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19489624 - SPEN transcript: Duplication of position 10532 measurement OMOP:19489720 - PTEN on GRCh38 chr10: Deletion in position 87957968 to 87957969 measurement OMOP:19489769 - CHEK2 protein: Substitution in position 351 of E replaced by K measurement OMOP:19489799 - CREBBP on GRCh38 chr16: Deletion in position 3731878 measurement OMOP:19489822 - AKT1 on GRCh38 chr14: Substitution in position 104773991 of G replaced by A measurement OMOP:19489900 - CDH1 transcript: Duplication of position 2231 measurement OMOP:19489904 - SH2B3 on GRCh38 chr12: Deletion in position 111448102 and Insertion of GT measurement OMOP:19489937 - ARHGAP5 on GRCh38 chr14: Substitution in position 32091910 of A replaced by G measurement OMOP:19490013 - ZMYM3 on GRCh38 chrX: Substitution in position 71250082 of G replaced by A measurement OMOP:19490019 - TP53 transcript: Deletion in position 408 measurement OMOP:19490049 - OR2A14 protein: Substitution in position 176 of F replaced by Y measurement OMOP:19490205 - RHOA on GRCh38 chr3: Deletion in position 49368453 to 49368466 measurement OMOP:19490267 - TP53 on GRCh38 chr17: Duplication of position 7674915 to 7674918 measurement OMOP:19642997 - t(9;14)(p11;q32) measurement OMOP:19490359 - APC protein: Substitution in position 1252 of S replaced by F measurement OMOP:19490365 - VHL on GRCh38 chr3: Insertion in position 10146546 to 10146547 of T measurement OMOP:19490460 - NOTCH1 transcript: Deletion in position 5353 measurement OMOP:19490463 - TBX3 on GRCh38 chr12: Insertion in position 114676428 to 114676429 of TCTT measurement OMOP:19490473 - TP53 transcript: Substitution in position 761 of T replaced by A measurement OMOP:19490577 - VHL on GRCh38 chr3: Deletion in position 10142082 measurement OMOP:19490640 - RBM10 protein: Substitution in position 531 of S replaced by an early stop codon measurement OMOP:19490720 - ATM on GRCh38 chr11: Substitution in position 108271372 of C replaced by T measurement OMOP:19490902 - IRS4 protein: Frameshift substitution in position 592 of K replaced by Q followed by a new reading frame extending for 12 amino acids measurement OMOP:19490969 - KEAP1 transcript: Substitution in position 1321 of G replaced by T measurement OMOP:19490982 - SETD2 transcript: Insertion in position 1712 to 1713 of G measurement OMOP:19490995 - APC protein: Frameshift substitution in position 1353 of E replaced by D followed by a new reading frame extending for 21 amino acids measurement OMOP:19491117 - TSC2 protein: Substitution in position 1713 of R replaced by H measurement OMOP:19491190 - TET2 on GRCh38 chr4: Deletion in position 105235270 to 105235271 measurement OMOP:19491240 - CEBPA transcript: Deletion in position 98 to 99 measurement OMOP:19491241 - NOTCH2 transcript: Deletion in position 7259 to 7260 measurement OMOP:19491242 - NOTCH2 on GRCh38 chr1: Substitution in position 119953609 of G replaced by A measurement OMOP:19491422 - SFRP4 protein: Substitution in position 287 of W replaced by an early stop codon measurement OMOP:19491478 - AMER1 transcript: Deletion in position 2609 measurement OMOP:19491520 - TP53 transcript: Deletion in position 846 measurement OMOP:19491532 - BRCA2 transcript: Deletion in position 7085 measurement OMOP:19491565 - CREBBP transcript: Insertion in position 93 to 94 of CATGG measurement OMOP:19491576 - BRCA2 protein: Substitution in position 1180 of K replaced by R measurement OMOP:19491727 - SETD2 transcript: Substitution in position 7482 of C replaced by A measurement OMOP:19491864 - RUNX1 transcript: Deletion in position 469 measurement OMOP:19491944 - APC protein: Substitution in position 1069 of R replaced by G measurement OMOP:19491946 - ACVR2A transcript: Deletion in position 1327 to 1328 measurement OMOP:19491994 - TET2 transcript: Substitution in position 1776 of T replaced by G measurement OMOP:19492034 - TET2 protein: Frameshift substitution in position 962 of Q replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19492096 - MAP2K4 protein: Frameshift substitution in position 322 of K replaced by T followed by a new reading frame extending for 6 amino acids measurement OMOP:19492100 - RAC1 protein: Substitution in position 29 of P replaced by R measurement OMOP:19492116 - APC on GRCh38 chr5: Deletion in position 112837615 measurement OMOP:19492137 - APC protein: Substitution in position 74 of E replaced by an early stop codon measurement OMOP:19492202 - LARP4B protein: Frameshift substitution in position 137 of L replaced by A followed by a new reading frame extending for 2 amino acids measurement OMOP:19492215 - JAK1 protein: Substitution in position 545 of Q replaced by an early stop codon measurement OMOP:19492223 - KMT2D protein: Frameshift substitution in position 3821 of Q replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19492234 - TET2 transcript: Duplication of position 1251 measurement OMOP:19492238 - CPEB3 protein: Substitution in position 183 of Q replaced by an early stop codon measurement OMOP:19492251 - TET2 transcript: Substitution in position 5750 of G replaced by A measurement OMOP:19492298 - BCL9L on GRCh38 chr11: Substitution in position 118901855 of G replaced by A measurement OMOP:19492573 - APC transcript: Substitution in position 2306 of T replaced by A measurement OMOP:19492775 - RB1 protein: Frameshift substitution in position 417 of K replaced by W followed by a new reading frame extending for 23 amino acids measurement OMOP:19492966 - DDX10 protein: Frameshift substitution in position 365 of R replaced by E followed by a new reading frame extending for 20 amino acids measurement OMOP:19492978 - APC protein: Substitution in position 997 of Y replaced by an early stop codon measurement OMOP:19493018 - TP53 protein: Frameshift substitution in position 202 of R replaced by A followed by a new reading frame extending for 7 amino acids measurement OMOP:19493026 - CREBBP transcript: Substitution in position 4348 of T replaced by G measurement OMOP:19493035 - APC on GRCh38 chr5: Deletion in position 112828935 to 112828936 measurement OMOP:19493057 - NF1 protein: Substitution in position 82 of S replaced by F measurement OMOP:19493216 - TBX3 on GRCh38 chr12: Duplication of position 114677654 measurement OMOP:19493252 - PTCH1 transcript: Substitution in position 384 of G replaced by A measurement OMOP:19493331 - BIRC3 protein: Frameshift substitution in position 434 of R replaced by S followed by a new reading frame extending for 3 amino acids measurement OMOP:19493367 - FEN1 transcript: Duplication of position 1037 to 1038 measurement OMOP:19493540 - WNK2 protein: Frameshift substitution in position 1963 of L replaced by S followed by a new reading frame extending for 17 amino acids measurement OMOP:19493559 - KMT2D transcript: Deletion in position 3902 to 3903 measurement OMOP:19493706 - TP53 on GRCh38 chr17: Insertion in position 7675206 to 7675207 of A measurement OMOP:19493745 - CIC protein: Substitution in position 1703 of S replaced by an early stop codon measurement OMOP:19493867 - KMT2D on GRCh38 chr12: Substitution in position 49038613 of G replaced by A measurement OMOP:19493941 - ARID1A on GRCh38 chr1: Deletion in position 26731451 measurement OMOP:19493977 - B2M on GRCh38 chr15: Substitution in position 44715447 of C replaced by G measurement OMOP:19494039 - ZRSR2 protein: Frameshift substitution in position 40 of S replaced by F followed by a new reading frame extending for 15 amino acids measurement OMOP:19494213 - RECQL4 transcript: Insertion in position 1634 to 1635 of TGGCC measurement OMOP:19494405 - TNFAIP3 on GRCh38 chr6: Duplication of position 137877131 measurement OMOP:19494441 - PTPRD transcript: Substitution in position 1981 of G replaced by T measurement OMOP:19494509 - CREBBP transcript: Substitution in position 2887 of C replaced by T measurement OMOP:19494666 - MTOR protein: Substitution in position 273 of R replaced by Q measurement OMOP:19494674 - NF1 protein: Frameshift substitution in position 2061 of T replaced by I followed by a new reading frame extending for 9 amino acids measurement OMOP:19494713 - FAT4 transcript: Substitution in position 11251 of C replaced by T measurement OMOP:19494723 - APC on GRCh38 chr5: Deletion in position 112821947 to 112821951 measurement OMOP:19494827 - BARD1 protein: Substitution in position 103 of S replaced by N measurement OMOP:19494836 - FAS on GRCh38 chr10: Substitution in position 89014128 of T replaced by A measurement OMOP:19494845 - MTOR on GRCh38 chr1: Substitution in position 11128108 of T replaced by A measurement OMOP:19494880 - VHL protein: Frameshift substitution in position 72 of S replaced by Y followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19495075 - TP53 protein: Frameshift substitution in position 339 of E replaced by P followed by a new reading frame extending for 5 amino acids measurement OMOP:19495079 - CREBBP transcript: Substitution in position 1958 of T replaced by G measurement OMOP:19495081 - LRP1B transcript: Substitution in position 8015 of T replaced by G measurement OMOP:19495103 - NCOR1 transcript: Substitution in position 1609 of G replaced by T measurement OMOP:19495131 - RNF43 transcript: Substitution in position 1276 of C replaced by T measurement OMOP:19495165 - SPEN transcript: Substitution in position 373 of C replaced by T measurement OMOP:19495180 - ROBO2 protein: Substitution in position 154 of C replaced by an early stop codon measurement OMOP:19495261 - CBLB on GRCh38 chr3: Deletion in position 105776487 measurement OMOP:19495392 - FAT1 on GRCh38 chr4: Substitution in position 186618782 of C replaced by A measurement OMOP:19495433 - CEBPA transcript: Insertion in position 477 to 478 of GTCCCCC measurement OMOP:19495685 - TET2 transcript: Deletion in position 2735 measurement OMOP:19495703 - ZMYM3 protein: Frameshift substitution in position 1098 of R replaced by V followed by a new reading frame extending for 22 amino acids measurement OMOP:19495761 - ARID1B protein: Substitution in position 1588 of W replaced by an early stop codon measurement OMOP:19495844 - KMT2C protein: Frameshift substitution in position 3285 of Q replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19495846 - RBM10 protein: Substitution in position 54 of K replaced by an early stop codon measurement OMOP:19495963 - RPL5 on GRCh38 chr1: Deletion in position 92834838 to 92834857 measurement OMOP:19496066 - BRCA1 on GRCh38 chr17: Duplication of position 43104239 measurement OMOP:19496108 - PTEN transcript: Deletion in position 777 measurement OMOP:19496150 - MSH6 protein: Substitution in position 417 of K replaced by an early stop codon measurement OMOP:19496238 - KMT2D on GRCh38 chr12: Deletion in position 49042159 measurement OMOP:19496321 - VHL protein: Substitution in position 82 of R replaced by P measurement OMOP:19496339 - SPEN protein: Frameshift substitution in position 1073 of S replaced by C followed by a new reading frame extending for 21 amino acids measurement OMOP:19496345 - BARD1 transcript: Substitution in position 1976 of G replaced by A measurement OMOP:19496444 - PTPN13 on GRCh38 chr4: Substitution in position 86785272 of G replaced by T measurement OMOP:19496445 - CBFA2T3 transcript: Duplication of position 285 measurement OMOP:19496538 - EXT1 on GRCh38 chr8: Substitution in position 118110791 of G replaced by A measurement OMOP:19496566 - PTEN transcript: Duplication of position 955 to 958 measurement OMOP:19496597 - TET2 on GRCh38 chr4: Substitution in position 105236588 of C replaced by A measurement OMOP:19496619 - SMAD4 protein: Substitution in position 252 of G replaced by an early stop codon measurement OMOP:19496634 - CIITA protein: Substitution in position 968 of S replaced by an early stop codon measurement OMOP:19496685 - PTPRB protein: Substitution in position 297 of G replaced by an early stop codon measurement OMOP:19496692 - BRCA1 on GRCh38 chr17: Substitution in position 43092959 of G replaced by A measurement OMOP:19496816 - ARID1A transcript: Deletion in position 110 measurement OMOP:19496848 - KDM6A transcript: Substitution in position 3938 of T replaced by A measurement OMOP:19496904 - KDM6A on GRCh38 chrX: Deletion in position 45070092 to 45070099 measurement OMOP:19497024 - CREBBP on GRCh38 chr16: Substitution in position 3792055 of C replaced by T measurement OMOP:19497029 - PTCH1 transcript: Substitution in position 2095 of C replaced by T measurement OMOP:19497031 - ATM protein: Substitution in position 522 of E replaced by an early stop codon measurement OMOP:19497048 - APC on GRCh38 chr5: [Deletion in position 112839514 and insertion of ; Deletion in position 112839517 to 112839518; Duplication of position 112839519] OMOP:19497105 - CNBP on GRCh38 chr3: Substitution in position 129171676 of C replaced by A measurement OMOP:19497118 - NOTCH1 transcript: Insertion in position 7180 to 7181 of T measurement OMOP:19497182 - BRCA2 on GRCh38 chr13: Deletion in position 32339877 to 32339878 and Insertion of T measurement OMOP:19497196 - COL4A5 transcript: Substitution in position 3685 of G replaced by A measurement OMOP:19497266 - ARID1A on GRCh38 chr1: Duplication of position 26779082 measurement OMOP:19497316 - EZH2 on GRCh38 chr7: Substitution in position 148832659 of C replaced by T measurement OMOP:19497349 - CDH10 on GRCh38 chr5: Duplication of position 24488116 measurement OMOP:19497368 - ERBB4 protein: Substitution in position 900 of Q replaced by an early stop codon measurement OMOP:19497397 - EGFR transcript: [Deletion in position 2235 to 2246; Substitution in position 2249 of C replaced by A; 2252C=] OMOP:19497461 - TSC2 transcript: Substitution in position 3259 of G replaced by T measurement OMOP:19497546 - CREBBP on GRCh38 chr16: Substitution in position 3781259 of G replaced by A measurement OMOP:19497727 - CDK12 protein: Frameshift substitution in position 601 of S replaced by L followed by a new reading frame extending for 9 amino acids measurement OMOP:19497817 - NF2 transcript: Deletion in position 89 to 110 measurement OMOP:19498004 - TP53 on GRCh38 chr17: Deletion in position 7676205 to 7676211 measurement OMOP:19498024 - FOXO3 protein: Frameshift substitution in position 505 of S replaced by L followed by a new reading frame extending for 10 amino acids measurement OMOP:19498025 - TSC2 transcript: Substitution in position 4747 of G replaced by T measurement OMOP:19498064 - ATRX on GRCh38 chrX: Substitution in position 77683830 of G replaced by A measurement OMOP:19498079 - KIT transcript: Deletion in position 1652 to 1666 measurement OMOP:19498122 - BCOR protein: Frameshift substitution in position 693 of P replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19498137 - WT1 on GRCh38 chr11: Deletion in position 32389083 to 32389084 measurement OMOP:19498162 - GATA1 transcript: Deletion in position 180 to 205 measurement OMOP:19498213 - ETV6 transcript: Deletion in position 964 to 965 measurement OMOP:19498243 - ZFHX3 transcript: Duplication of position 5044 measurement OMOP:19498253 - APC on GRCh38 chr5: Deletion in position 112819283 measurement OMOP:19498257 - ARID1A on GRCh38 chr1: Duplication of position 26779613 measurement OMOP:19498267 - POLD1 on GRCh38 chr19: Deletion in position 50409191 measurement OMOP:19498295 - PIK3R1 transcript: Insertion in position 463 to 464 of TT measurement OMOP:19498299 - APC transcript: Substitution in position 157 of G replaced by T measurement OMOP:19498318 - PTCH1 protein: Substitution in position 1163 of G replaced by V measurement OMOP:19498462 - CDKN2A protein: Substitution in position 23 of G replaced by S measurement OMOP:19498568 - BCOR transcript: Substitution in position 4794 of G replaced by A measurement OMOP:19498596 - CHEK2 protein: Substitution in position 414 of G replaced by R measurement OMOP:19498652 - CUX1 protein: Frameshift substitution in position 714 of R replaced by A followed by a new reading frame extending for 15 amino acids measurement OMOP:19498691 - NTRK1 transcript: Deletion in position 1961 to 1965 measurement OMOP:19498954 - WT1 protein: Frameshift substitution in position 469 of D replaced by K followed by a new reading frame extending for 18 amino acids measurement OMOP:19498975 - RUNX1 on GRCh38 chr21: Duplication of position 34799401 to 34799402 measurement OMOP:19498993 - FBXW7 transcript: Duplication of position 871 measurement OMOP:19499047 - RBM10 protein: Substitution in position 255 of Q replaced by an early stop codon measurement OMOP:19499048 - ATP2B3 transcript: Substitution in position 1027 of G replaced by T measurement OMOP:19499078 - CDKN1A transcript: Deletion in position 46 to 47 measurement OMOP:19499091 - BRCA2 transcript: Substitution in position 8245 of C replaced by T measurement OMOP:19499355 - APC on GRCh38 chr5: Deletion in position 112839643 to 112839644 measurement OMOP:19499444 - FAT1 protein: Frameshift substitution in position 2416 of D replaced by E followed by a new reading frame extending for 9 amino acids measurement OMOP:19499469 - SOCS1 protein: Frameshift substitution in position 51 of G replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19499481 - PTPRB protein: Substitution in position 1653 of E replaced by an early stop codon measurement OMOP:19499491 - CCN2 transcript: Substitution in position 247 of C replaced by G measurement OMOP:19499625 - RB1 transcript: Deletion in position 810 measurement OMOP:19499649 - ARID1A transcript: Deletion in position 6735 measurement OMOP:19499695 - TP53 on GRCh38 chr17: Insertion in position 7673740 to 7673741 of A measurement OMOP:19499728 - KMT2C transcript: Substitution in position 7486 of G replaced by T measurement OMOP:19499730 - SMARCA4 on GRCh38 chr19: Deletion in position 11060097 to 11060173 measurement OMOP:19499764 - ZFHX3 on GRCh38 chr16: Substitution in position 72950657 of G replaced by A measurement OMOP:19499829 - ARID1A on GRCh38 chr1: Duplication of position 26773684 measurement OMOP:19499913 - ATP1A1 protein: Frameshift substitution in position 100 of F replaced by V followed by a new reading frame extending for 17 amino acids measurement OMOP:19499962 - TSC2 on GRCh38 chr16: Deletion in position 2084573 measurement OMOP:19500008 - PTCH1 transcript: Deletion in position 1581 to 1582 measurement OMOP:19500142 - STK11 protein: Substitution in position 108 of K replaced by an early stop codon measurement OMOP:19500299 - APC on GRCh38 chr5: Duplication of position 112839308 measurement OMOP:19500378 - MLH1 transcript: Deletion in position 1852 to 1854 measurement OMOP:19500635 - APC on GRCh38 chr5: Substitution in position 112839846 of A replaced by G measurement OMOP:19500724 - KMT2D on GRCh38 chr12: Substitution in position 49042167 of C replaced by A measurement OMOP:19500747 - PTEN on GRCh38 chr10: Deletion in position 87864513 to 87864529 measurement OMOP:19500778 - APC on GRCh38 chr5: Deletion in position 112839654 to 112839667 measurement OMOP:19500860 - APC on GRCh38 chr5: Substitution in position 112819321 of G replaced by A measurement OMOP:19500904 - RB1 transcript: Substitution in position 718 of A replaced by T measurement OMOP:19500970 - PTPRC transcript: Duplication of position 2810 measurement OMOP:19500984 - ARID2 on GRCh38 chr12: Substitution in position 45731237 of G replaced by A measurement OMOP:19500995 - CUX1 protein: Substitution in position 61 of Q replaced by an early stop codon measurement OMOP:19501024 - ARID2 transcript: Deletion in position 5025 measurement OMOP:19501072 - TBL1XR1 protein: Substitution in position 395 of Y replaced by D measurement OMOP:19501100 - EGFR protein: Deletion in position 746 to 752 and Insertion of A measurement OMOP:19501169 - ITGAV protein: Substitution in position 775 of R replaced by K measurement OMOP:19501203 - TSC2 protein: Substitution in position 661 of G replaced by S measurement OMOP:19501205 - CUX1 transcript: Deletion in position 2229 measurement OMOP:19501228 - CDKN2A protein: Frameshift substitution in position 21 of A replaced by P followed by a new reading frame extending for 22 amino acids measurement OMOP:19501416 - TP53 on GRCh38 chr17: Substitution in position 7674893 of C replaced by T measurement OMOP:19501529 - APC on GRCh38 chr5: Substitution in position 112838069 of T replaced by G measurement OMOP:19501721 - PMS2 protein: Frameshift substitution in position 41 of E replaced by G followed by a new reading frame extending for 13 amino acids measurement OMOP:19501723 - NOTCH1 protein: Frameshift substitution in position 2531 of D replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19501779 - ATRX protein: Frameshift substitution in position 274 of L replaced by F followed by a new reading frame extending for 8 amino acids measurement OMOP:19501888 - NCOR1 on GRCh38 chr17: Substitution in position 16061418 of G replaced by C measurement OMOP:19501916 - APC on GRCh38 chr5: Deletion in position 112840303 measurement OMOP:19502159 - RSPO2 protein: Substitution in position 150 of W replaced by an early stop codon measurement OMOP:19502236 - APC on GRCh38 chr5: Deletion in position 112838646 measurement OMOP:19502299 - CUX1 transcript: Substitution in position 634 of C replaced by T measurement OMOP:19502327 - WT1 protein: Frameshift substitution in position 373 of V replaced by N followed by a new reading frame extending for 18 amino acids measurement OMOP:19502381 - MAP3K13 on GRCh38 chr3: Substitution in position 185443503 of C replaced by T measurement OMOP:19502456 - LRP1B transcript: Substitution in position 7549 of G replaced by T measurement OMOP:19502748 - RBM10 on GRCh38 chrX: Deletion in position 47176550 measurement OMOP:19502759 - KMT2D transcript: Substitution in position 272 of G replaced by A measurement OMOP:19502836 - BRCA1 on GRCh38 chr17: Substitution in position 43074498 of G replaced by T measurement OMOP:19502843 - JAG1 transcript: Substitution in position 2698 of C replaced by T measurement OMOP:19502861 - RNF43 protein: Substitution in position 59 of G replaced by an early stop codon measurement OMOP:19502915 - FGFR2 on GRCh38 chr10: Substitution in position 121526121 of C replaced by A measurement OMOP:19503146 - BAP1 on GRCh38 chr3: Deletion in position 52402612 measurement OMOP:19503181 - RANBP2 transcript: Duplication of position 972 measurement OMOP:19503212 - APC protein: Substitution in position 1152 of Q replaced by an early stop codon measurement OMOP:19503273 - RB1 transcript: Substitution in position 2136 of C replaced by A measurement OMOP:19503331 - CEBPA protein: Frameshift substitution in position 68 of I replaced by D followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19503524 - PMS2 transcript: Insertion in position 1876 to 1877 of A measurement OMOP:19503623 - STAG2 on GRCh38 chrX: Substitution in position 124045204 of G replaced by A measurement OMOP:19503717 - RB1 transcript: Insertion in position 1841 to 1842 of C measurement OMOP:19503758 - CNTNAP2 on GRCh38 chr7: Substitution in position 147562186 of C replaced by A measurement OMOP:19503894 - MKRN1 transcript: Substitution in position 811 of T replaced by A measurement OMOP:19503904 - KMT2D transcript: Substitution in position 9961 of C replaced by T measurement OMOP:19503906 - ARID2 protein: Substitution in position 923 of Q replaced by an early stop codon measurement OMOP:19503911 - EPAS1 transcript: Deletion in position 2343 to 2364 measurement OMOP:19503919 - ERBB4 transcript: Duplication of position 1399 measurement OMOP:19503927 - NF1 protein: Substitution in position 985 of Q replaced by an early stop codon measurement OMOP:19503988 - DNM2 on GRCh38 chr19: Deletion in position 10830295 measurement OMOP:19504018 - DICER1 on GRCh38 chr14: Duplication of position 95103769 measurement OMOP:19504045 - STAG2 protein: Substitution in position 1238 of S replaced by an early stop codon measurement OMOP:19504105 - CREBBP protein: Substitution in position 2235 of Q replaced by an early stop codon measurement OMOP:19504262 - ZNF628 on GRCh38 chr19: Substitution in position 55481893 of A replaced by G measurement OMOP:19504302 - CHEK2 protein: Substitution in position 202 of F replaced by L measurement OMOP:19504321 - FAT1 protein: Substitution in position 4264 of S replaced by an early stop codon measurement OMOP:19504380 - TSC2 protein: Frameshift substitution in position 853 of L replaced by A followed by a new reading frame extending for 30 amino acids measurement OMOP:19504448 - LATS1 on GRCh38 chr6: Substitution in position 149661881 of G replaced by A measurement OMOP:19504503 - POLE on GRCh38 chr12: Duplication of position 132675745 measurement OMOP:19504521 - ARHGEF10L on GRCh38 chr1: Deletion in position 17607968 to 17607969 and Insertion of TT measurement OMOP:19504569 - ARHGAP35 on GRCh38 chr19: Deletion in position 47000523 measurement OMOP:19504574 - MSH2 protein: Substitution in position 731 of E replaced by an early stop codon measurement OMOP:19504584 - TP53 transcript: Deletion in position 808 to 817 measurement OMOP:19504605 - STAG2 on GRCh38 chrX: Substitution in position 124056219 of G replaced by T measurement OMOP:19504670 - FAT1 transcript: Substitution in position 5723 of C replaced by A measurement OMOP:19504884 - KMT2D protein: Substitution in position 2257 of V replaced by an early stop codon measurement OMOP:19504987 - TSC2 transcript: Substitution in position 994 of G replaced by A measurement OMOP:19505060 - RB1 on GRCh38 chr13: Substitution in position 48463751 of T replaced by A measurement OMOP:19505075 - KDM5C protein: Substitution in position 469 of Y replaced by an early stop codon measurement OMOP:19505087 - STK11 protein: Substitution in position 308 of W replaced by C measurement OMOP:19505192 - BIRC3 on GRCh38 chr11: Duplication of position 102331212 measurement OMOP:19505229 - RBM10 protein: Substitution in position 189 of E replaced by an early stop codon measurement OMOP:19505288 - ARID1A protein: Substitution in position 1777 of E replaced by an early stop codon measurement OMOP:19505295 - NOTCH1 on GRCh38 chr9: Deletion in position 136503207 measurement OMOP:19505441 - DNMT3A transcript: Duplication of position 1920 to 1923 measurement OMOP:19505547 - EWSR1 protein: Substitution in position 572 of R replaced by W measurement OMOP:19505553 - FAT1 on GRCh38 chr4: Substitution in position 186604390 of A replaced by T measurement OMOP:19505559 - EGFR transcript: [Deletion in position 2235 to 2243; 2245G=; 2248G=; Deletion in position 2250 to 2277 and insertion of AACATCTCCGAAAGCCAACAAGGAAATC] OMOP:19505563 - EWSR1 on GRCh38 chr22: Substitution in position 29287497 of T replaced by C measurement OMOP:19505679 - EZH2 on GRCh38 chr7: Duplication of position 148818002 measurement OMOP:19505706 - BRCA1 on GRCh38 chr17: Deletion in position 43092738 measurement OMOP:19505805 - TET2 protein: Frameshift substitution in position 1423 of V replaced by S followed by a new reading frame extending for 25 amino acids measurement OMOP:19505822 - ROS1 on GRCh38 chr6: Deletion in position 117301021 to 117301025 and Insertion of CACTG measurement OMOP:19505909 - PRDM1 transcript: Substitution in position 827 of C replaced by A measurement OMOP:19505914 - SETD2 transcript: Substitution in position 2515 of A replaced by T measurement OMOP:19505958 - FAT1 protein: Substitution in position 4290 of E replaced by an early stop codon measurement OMOP:19505999 - EZH2 transcript: Deletion in position 1048 measurement OMOP:19506254 - STAG2 transcript: Substitution in position 871 of G replaced by T measurement OMOP:19506312 - ASXL1 on GRCh38 chr20: Deletion in position 32431626 measurement OMOP:19506369 - PDGFRB protein: Substitution in position 596 of P replaced by L measurement OMOP:195064 - Perinatal jaundice due to hepatocellular damage OMOP:19506550 - TP53 transcript: Deletion in position 463 measurement OMOP:19506635 - NAB2 transcript: Duplication of position 632 measurement OMOP:19506658 - FOXO4 protein: Substitution in position 468 of Q replaced by an early stop codon measurement OMOP:19506724 - TP53 on GRCh38 chr17: Deletion in position 7675061 measurement OMOP:19506770 - NF2 on GRCh38 chr22: Deletion in position 29673384 measurement OMOP:19506872 - TP63 protein: Frameshift substitution in position 202 of Y replaced by K followed by a new reading frame extending for 29 amino acids measurement OMOP:19507082 - ARID1A protein: Frameshift substitution in position 407 of P replaced by L followed by a new reading frame extending for 26 amino acids measurement OMOP:19507143 - KMT2D on GRCh38 chr12: Duplication of position 49051030 measurement OMOP:195072 - Medullary sponge kidney OMOP:19507241 - LATS1 on GRCh38 chr6: Insertion in position 149683546 to 149683547 of GTGTGTGTGTGTTC measurement OMOP:19507263 - APC on GRCh38 chr5: Insertion in position 112842365 to 112842366 of CCAGCCTCCAAAAGCCC measurement OMOP:19507367 - NOTCH1 on GRCh38 chr9: Deletion in position 136496414 to 136496426 measurement OMOP:19507429 - ATM on GRCh38 chr11: Deletion in position 108235685 to 108235686 measurement OMOP:19507481 - KRAS protein: Substitution in position 146 of A replaced by P measurement OMOP:19507494 - WT1 protein: Substitution in position 413 of L replaced by an early stop codon measurement OMOP:19507581 - CAMTA1 transcript: Substitution in position 1012 of C replaced by T measurement OMOP:19507609 - ARHGEF10 protein: Frameshift substitution in position 381 of A replaced by R followed by a new reading frame extending for 21 amino acids measurement OMOP:19524613 - CDH1 on GRCh38 chr16: Duplication of position 68813387 measurement OMOP:19507708 - TET2 protein: Frameshift substitution in position 1063 of T replaced by Y followed by a new reading frame extending for 5 amino acids measurement OMOP:19507769 - APC on GRCh38 chr5: Substitution in position 112842090 of C replaced by T measurement OMOP:19507904 - IKZF1 protein: Substitution in position 492 of C replaced by an early stop codon measurement OMOP:19507951 - SETD2 protein: Substitution in position 1322 of R replaced by an early stop codon measurement OMOP:19507982 - PTEN transcript: Deletion in position 701 to 702 and Insertion of CCGTTC measurement OMOP:19508096 - POLD1 transcript: Substitution in position 1972 of C replaced by T measurement OMOP:19508172 - NF2 transcript: Deletion in position 500 to 501 measurement OMOP:19508540 - FAT1 transcript: Substitution in position 12340 of C replaced by T measurement OMOP:19508698 - ARID1A on GRCh38 chr1: Deletion in position 26761467 measurement OMOP:19508702 - SETD2 transcript: Deletion in position 6212 to 6216 measurement OMOP:19508862 - PTCH1 transcript: Substitution in position 2529 of G replaced by C measurement OMOP:19508954 - BIRC3 protein: Substitution in position 472 of G replaced by an early stop codon measurement OMOP:19508993 - PHF6 transcript: Deletion in position 481 to 485 measurement OMOP:19509028 - KDM6A transcript: Deletion in position 3316 measurement OMOP:19509127 - ATM transcript: Deletion in position 7198 measurement OMOP:19509210 - APC transcript: Substitution in position 4905 of G replaced by A measurement OMOP:19509238 - PDGFRB on GRCh38 chr5: Substitution in position 150121265 of A replaced by T measurement OMOP:19509460 - ATRX on GRCh38 chrX: Deletion in position 77599555 measurement OMOP:19509484 - CDH1 transcript: Deletion in position 866 measurement OMOP:19509689 - TNFAIP3 transcript: Duplication of position 357 to 360 measurement OMOP:19509698 - CDH1 transcript: Deletion in position 1930 measurement OMOP:19509751 - MAP3K1 transcript: Duplication of position 2210 measurement OMOP:19509791 - RECQL4 protein: Substitution in position 758 of R replaced by an early stop codon measurement OMOP:19509812 - SPEN on GRCh38 chr1: Deletion in position 15930762 measurement OMOP:19509840 - STAG1 protein: Frameshift substitution in position 174 of F replaced by I followed by a new reading frame extending for 7 amino acids measurement OMOP:19509959 - GATA1 protein: Frameshift substitution in position 17 of Q replaced by V followed by a new reading frame extending for 22 amino acids measurement OMOP:19510089 - KMT2D transcript: Deletion in position 4941 to 4945 measurement OMOP:19510107 - ARID2 protein: Frameshift substitution in position 1694 of D replaced by M followed by a new reading frame extending for 7 amino acids measurement OMOP:19510132 - NF1 protein: Substitution in position 1196 of L replaced by F measurement OMOP:19510221 - CDH1 transcript: Duplication of position 497 measurement OMOP:19510354 - BIRC3 transcript: Deletion in position 1594 to 1598 measurement OMOP:19510403 - ATM on GRCh38 chr11: Substitution in position 108272532 of G replaced by A measurement OMOP:19510404 - TNFAIP3 protein: Frameshift substitution in position 626 of L replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19510440 - KNL1 on GRCh38 chr15: Duplication of position 40623463 measurement OMOP:19510508 - TNFRSF14 protein: Substitution in position 151 of Q replaced by an early stop codon measurement OMOP:19510515 - MSH6 transcript: Substitution in position 2194 of C replaced by T measurement OMOP:19510526 - TSC2 protein: Substitution in position 1478 of D replaced by N measurement OMOP:19510556 - ARID1B transcript: Deletion in position 6456 measurement OMOP:19510650 - ZMYM3 transcript: Deletion in position 1195 measurement OMOP:19510651 - ELF3 transcript: Duplication of position 485 to 486 measurement OMOP:19510658 - TP53 protein: Frameshift substitution in position 164 of K replaced by S followed by a new reading frame extending for 6 amino acids measurement OMOP:19510704 - MAP3K1 on GRCh38 chr5: Deletion in position 56875195 measurement OMOP:19510763 - APC transcript: Substitution in position 802 of G replaced by T measurement OMOP:19510840 - MEN1 transcript: Deletion in position 881 measurement OMOP:19510946 - KDM6A on GRCh38 chrX: Insertion in position 45083513 to 45083514 of GTTTGGAT measurement OMOP:19511000 - RAD21 transcript: Insertion in position 661 to 662 of TAAGAATG measurement OMOP:19511036 - ATRX transcript: Deletion in position 4377 to 4378 measurement OMOP:19511046 - ATM transcript: Substitution in position 5249 of G replaced by A measurement OMOP:19511052 - CDKN2A protein: Frameshift substitution in position 70 of P replaced by Q followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19511075 - FAT1 on GRCh38 chr4: Substitution in position 186636773 of G replaced by A measurement OMOP:19511086 - FOXO3 on GRCh38 chr6: Deletion in position 108664804 measurement OMOP:19511279 - ARID1A on GRCh38 chr1: Substitution in position 26732713 of C replaced by G measurement OMOP:19511395 - CDH1 transcript: Deletion in position 1399 to 1400 measurement OMOP:19511434 - APC protein: Substitution in position 682 of G replaced by an early stop codon measurement OMOP:19511718 - FOXO1 transcript: Substitution in position 16 of C replaced by T measurement OMOP:19511933 - CDH1 transcript: Deletion in position 437 to 447 measurement OMOP:19512160 - POLE protein: Substitution in position 911 of Q replaced by an early stop codon measurement OMOP:19512200 - SMARCB1 transcript: Substitution in position 425 of T replaced by G measurement OMOP:19512218 - MAP3K1 protein: Frameshift substitution in position 919 of K replaced by N followed by a new reading frame extending for 2 amino acids measurement OMOP:19512388 - KMT2D on GRCh38 chr12: Insertion in position 49032667 to 49032668 of ACT measurement OMOP:19512468 - NSD1 protein: Substitution in position 2261 of M replaced by T measurement OMOP:19512532 - SETD1B on GRCh38 chr12: Deletion in position 121805182 measurement OMOP:19512554 - RB1 protein: Frameshift substitution in position 123 of N replaced by T followed by a new reading frame extending for 2 amino acids measurement OMOP:19512555 - PTPRD on GRCh38 chr9: Deletion in position 8500897 measurement OMOP:19513010 - PMS2 protein: Substitution in position 160 of Q replaced by an early stop codon measurement OMOP:19513125 - MYC on GRCh38 chr8: Substitution in position 127738434 of A replaced by G measurement OMOP:19513367 - BAP1 protein: Frameshift substitution in position 99 of V replaced by C followed by a new reading frame extending for 3 amino acids measurement OMOP:19513453 - ACVR1B transcript: Duplication of position 829 measurement OMOP:19513456 - GATA3 transcript: Deletion in position 963 to 1003 measurement OMOP:19513484 - ARID1A transcript: Deletion in position 6433 measurement OMOP:19513492 - KMT2C protein: Substitution in position 1889 of S replaced by an early stop codon measurement OMOP:19513575 - NF1 protein: Substitution in position 80 of Y replaced by an early stop codon measurement OMOP:19513596 - CTCF on GRCh38 chr16: Substitution in position 67611349 of G replaced by T measurement OMOP:19513599 - KMT2C protein: Frameshift substitution in position 2576 of A replaced by L followed by a new reading frame extending for 7 amino acids measurement OMOP:19513635 - TERT protein: Substitution in position 726 of T replaced by M measurement OMOP:19513858 - ARID1A transcript: Deletion in position 5351 to 5364 measurement OMOP:19513878 - IRS4 on GRCh38 chrX: Duplication of position 108734579 to 108734580 measurement OMOP:19513982 - EZH2 protein: Substitution in position 113 of W replaced by an early stop codon measurement OMOP:19514010 - CSF1R protein: Substitution in position 301 of L replaced by an early stop codon measurement OMOP:19514124 - RUNX1 transcript: Substitution in position 1431 of G replaced by A measurement OMOP:19514170 - NOTCH2 protein: Frameshift substitution in position 1754 of T replaced by S followed by a new reading frame extending for 11 amino acids measurement OMOP:19514244 - STK11 protein: Frameshift substitution in position 134 of C replaced by W followed by a new reading frame extending for 28 amino acids measurement OMOP:19514413 - RUNX1 on GRCh38 chr21: Duplication of position 34880700 to 34880701 measurement OMOP:19514430 - APC protein: Frameshift substitution in position 835 of S replaced by V followed by a new reading frame extending for 13 amino acids measurement OMOP:19514487 - PTEN protein: Substitution in position 180 of Y replaced by an early stop codon measurement OMOP:19514501 - PTEN protein: Substitution in position 13 of K replaced by an early stop codon measurement OMOP:19514621 - ARID2 on GRCh38 chr12: Deletion in position 45851383 measurement OMOP:19514717 - TET2 protein: Substitution in position 1357 of E replaced by an early stop codon measurement OMOP:19514719 - TP53 protein: Frameshift substitution in position 136 of Q replaced by W followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19514799 - RB1 on GRCh38 chr13: Substitution in position 48373443 of T replaced by A measurement OMOP:19514814 - ARHGAP26 transcript: Substitution in position 826 of G replaced by T measurement OMOP:19514849 - DICER1 transcript: Substitution in position 5563 of C replaced by T measurement OMOP:19514922 - APC transcript: Substitution in position 3677 of A replaced by G measurement OMOP:19514927 - NOTCH1 transcript: Deletion in position 2133 measurement OMOP:19514938 - CDKN1B transcript: Substitution in position 264 of C replaced by G measurement OMOP:19514969 - GATA1 protein: Frameshift substitution in position 11 of T replaced by D followed by a new reading frame extending for 29 amino acids measurement OMOP:19514981 - ARID1A transcript: Insertion in position 954 to 955 of CAGGACGGGGGCGCCGGCAA measurement OMOP:19514989 - MSH6 on GRCh38 chr2: Substitution in position 47800393 of A replaced by T measurement OMOP:19515020 - SETD2 protein: Substitution in position 1496 of R replaced by an early stop codon measurement OMOP:19515139 - STAG2 on GRCh38 chrX: Substitution in position 124050293 of G replaced by A measurement OMOP:19515244 - KMT2D on GRCh38 chr12: Deletion in position 49038840 measurement OMOP:19515428 - ARHGAP35 protein: Frameshift substitution in position 1453 of S replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19515445 - NOTCH1 protein: Substitution in position 1684 of Q replaced by an early stop codon measurement OMOP:19515458 - TGFBR2 protein: Frameshift substitution in position 128 of K replaced by A followed by a new reading frame extending for 3 amino acids measurement OMOP:19515533 - TSC1 on GRCh38 chr9: Substitution in position 132906053 of G replaced by A measurement OMOP:19515598 - ARHGAP35 protein: Frameshift substitution in position 200 of T replaced by S followed by a new reading frame extending for 18 amino acids measurement OMOP:19515667 - FBLN2 transcript: Substitution in position 1009 of G replaced by T measurement OMOP:19515696 - BAP1 transcript: Insertion in position 2084 to 2085 of T measurement OMOP:19515818 - RB1 on GRCh38 chr13: Substitution in position 48465022 of G replaced by T measurement OMOP:19515835 - NOTCH2 transcript: Deletion in position 4810 to 4811 measurement OMOP:19643017 - t(9;17)(q22;q11.2) measurement OMOP:19515896 - SMARCB1 transcript: Substitution in position 153 of G replaced by A measurement OMOP:19515941 - POLQ on GRCh38 chr3: Substitution in position 121498499 of G replaced by A measurement OMOP:19515954 - ZFHX3 protein: Substitution in position 1053 of E replaced by an early stop codon measurement OMOP:19516287 - PTCH1 transcript: Deletion in position 3274 to 3275 and Insertion of TA measurement OMOP:19516502 - CCDC6 on GRCh38 chr10: Substitution in position 59852684 of C replaced by A measurement OMOP:19516506 - NCOR2 transcript: Duplication of position 2538 measurement OMOP:19516721 - ERCC2 protein: Frameshift substitution in position 309 of V replaced by C followed by a new reading frame extending for 25 amino acids measurement OMOP:19516902 - AXIN1 transcript: Substitution in position 1868 of C replaced by A measurement OMOP:19517100 - KMT2C transcript: Substitution in position 9748 of C replaced by T measurement OMOP:19517185 - PRDM1 protein: Frameshift substitution in position 248 of Y replaced by S followed by a new reading frame extending for 4 amino acids measurement OMOP:19517202 - APC transcript: Substitution in position 2388 of T replaced by C measurement OMOP:19517265 - KIT protein: Substitution in position 563 of I replaced by K measurement OMOP:19517434 - ARID1A transcript: Substitution in position 413 of C replaced by G measurement OMOP:19517440 - MSH2 protein: Substitution in position 834 of A replaced by T measurement OMOP:19517478 - BRAF protein: Substitution in position 621 of N replaced by T measurement OMOP:19517501 - GATA3 transcript: Duplication of position 630 measurement OMOP:19517521 - TP53 transcript: Deletion in position 472 to 484 measurement OMOP:19517577 - STAG2 on GRCh38 chrX: Duplication of position 124050204 measurement OMOP:19517619 - MSH2 protein: Substitution in position 859 of E replaced by an early stop codon measurement OMOP:19517620 - POLQ transcript: Substitution in position 6855 of T replaced by A measurement OMOP:19517762 - MAX on GRCh38 chr14: Substitution in position 65077937 of G replaced by A measurement OMOP:19517767 - RB1 on GRCh38 chr13: Duplication of position 48304048 measurement OMOP:19517892 - FAT1 on GRCh38 chr4: Substitution in position 186620863 of G replaced by T measurement OMOP:19517944 - TP53 transcript: Substitution in position 59 of C replaced by G measurement OMOP:19517994 - ATRX protein: Substitution in position 440 of E replaced by an early stop codon measurement OMOP:19518013 - BAP1 on GRCh38 chr3: Substitution in position 52402811 of T replaced by A measurement OMOP:19518035 - FAT1 protein: Substitution in position 992 of E replaced by an early stop codon measurement OMOP:19518087 - CIC on GRCh38 chr19: Deletion in position 42287192 measurement OMOP:19518093 - KMT2C on GRCh38 chr7: Substitution in position 152154423 of G replaced by A measurement OMOP:19518340 - ATRX on GRCh38 chrX: Substitution in position 77683329 of C replaced by A measurement OMOP:19518479 - FGFR3 on GRCh38 chr4: Substitution in position 1804472 of G replaced by C measurement OMOP:19518510 - CDK12 transcript: Duplication of position 1479 measurement OMOP:19518717 - NOTCH2 transcript: Substitution in position 6031 of G replaced by T measurement OMOP:19518948 - KMT2C protein: Frameshift substitution in position 3530 of S replaced by L followed by a new reading frame extending for 3 amino acids measurement OMOP:19519046 - ERBB3 on GRCh38 chr12: Substitution in position 56087664 of A replaced by G measurement OMOP:19519225 - PABPC1 transcript: Insertion in position 467 to 468 of G measurement OMOP:19519393 - STAG2 on GRCh38 chrX: Substitution in position 124086758 of C replaced by T measurement OMOP:19519406 - ARID2 on GRCh38 chr12: Substitution in position 45891865 of G replaced by T measurement OMOP:19519414 - HNF1A on GRCh38 chr12: Deletion in position 120978902 to 120978926 measurement OMOP:19519418 - TP53 transcript: Deletion in position 307 to 322 measurement OMOP:19519463 - FLCN on GRCh38 chr17: Substitution in position 17224033 of C replaced by T measurement OMOP:19519531 - ROS1 protein: Substitution in position 2322 of K replaced by R measurement OMOP:19519582 - MLH1 protein: Substitution in position 31 of A replaced by G measurement OMOP:19519664 - KDM6A transcript: Insertion in position 2072 to 2073 of TA measurement OMOP:19519742 - RUNX1 protein: Frameshift substitution in position 120 of A replaced by V followed by a new reading frame extending for 3 amino acids measurement OMOP:19519753 - CIC on GRCh38 chr19: Duplication of position 42294063 measurement OMOP:19519957 - APC transcript: Substitution in position 8323 of G replaced by A measurement OMOP:19519979 - SMAD3 on GRCh38 chr15: Substitution in position 67181260 of C replaced by A measurement OMOP:19520037 - CDKN2A transcript: Deletion in position 256 measurement OMOP:19520067 - APC protein: Substitution in position 2285 of V replaced by I measurement OMOP:19520213 - PRF1 protein: Substitution in position 425 of W replaced by an early stop codon measurement OMOP:19520416 - TET2 protein: Frameshift substitution in position 1284 of S replaced by M followed by a new reading frame extending for 9 amino acids measurement OMOP:19520567 - CREBBP transcript: Duplication of position 4792 measurement OMOP:19520778 - KMT2C protein: Substitution in position 606 of S replaced by an early stop codon measurement OMOP:19520818 - BAP1 protein: Frameshift substitution in position 615 of M replaced by W followed by a new reading frame extending for 2 amino acids measurement OMOP:19520859 - TP53 protein: Frameshift substitution in position 307 of A replaced by T followed by a new reading frame extending for 29 amino acids measurement OMOP:19520862 - GPC3 on GRCh38 chrX: Deletion in position 133692392 to 133692393 and Insertion of TT measurement OMOP:19520949 - CHEK2 transcript: Substitution in position 1129 of G replaced by T measurement OMOP:19521017 - CHEK2 protein: Substitution in position 175 of V replaced by A measurement OMOP:19521061 - ATM transcript: Deletion in position 1676 measurement OMOP:19521105 - TET2 transcript: Deletion in position 2621 measurement OMOP:19521240 - GATA3 transcript: Duplication of position 1203 measurement OMOP:19521259 - POLE protein: Substitution in position 932 of E replaced by an early stop codon measurement OMOP:19521381 - RNF43 transcript: Substitution in position 2178 of G replaced by A measurement OMOP:19521417 - CHEK2 on GRCh38 chr22: Substitution in position 28695202 of C replaced by T measurement OMOP:19521543 - LRP1B transcript: Substitution in position 12415 of C replaced by T measurement OMOP:19521584 - KMT2D transcript: Substitution in position 9241 of G replaced by T measurement OMOP:19521591 - SMARCA4 protein: Frameshift substitution in position 1069 of I replaced by L followed by a new reading frame extending for 2 amino acids measurement OMOP:19521636 - NTRK1 protein: Substitution in position 206 of D replaced by N measurement OMOP:19521755 - TNFAIP3 protein: Frameshift substitution in position 587 of P replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19521809 - TRIM33 on GRCh38 chr1: Duplication of position 114433726 measurement OMOP:19521850 - PIK3R1 on GRCh38 chr5: Deletion in position 68226894 to 68226897 measurement OMOP:19521872 - TAF1B transcript: Substitution in position 16 of G replaced by T measurement OMOP:19521983 - STAG2 protein: Substitution in position 984 of E replaced by an early stop codon measurement OMOP:19522118 - PTCH1 protein: Frameshift substitution in position 454 of C replaced by P followed by a new reading frame extending for 3 amino acids measurement OMOP:19522120 - EP300 on GRCh38 chr22: Deletion in position 41177513 to 41177514 measurement OMOP:19522164 - CDH11 transcript: Substitution in position 727 of G replaced by T measurement OMOP:19522216 - EZH2 transcript: Deletion in position 1454 measurement OMOP:19522221 - VHL on GRCh38 chr3: Deletion in position 10142054 to 10142055 measurement OMOP:19522225 - PTPRT on GRCh38 chr20: Duplication of position 42472423 measurement OMOP:19522229 - NF1 on GRCh38 chr17: Deletion in position 31182576 to 31182581 and Insertion of GG measurement OMOP:19522276 - DNMT3A transcript: Substitution in position 2560 of G replaced by T measurement OMOP:19522320 - MAP2K4 on GRCh38 chr17: Substitution in position 12081422 of G replaced by A measurement OMOP:19522691 - KMT2D on GRCh38 chr12: Duplication of position 49026758 measurement OMOP:19522755 - STK11 protein: Substitution in position 100 of Q replaced by an early stop codon measurement OMOP:19522888 - KMT2D transcript: Substitution in position 10825 of C replaced by T measurement OMOP:19522922 - NF2 protein: Substitution in position 434 of E replaced by an early stop codon measurement OMOP:19522923 - COL4A4 transcript: Substitution in position 754 of G replaced by A measurement OMOP:19522937 - APC on GRCh38 chr5: Deletion in position 112839348 measurement OMOP:19523000 - STAT5B on GRCh38 chr17: Insertion in position 42219829 to 42219830 of T measurement OMOP:19523123 - LRP1B protein: Substitution in position 2258 of W replaced by an early stop codon measurement OMOP:19523150 - TET2 transcript: Deletion in position 4227 measurement OMOP:19523345 - EZH2 protein: Substitution in position 666 of Y replaced by an early stop codon measurement OMOP:19523417 - TRIM33 protein: Frameshift substitution in position 996 of I replaced by L followed by a new reading frame extending for 2 amino acids measurement OMOP:19523420 - WNK2 protein: Frameshift substitution in position 1964 of V replaced by C followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19523659 - RBM10 on GRCh38 chrX: Substitution in position 47185628 of A replaced by T measurement OMOP:19523832 - BAZ1A protein: Substitution in position 614 of M replaced by an early stop codon measurement OMOP:19523835 - APC transcript: Substitution in position 3509 of A replaced by G measurement OMOP:19523840 - NOTCH1 on GRCh38 chr9: Deletion in position 136496309 measurement OMOP:19523925 - TGFBR2 transcript: Duplication of position 383 measurement OMOP:19523945 - SMAD2 protein: Frameshift substitution in position 260 of S replaced by I followed by a new reading frame extending for 19 amino acids measurement OMOP:19523986 - ARID1A protein: Frameshift substitution in position 1276 of R replaced by I followed by a new reading frame extending for 10 amino acids measurement OMOP:19524009 - APC protein: Substitution in position 1506 of L replaced by an early stop codon measurement OMOP:19524035 - ERBB4 protein: Substitution in position 1176 of K replaced by an early stop codon measurement OMOP:19524117 - CDKN2A transcript: Deletion in position 53 measurement OMOP:19524229 - BRAF protein: Substitution in position 509 of G replaced by A measurement OMOP:19524232 - TINF2 protein: Substitution in position 282 of R replaced by H measurement OMOP:19524295 - ARHGEF12 transcript: Substitution in position 685 of C replaced by T measurement OMOP:19524370 - TET2 on GRCh38 chr4: Deletion in position 105234885 measurement OMOP:19524530 - NBN transcript: Substitution in position 1982 of C replaced by A measurement OMOP:19524561 - ZRSR2 on GRCh38 chrX: Deletion in position 15791007 to 15791008 measurement OMOP:19524589 - CHD2 protein: Substitution in position 725 of Q replaced by an early stop codon measurement OMOP:19524705 - TP53 on GRCh38 chr17: Deletion in position 7675236 measurement OMOP:19524725 - STK11 protein: Frameshift substitution in position 39 of R replaced by S followed by a new reading frame extending for 7 amino acids measurement OMOP:19524807 - PTEN transcript: Duplication of position 405 measurement OMOP:19524815 - ATM on GRCh38 chr11: Deletion in position 108271328 measurement OMOP:19524846 - STAG2 on GRCh38 chrX: Duplication of position 124049044 to 124049048 measurement OMOP:19524881 - FLT3 on GRCh38 chr13: Substitution in position 28018484 of A replaced by G measurement OMOP:19524924 - ATRX on GRCh38 chrX: Substitution in position 77620448 of G replaced by T measurement OMOP:19524939 - PTCH1 transcript: Substitution in position 782 of T replaced by A measurement OMOP:19524960 - SETD2 protein: Frameshift substitution in position 1001 of S replaced by L followed by a new reading frame extending for 5 amino acids measurement OMOP:19524983 - BIRC3 on GRCh38 chr11: Substitution in position 102335972 of T replaced by A measurement OMOP:19525107 - ATRX protein: Frameshift substitution in position 1410 of A replaced by Q followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19525111 - KMT2D on GRCh38 chr12: Insertion in position 49039545 to 49039546 of A measurement OMOP:19525157 - WNK2 on GRCh38 chr9: Substitution in position 93289438 of C replaced by T measurement OMOP:19525206 - NF1 transcript: Substitution in position 4369 of A replaced by G measurement OMOP:19525261 - OPTN protein: Substitution in position 545 of R replaced by Q measurement OMOP:19525278 - PTPN13 transcript: Substitution in position 4102 of G replaced by T measurement OMOP:19525303 - KMT2D on GRCh38 chr12: Substitution in position 49024687 of G replaced by A measurement OMOP:19525340 - RUNX1 on GRCh38 chr21: Insertion in position 34880572 to 34880573 of AAAAC measurement OMOP:19525350 - FBXO11 protein: Frameshift substitution in position 772 of R replaced by N followed by a new reading frame extending for 3 amino acids measurement OMOP:19525634 - PTCH1 protein: Frameshift substitution in position 250 of K replaced by C followed by a new reading frame extending for 15 amino acids measurement OMOP:19525654 - SH2B3 transcript: Insertion in position 959 to 960 of TATTC measurement OMOP:19525725 - FAT1 on GRCh38 chr4: Deletion in position 186709319 to 186709320 measurement OMOP:19525784 - AMER1 transcript: Deletion in position 1361 measurement OMOP:19525855 - APC on GRCh38 chr5: Substitution in position 112843254 of C replaced by T measurement OMOP:19525856 - NF1 transcript: Deletion in position 5037 to 5040 measurement OMOP:19525955 - KMT2C protein: Substitution in position 2089 of Q replaced by an early stop codon measurement OMOP:19525971 - LRP1B protein: Substitution in position 2807 of E replaced by an early stop codon measurement OMOP:19526057 - ERBB2 on GRCh38 chr17: Deletion in position 39723586 to 39723652 measurement OMOP:19526113 - PPP6C transcript: Insertion in position 274 to 275 of GTTGAGT measurement OMOP:19526156 - EGFR protein: Substitution in position 768 of S replaced by I measurement OMOP:19526214 - GNAS transcript: Substitution in position 2608 of C replaced by G measurement OMOP:19526317 - MAPK1 on GRCh38 chr22: Substitution in position 21772874 of T replaced by G measurement OMOP:19526449 - CHEK2 protein: Substitution in position 446 of N replaced by D measurement OMOP:19526460 - PALB2 protein: Substitution in position 1091 of Q replaced by an early stop codon measurement OMOP:19526516 - PDGFRA protein: Substitution in position 844 of M replaced by I measurement OMOP:19526538 - PIK3R1 transcript: Deletion in position 95 to 96 measurement OMOP:19526614 - TMPRSS2 on GRCh38 chr21: Substitution in position 41489203 of C replaced by A measurement OMOP:19526760 - CDK12 transcript: Deletion in position 3354 to 3355 measurement OMOP:19527052 - KDM6A protein: Frameshift substitution in position 1165 of V replaced by F followed by a new reading frame extending for 10 amino acids measurement OMOP:19527245 - APC transcript: Deletion in position 4241 to 4247 measurement OMOP:19527357 - MUTYH transcript: Substitution in position 235 of G replaced by T measurement OMOP:19527399 - APC on GRCh38 chr5: Substitution in position 112838026 of C replaced by G measurement OMOP:19527436 - RUNX1 on GRCh38 chr21: Substitution in position 34880643 of G replaced by T measurement OMOP:19527473 - PTPRC protein: Substitution in position 1011 of S replaced by an early stop codon measurement OMOP:19527506 - APC on GRCh38 chr5: Deletion in position 112819156 measurement OMOP:19527547 - B2M transcript: Deletion in position 105 measurement OMOP:19527608 - BCOR transcript: Deletion in position 4818 measurement OMOP:19527623 - ATM protein: Substitution in position 553 of G replaced by an early stop codon measurement OMOP:19527706 - TSC2 on GRCh38 chr16: Deletion in position 2079642 to 2079654 measurement OMOP:19527754 - NF2 transcript: Deletion in position 1029 measurement OMOP:19527808 - PPP2R1A protein: Substitution in position 45 of V replaced by an early stop codon measurement OMOP:19527818 - CHD2 protein: Frameshift substitution in position 1391 of K replaced by N followed by a new reading frame extending for 15 amino acids measurement OMOP:19527828 - APC transcript: Deletion in position 1886 measurement OMOP:19528015 - TP53 protein: Frameshift substitution in position 178 of H replaced by P followed by a new reading frame extending for 2 amino acids measurement OMOP:19528115 - RET on GRCh38 chr10: Substitution in position 43113517 of G replaced by A measurement OMOP:19531766 - TP53 transcript: Deletion in position 1025 measurement OMOP:19528246 - PTEN protein: Frameshift substitution in position 293 of G replaced by E followed by a new reading frame extending for 4 amino acids measurement OMOP:19528262 - NF1 protein: Frameshift substitution in position 1360 of Q replaced by S followed by a new reading frame extending for 20 amino acids measurement OMOP:19528422 - TET2 transcript: Deletion in position 3850 to 3869 measurement OMOP:19528428 - POLQ protein: Substitution in position 359 of R replaced by an early stop codon measurement OMOP:19528501 - ZNRF3 protein: Substitution in position 464 of Q replaced by an early stop codon measurement OMOP:19528506 - IDH2 on GRCh38 chr15: Substitution in position 90088605 of C replaced by A measurement OMOP:19528605 - EGFR protein: Substitution in position 467 of K replaced by T measurement OMOP:19528617 - APC on GRCh38 chr5: Deletion in position 112840089 to 112840092 measurement OMOP:19528643 - ROS1 transcript: Substitution in position 3409 of G replaced by A measurement OMOP:19528676 - KMT2D protein: Substitution in position 1702 of R replaced by an early stop codon measurement OMOP:19528713 - APC on GRCh38 chr5: Insertion in position 112840235 to 112840236 of TCCAAGAGAAAGAGGCAGAAGAATCAAATGAA measurement OMOP:19528753 - PMS2 on GRCh38 chr7: Substitution in position 5987159 of G replaced by A measurement OMOP:19528929 - RB1 on GRCh38 chr13: Substitution in position 48465249 of C replaced by A measurement OMOP:19528949 - CBFB on GRCh38 chr16: Duplication of position 67036711 measurement OMOP:19529008 - POLQ on GRCh38 chr3: Substitution in position 121467585 of C replaced by A measurement OMOP:19529122 - RUNX1 transcript: Insertion in position 407 to 408 of GTGACCA measurement OMOP:19529132 - EGFR transcript: [Deletion in position 2235 to 2237; Deletion in position 2239 to 2240 and insertion of TT] OMOP:19529227 - ZFHX3 on GRCh38 chr16: Duplication of position 72794391 measurement OMOP:19529247 - ARID1A on GRCh38 chr1: Deletion in position 26780321 to 26780328 measurement OMOP:19529339 - IRS4 transcript: Substitution in position 2183 of C replaced by G measurement OMOP:19529667 - KDM6A on GRCh38 chrX: Substitution in position 45107471 of G replaced by T measurement OMOP:19529697 - SOCS1 transcript: Deletion in position 250 to 268 measurement OMOP:19529786 - STK11 transcript: Duplication of position 650 measurement OMOP:19529835 - VHL transcript: Deletion in position 168 to 172 measurement OMOP:19529863 - NOTCH1 protein: Frameshift substitution in position 2341 of S replaced by P followed by a new reading frame extending for 7 amino acids measurement OMOP:19529866 - BCOR transcript: Substitution in position 5161 of A replaced by T measurement OMOP:19529874 - MED12 on GRCh38 chrX: Substitution in position 71121096 of G replaced by T measurement OMOP:19529983 - RET on GRCh38 chr10: Substitution in position 43112803 of G replaced by T measurement OMOP:19530221 - BRCA2 transcript: Deletion in position 9709 measurement OMOP:19530248 - BAP1 transcript: Deletion in position 1518 to 1522 measurement OMOP:19530277 - JAK1 protein: Substitution in position 980 of Q replaced by an early stop codon measurement OMOP:19530287 - VHL on GRCh38 chr3: Deletion in position 10142078 to 10142079 measurement OMOP:19530340 - CNOT3 transcript: Deletion in position 1635 measurement OMOP:19530344 - GATA2 on GRCh38 chr3: Substitution in position 128486108 of C replaced by T measurement OMOP:19530483 - ATM on GRCh38 chr11: Deletion in position 108268564 measurement OMOP:19530565 - PRDM1 transcript: Duplication of position 260 to 275 measurement OMOP:19530669 - PRDM2 transcript: Deletion in position 4443 measurement OMOP:19530746 - KMT2C transcript: Deletion in position 5533 measurement OMOP:19530845 - RUNX1 transcript: Deletion in position 1070 measurement OMOP:19530887 - PTPRD transcript: Substitution in position 2161 of G replaced by T measurement OMOP:19530910 - KDM6A protein: Frameshift substitution in position 648 of N replaced by I followed by a new reading frame extending for 3 amino acids measurement OMOP:19530932 - FBXW7 transcript: Substitution in position 277 of G replaced by T measurement OMOP:19531008 - PTEN protein: Substitution in position 251 of G replaced by A measurement OMOP:19531099 - WT1 transcript: Substitution in position 1267 of G replaced by T measurement OMOP:19531129 - CDKN2A on GRCh38 chr9: Deletion in position 21974750 measurement OMOP:19531192 - TP53 transcript: Duplication of position 932 measurement OMOP:19531224 - TNFAIP3 on GRCh38 chr6: Insertion in position 137879061 to 137879062 of T measurement OMOP:19531227 - TNFAIP3 transcript: Substitution in position 1429 of A replaced by T measurement OMOP:19531334 - APC protein: Frameshift substitution in position 1285 of D replaced by L followed by a new reading frame extending for 5 amino acids measurement OMOP:19531396 - KMT2C on GRCh38 chr7: Substitution in position 152181786 of G replaced by C measurement OMOP:19531415 - CDKN2A protein: Frameshift substitution in position 21 of A replaced by E followed by a new reading frame extending for 11 amino acids measurement OMOP:19531448 - FAT1 transcript: Substitution in position 1270 of G replaced by T measurement OMOP:19531478 - KDM6A protein: Frameshift substitution in position 1228 of V replaced by S followed by a new reading frame extending for 3 amino acids measurement OMOP:19531509 - TSC1 transcript: Deletion in position 492 measurement OMOP:19531511 - ZNF331 on GRCh38 chr19: Deletion in position 53577613 to 53577614 measurement OMOP:19531524 - ARID2 protein: Substitution in position 712 of E replaced by an early stop codon measurement OMOP:19531730 - PHF6 protein: Substitution in position 34 of S replaced by an early stop codon measurement OMOP:19531810 - ROBO2 transcript: Substitution in position 3250 of C replaced by T measurement OMOP:19531858 - TP53 protein: Frameshift substitution in position 127 of S replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19531881 - EP300 transcript: Substitution in position 1465 of A replaced by T measurement OMOP:19531978 - APC transcript: Insertion in position 4396 to 4397 of T measurement OMOP:19532134 - APC on GRCh38 chr5: Deletion in position 112843316 to 112843317 measurement OMOP:19532171 - CDKN2A transcript: Substitution in position *2 of G replaced by T measurement OMOP:19532289 - CDKN2A transcript: Deletion in position 194-3510 measurement OMOP:19532504 - RB1 on GRCh38 chr13: Insertion in position 48307353 to 48307354 of AG measurement OMOP:19532538 - TRPC6 protein: Substitution in position 15 of P replaced by S measurement OMOP:19532598 - ASXL1 protein: Frameshift substitution in position 768 of Q replaced by K followed by a new reading frame extending for 4 amino acids measurement OMOP:19532645 - MLH1 on GRCh38 chr3: Substitution in position 37014460 of A replaced by T measurement OMOP:19532660 - ATM on GRCh38 chr11: Deletion in position 108320021 to 108320022 measurement OMOP:19532696 - CDKN2A transcript: Duplication of position 194-3547 measurement OMOP:19532798 - POT1 on GRCh38 chr7: Substitution in position 124853092 of G replaced by T measurement OMOP:19532932 - CNTNAP2 protein: Frameshift substitution in position 1038 of D replaced by T followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19532975 - N4BP2 transcript: Deletion in position 2773 measurement OMOP:19532979 - ASXL2 transcript: Duplication of position 2172 to 2194 measurement OMOP:19533021 - BCORL1 on GRCh38 chrX: Deletion in position 130050750 measurement OMOP:19533067 - KDM5C protein: Frameshift substitution in position 1446 of H replaced by Q followed by a new reading frame extending for 26 amino acids measurement OMOP:19533093 - RUNX1 protein: Frameshift substitution in position 81 of V replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19533102 - FAT1 on GRCh38 chr4: Substitution in position 186708918 of T replaced by A measurement OMOP:19533166 - NOTCH1 protein: Frameshift substitution in position 2473 of V replaced by G followed by a new reading frame extending for 5 amino acids measurement OMOP:19533279 - PIK3CA protein: Substitution in position 350 of D replaced by G measurement OMOP:19533291 - LRP1B protein: Substitution in position 1104 of W replaced by an early stop codon measurement OMOP:19533299 - BRCA1 protein: Substitution in position 1419 of E replaced by an early stop codon measurement OMOP:19533305 - CDH10 transcript: Substitution in position 431 of C replaced by A measurement OMOP:19533306 - ARID1A transcript: Duplication of position 6091 measurement OMOP:19533359 - BCOR transcript: Deletion in position 732 measurement OMOP:19533537 - NTRK1 on GRCh38 chr1: Substitution in position 156880002 of G replaced by T measurement OMOP:19533605 - FAT1 protein: Substitution in position 3251 of Q replaced by an early stop codon measurement OMOP:19533615 - POLQ transcript: Substitution in position 3530 of C replaced by G measurement OMOP:19533618 - ATRX transcript: Substitution in position 4915 of G replaced by T measurement OMOP:19533759 - RUNX1 protein: Frameshift substitution in position 146 of N replaced by S followed by a new reading frame extending for 3 amino acids measurement OMOP:19533787 - TBX3 on GRCh38 chr12: Deletion in position 114682926 measurement OMOP:19533792 - MED12 on GRCh38 chrX: Deletion in position 71121787 measurement OMOP:19533960 - PDGFRB protein: Substitution in position 695 of R replaced by L measurement OMOP:19534135 - CREBBP on GRCh38 chr16: Substitution in position 3767870 of C replaced by A measurement OMOP:19534172 - RUNX1 transcript: Substitution in position 497 of G replaced by T measurement OMOP:19534175 - EED on GRCh38 chr11: Substitution in position 86268532 of C replaced by T measurement OMOP:19534309 - DNMT3A protein: Substitution in position 330 of W replaced by an early stop codon measurement OMOP:19534323 - NCOR1 on GRCh38 chr17: Deletion in position 16075582 measurement OMOP:19534436 - ARID1A transcript: Deletion in position 5607 measurement OMOP:19534553 - FANCA on GRCh38 chr16: Substitution in position 89745053 of C replaced by A measurement OMOP:19534702 - ARID1A transcript: Substitution in position 6746 of C replaced by A measurement OMOP:19534755 - NFE2L2 protein: Substitution in position 79 of E replaced by an early stop codon measurement OMOP:19534785 - KDM6A protein: Frameshift substitution in position 937 of M replaced by T followed by a new reading frame extending for 10 amino acids measurement OMOP:19534918 - BCOR transcript: Deletion in position 2069 to 2070 measurement OMOP:19535070 - APC protein: Substitution in position 658 of E replaced by an early stop codon measurement OMOP:19535231 - del(11)(q24) measurement OMOP:19535460 - APC transcript: Substitution in position 2840 of G replaced by A measurement OMOP:19535465 - ROS1 protein: Substitution in position 233 of P replaced by S measurement OMOP:19535546 - PTCH1 transcript: Deletion in position 1959 to 1969 measurement OMOP:19535607 - CREB3L2 protein: Substitution in position 299 of R replaced by W measurement OMOP:19535616 - CBFB on GRCh38 chr16: Deletion in position 67036711 measurement OMOP:19535622 - ARID1A protein: Frameshift substitution in position 1354 of F replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19643113 - t(X;11)(q22;q23) measurement OMOP:19535903 - KMT2D protein: Substitution in position 5142 of C replaced by an early stop codon measurement OMOP:19535968 - PABPC1 protein: Substitution in position 454 of I replaced by L measurement OMOP:19536097 - APC transcript: Deletion in position 1797 measurement OMOP:19536107 - MEN1 transcript: Substitution in position 1252 of G replaced by T measurement OMOP:19536190 - APC on GRCh38 chr5: Substitution in position 112838215 of C replaced by G measurement OMOP:19536303 - CTCF transcript: Substitution in position 2092 of G replaced by T measurement OMOP:19536346 - MAP3K1 protein: Frameshift substitution in position 570 of G replaced by L followed by a new reading frame extending for 5 amino acids measurement OMOP:19536662 - KMT2D on GRCh38 chr12: Substitution in position 49041250 of G replaced by A measurement OMOP:19536795 - STK11 on GRCh38 chr19: Insertion in position 1207070 to 1207071 of T measurement OMOP:19536801 - SPEN protein: Substitution in position 2292 of S replaced by an early stop codon measurement OMOP:19536820 - EZH2 on GRCh38 chr7: Substitution in position 148826494 of A replaced by T measurement OMOP:19536849 - TSC2 on GRCh38 chr16: Substitution in position 2080351 of C replaced by T measurement OMOP:19536887 - TP53 transcript: Deletion in position 1180 to 1181 measurement OMOP:19536982 - CDKN2A protein: Substitution in position 97 of A replaced by T measurement OMOP:19537070 - MAP3K1 protein: Frameshift substitution in position 354 of F replaced by L followed by a new reading frame extending for 2 amino acids measurement OMOP:19537072 - PTPRD transcript: Substitution in position 1720 of G replaced by T measurement OMOP:19537082 - WT1 transcript: Deletion in position 1153 and Insertion of AA measurement OMOP:19537158 - TET2 protein: Substitution in position 758 of Q replaced by an early stop codon measurement OMOP:19537188 - NOTCH1 transcript: Duplication of position 7310 to 7320 measurement OMOP:19537276 - TRIM33 transcript: Duplication of position 2791 measurement OMOP:19537284 - SMARCA4 protein: Substitution in position 1640 of S replaced by an early stop codon measurement OMOP:19537344 - ARID1A transcript: Duplication of position 4230 to 4231 measurement OMOP:19537397 - APC on GRCh38 chr5: Deletion in position 112838767 measurement OMOP:19537530 - PTEN protein: Frameshift substitution in position 87 of Q replaced by L followed by a new reading frame extending for 9 amino acids measurement OMOP:19537690 - SETD2 protein: Frameshift substitution in position 1822 of P replaced by Q followed by a new reading frame extending for 16 amino acids measurement OMOP:19537722 - ATR on GRCh38 chr3: Deletion in position 142553991 measurement OMOP:19537727 - ASXL1 transcript: Deletion in position 2030 to 2046 measurement OMOP:19537756 - NF1 protein: Frameshift substitution in position 2285 of Y replaced by T followed by a new reading frame extending for 5 amino acids measurement OMOP:19537774 - RB1 on GRCh38 chr13: Deletion in position 48377007 to 48377034 measurement OMOP:19537779 - KMT2D transcript: Substitution in position 6017 of G replaced by A measurement OMOP:19537867 - FLT3 transcript: Substitution in position 1798 of G replaced by T measurement OMOP:19538074 - BAZ1A protein: Substitution in position 968 of Q replaced by an early stop codon measurement OMOP:19538171 - CREBBP transcript: Deletion in position 5346 measurement OMOP:19538235 - SMAD4 on GRCh38 chr18: Substitution in position 51049301 of C replaced by A measurement OMOP:19538326 - CEBPA transcript: Insertion in position 69 to 70 of TCTCCCG measurement OMOP:19538419 - NCOR1 transcript: Duplication of position 1792 measurement OMOP:19538429 - BAP1 transcript: Insertion in position 1525 to 1526 of AG measurement OMOP:19538443 - GATA1 transcript: Deletion in position 187 to 215 measurement OMOP:19538630 - KDM6A protein: Substitution in position 346 of Q replaced by an early stop codon measurement OMOP:19538818 - FGFR1 protein: Substitution in position 303 of D replaced by G measurement OMOP:19538885 - PDGFRB on GRCh38 chr5: Substitution in position 150137057 of C replaced by T measurement OMOP:19538909 - CHD2 transcript: Insertion in position 4435 to 4436 of C measurement OMOP:19538924 - STK11 protein: Substitution in position 303 of I replaced by S measurement OMOP:19539133 - ARID1B transcript: Insertion in position 6137 to 6138 of ACTAG measurement OMOP:19539268 - FAT1 on GRCh38 chr4: Duplication of position 186708188 to 186708189 measurement OMOP:19539285 - AR on GRCh38 chrX: Substitution in position 67545438 of C replaced by T measurement OMOP:19539311 - H3-3A on GRCh38 chr1: Deletion in position 226064436 to 226064437 measurement OMOP:19539338 - RANBP2 transcript: Deletion in position 7427 measurement OMOP:19539387 - CDH1 protein: Substitution in position 298 of A replaced by T measurement OMOP:19539404 - APC on GRCh38 chr5: Duplication of position 112815528 measurement OMOP:19539459 - TET2 protein: Frameshift substitution in position 535 of N replaced by K followed by a new reading frame extending for 6 amino acids measurement OMOP:19539476 - RB1 transcript: Deletion in position 240 measurement OMOP:19539505 - FANCD2 on GRCh38 chr3: Deletion in position 10087144 measurement OMOP:19539681 - EWSR1 on GRCh38 chr22: Substitution in position 29286849 of T replaced by C measurement OMOP:19539772 - RPL5 protein: Frameshift substitution in position 280 of V replaced by G followed by a new reading frame extending for 17 amino acids measurement OMOP:19539840 - KMT2D on GRCh38 chr12: Deletion in position 49041416 to 49041417 and Insertion of A measurement OMOP:19539864 - PTEN on GRCh38 chr10: Deletion in position 87961079 to 87961088 measurement OMOP:19539906 - PTEN transcript: Deletion in position 878 to 879 measurement OMOP:19539926 - APC on GRCh38 chr5: Deletion in position 112837942 to 112837955 measurement OMOP:19539927 - MEN1 on GRCh38 chr11: Substitution in position 64805060 of G replaced by A measurement OMOP:19540145 - CYLD transcript: Substitution in position 2272 of C replaced by T measurement OMOP:19540162 - TMPRSS2 on GRCh38 chr21: Substitution in position 41485788 of T replaced by C measurement OMOP:19540175 - COL4A3 transcript: Substitution in position 680 of G replaced by A measurement OMOP:19540295 - CEBPA on GRCh38 chr19: Deletion in position 33302229 to 33302238 measurement OMOP:19540331 - PDGFRB on GRCh38 chr5: Substitution in position 150136967 of G replaced by A measurement OMOP:19540513 - TGFBR2 protein: Substitution in position 511 of Q replaced by an early stop codon measurement OMOP:19540519 - TMPRSS2 on GRCh38 chr21: Substitution in position 41503725 of G replaced by T measurement OMOP:19540532 - FLCN on GRCh38 chr17: Substitution in position 17226205 of G replaced by A measurement OMOP:19540556 - KMT2C on GRCh38 chr7: Duplication of position 152176305 measurement OMOP:19540557 - ACVR2A on GRCh38 chr2: Substitution in position 147915283 of G replaced by A measurement OMOP:19540585 - ARID1A protein: Frameshift substitution in position 2141 of F replaced by L followed by a new reading frame extending for 9 amino acids measurement OMOP:19540636 - TP53 on GRCh38 chr17: Deletion in position 7673803 to 7673804 and Insertion of TT measurement OMOP:19540727 - PTPRD transcript: Deletion in position 180 measurement OMOP:19540800 - PTCH1 on GRCh38 chr9: Substitution in position 95458273 of C replaced by A measurement OMOP:19540830 - KDM6A protein: Frameshift substitution in position 355 of W replaced by L followed by a new reading frame extending for 9 amino acids measurement OMOP:19540955 - LRP1B transcript: Substitution in position 9070 of G replaced by T measurement OMOP:19540982 - MAP2K2 protein: Substitution in position 231 of R replaced by H measurement OMOP:19541067 - CREBBP transcript: Substitution in position 4505 of G replaced by T measurement OMOP:19541112 - NCOR2 on GRCh38 chr12: Substitution in position 124483738 of G replaced by C measurement OMOP:19541120 - CDH1 on GRCh38 chr16: Insertion in position 68829779 to 68829780 of TG measurement OMOP:19541134 - MSH2 protein: Substitution in position 258 of L replaced by an early stop codon measurement OMOP:19541168 - PRDM2 on GRCh38 chr1: Substitution in position 13778669 of G replaced by T measurement OMOP:19541216 - USP44 on GRCh38 chr12: Deletion in position 95533423 measurement OMOP:19541227 - TBX3 protein: Frameshift substitution in position 68 of L replaced by I followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19541261 - CSMD3 transcript: Substitution in position 4824 of T replaced by A measurement OMOP:19541361 - ARID1A protein: Frameshift substitution in position 808 of G replaced by T followed by a new reading frame extending for 24 amino acids measurement OMOP:19541408 - ACVR2A on GRCh38 chr2: Substitution in position 147899874 of C replaced by A measurement OMOP:19541410 - APC protein: Frameshift substitution in position 1493 of T replaced by N followed by a new reading frame extending for 21 amino acids measurement OMOP:19541427 - PTPN13 protein: Substitution in position 380 of R replaced by an early stop codon measurement OMOP:19541482 - PTEN transcript: Deletion in position 475 measurement OMOP:19541642 - WT1 on GRCh38 chr11: Duplication of position 32396369 measurement OMOP:19541880 - BRCA2 protein: Substitution in position 1740 of L replaced by an early stop codon measurement OMOP:19541948 - KNL1 protein: Substitution in position 1687 of Q replaced by an early stop codon measurement OMOP:19541959 - APC transcript: Duplication of position 3986 measurement OMOP:19542002 - WNK2 transcript: Deletion in position 4620 measurement OMOP:19542051 - VHL protein: Substitution in position 76 of F replaced by L measurement OMOP:19542113 - TSC2 on GRCh38 chr16: Deletion in position 2070472 measurement OMOP:19542125 - WDR87 transcript: Substitution in position 423 of A replaced by C measurement OMOP:19542183 - CIC protein: Substitution in position 992 of E replaced by an early stop codon measurement OMOP:19542262 - GATA3 protein: Frameshift substitution in position 405 of S replaced by E followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19542327 - MYH9 protein: Frameshift substitution in position 627 of M replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19542361 - TP53 protein: Substitution in position 158 of R replaced by P measurement OMOP:19542643 - CHD2 transcript: Substitution in position 4601 of G replaced by A measurement OMOP:19542753 - VHL on GRCh38 chr3: Deletion in position 10142100 to 10142107 measurement OMOP:19542903 - CDK12 on GRCh38 chr17: Deletion in position 39494580 measurement OMOP:19542928 - SOCS1 on GRCh38 chr16: Duplication of position 11255080 to 11255101 measurement OMOP:19543180 - CREBBP protein: Frameshift substitution in position 1423 of P replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19543191 - EP300 protein: Frameshift substitution in position 1934 of R replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19543216 - KDM6A on GRCh38 chrX: Substitution in position 44961323 of G replaced by T measurement OMOP:19543344 - CDH1 protein: Frameshift substitution in position 698 of A replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19543417 - FAT1 on GRCh38 chr4: Deletion in position 186709391 measurement OMOP:19543418 - ARID1A protein: Frameshift substitution in position 2145 of E replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19543431 - PIK3R1 on GRCh38 chr5: Substitution in position 68293781 of G replaced by T measurement OMOP:19543449 - APC transcript: Deletion in position 748 measurement OMOP:19543562 - ERBB2 on GRCh38 chr17: Substitution in position 39708507 of C replaced by T measurement OMOP:19543598 - APC protein: Frameshift substitution in position 1546 of N replaced by R followed by a new reading frame extending for 2 amino acids measurement OMOP:19543685 - NOTCH3 protein: Substitution in position 497 of S replaced by L measurement OMOP:19543699 - VHL transcript: Deletion in position 311 to 320 measurement OMOP:19543733 - MTOR transcript: Substitution in position 3026 of G replaced by A measurement OMOP:19543858 - ARID1A transcript: Deletion in position 5826 measurement OMOP:19543868 - ARID1A transcript: Deletion in position 1986 to 1993 measurement OMOP:19543888 - APC protein: Substitution in position 902 of E replaced by an early stop codon measurement OMOP:19543937 - APC protein: Frameshift substitution in position 1936 of S replaced by V followed by a new reading frame extending for 13 amino acids measurement OMOP:19543951 - AKT1 on GRCh38 chr14: Substitution in position 104770890 of C replaced by A measurement OMOP:19544096 - PTEN protein: Frameshift substitution in position 176 of Y replaced by I followed by a new reading frame extending for 5 amino acids measurement OMOP:19544098 - TP53 on GRCh38 chr17: Substitution in position 7676211 of C replaced by T measurement OMOP:19544112 - TP53 protein: Substitution in position 237 of M replaced by K measurement OMOP:19544212 - ATR transcript: Duplication of position 4915 to 4918 measurement OMOP:19544227 - TP53 transcript: Deletion in position 789 to 791 and Insertion of A measurement OMOP:19544312 - RB1 transcript: Substitution in position 769 of C replaced by T measurement OMOP:19544320 - HTR2A on GRCh38 chr13: Substitution in position 46834899 of G replaced by A measurement OMOP:19544343 - RAD21 transcript: Substitution in position 1615 of G replaced by T measurement OMOP:19544351 - AKT1 on GRCh38 chr14: Substitution in position 104770395 of G replaced by T measurement OMOP:19544377 - CYLD transcript: Substitution in position 1168 of G replaced by T measurement OMOP:19544471 - CASP8 transcript: Deletion in position 1380 measurement OMOP:19544647 - FOXA1 on GRCh38 chr14: Substitution in position 37591988 of A replaced by T measurement OMOP:19544664 - EGFR transcript: [Deletion in position 2236 to 2250; Substitution in position 2253 of A replaced by G] OMOP:19544675 - ARID1A transcript: Deletion in position 6665 to 6666 measurement OMOP:19544714 - PAX5 on GRCh38 chr9: Substitution in position 36966716 of C replaced by A measurement OMOP:19544801 - KDM6A on GRCh38 chrX: Substitution in position 45063489 of C replaced by A measurement OMOP:19544818 - SMAD3 transcript: Substitution in position 695 of G replaced by A measurement OMOP:19544843 - PTPRD on GRCh38 chr9: Substitution in position 8500842 of C replaced by T measurement OMOP:19544845 - ATM transcript: Substitution in position 7777 of C replaced by T measurement OMOP:19544895 - IKZF1 transcript: Insertion in position 483 to 484 of T measurement OMOP:19545015 - APC on GRCh38 chr5: Substitution in position 112839225 of A replaced by G measurement OMOP:19545028 - TNFRSF14 transcript: Substitution in position 62 of T replaced by A measurement OMOP:19545046 - CTCF on GRCh38 chr16: Deletion in position 67629452 measurement OMOP:19545099 - DNMT3A on GRCh38 chr2: Insertion in position 25248198 to 25248199 of G measurement OMOP:19545198 - CDH1 protein: Substitution in position 74 of R replaced by an early stop codon measurement OMOP:19545232 - KMT2C on GRCh38 chr7: Deletion in position 152162742 measurement OMOP:19545359 - TET2 transcript: Deletion in position 3197 measurement OMOP:19545381 - del(17)(p13p13) measurement OMOP:19545403 - RNF43 transcript: Duplication of position 144 measurement OMOP:19545505 - ELL transcript: Substitution in position 1045 of C replaced by T measurement OMOP:19545554 - B2M protein: Substitution in position 98 of Y replaced by an early stop codon measurement OMOP:19545556 - KDM6A transcript: Substitution in position 3151 of G replaced by T measurement OMOP:19545589 - TP53 on GRCh38 chr17: Deletion in position 7674200 measurement OMOP:19545631 - TP53 transcript: Duplication of position 463 to 466 measurement OMOP:19545632 - CSMD3 protein: Frameshift substitution in position 746 of N replaced by I followed by a new reading frame extending for 6 amino acids measurement OMOP:19545679 - ZCCHC14 on GRCh38 chr16: Substitution in position 87414462 of T replaced by G measurement OMOP:19545680 - CDKN2A transcript: Substitution in position 222 of C replaced by A measurement OMOP:19545702 - TSC2 on GRCh38 chr16: Substitution in position 2085233 of C replaced by T measurement OMOP:19545713 - CDKN2A transcript: Deletion in position 64 to 65 measurement OMOP:19545732 - KMT2C transcript: Deletion in position 5682 to 5691 measurement OMOP:19545797 - MEN1 protein: Frameshift substitution in position 568 of T replaced by D followed by a new reading frame extending for 27 amino acids measurement OMOP:19545833 - ERBB2 on GRCh38 chr17: Substitution in position 39726940 of T replaced by A measurement OMOP:19545904 - GRIN2A on GRCh38 chr16: Substitution in position 9764171 of C replaced by A measurement OMOP:19545956 - PTPRT on GRCh38 chr20: Deletion in position 42110368 measurement OMOP:195462 - Intestinal infection caused by Pseudomonas OMOP:19546236 - ATM on GRCh38 chr11: Substitution in position 108331498 of G replaced by C measurement OMOP:19546241 - ARID1A on GRCh38 chr1: Duplication of position 26729843 to 26729847 measurement OMOP:19546249 - IRS4 transcript: Duplication of position 3309 measurement OMOP:19546359 - PRDM2 protein: Frameshift substitution in position 398 of A replaced by P followed by a new reading frame extending for 19 amino acids measurement OMOP:19546364 - IL6ST protein: Substitution in position 191 of F replaced by V measurement OMOP:19546369 - PTPN6 transcript: Substitution in position 234 of C replaced by G measurement OMOP:19546393 - CREBBP protein: Substitution in position 104 of Q replaced by an early stop codon measurement OMOP:195464 - Epidemic pleurodynia OMOP:19546405 - SDHB on GRCh38 chr1: Substitution in position 17028736 of C replaced by T measurement OMOP:19546467 - POLE on GRCh38 chr12: Deletion in position 132635985 to 132636001 measurement OMOP:19546496 - TP53 transcript: Deletion in position 1140 measurement OMOP:19546533 - ARID1B transcript: Deletion in position 6014 to 6015 measurement OMOP:19546733 - RUNX1 transcript: Deletion in position 190 to 194 measurement OMOP:19546903 - PTCH1 protein: Frameshift substitution in position 292 of M replaced by T followed by a new reading frame extending for 27 amino acids measurement OMOP:19546941 - NOTCH1 protein: Frameshift substitution in position 1429 of D replaced by T followed by a new reading frame extending for 14 amino acids measurement OMOP:19547030 - ATM transcript: Deletion in position 5118 measurement OMOP:19547077 - EXT2 protein: Substitution in position 389 of Q replaced by an early stop codon measurement OMOP:19547137 - SPRED1 protein: Substitution in position 64 of R replaced by an early stop codon measurement OMOP:19547223 - APC protein: Frameshift substitution in position 1466 of G replaced by V followed by a new reading frame extending for 3 amino acids measurement OMOP:19547225 - APC on GRCh38 chr5: Deletion in position 112838624 measurement OMOP:19547285 - ERBB4 transcript: Substitution in position 1221 of G replaced by A measurement OMOP:19547356 - NF2 protein: Frameshift substitution in position 507 of F replaced by T followed by a new reading frame extending for 7 amino acids measurement OMOP:19547399 - KDM6A on GRCh38 chrX: Deletion in position 45083510 to 45083511 measurement OMOP:19547503 - AXIN1 protein: Frameshift substitution in position 265 of G replaced by E followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19547505 - GATA1 protein: Frameshift substitution in position 64 of R replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19547543 - APC on GRCh38 chr5: Deletion in position 112840495 measurement OMOP:19547581 - MUC4 protein: Substitution in position 1001 of V replaced by E measurement OMOP:19547600 - EWSR1 on GRCh38 chr22: Substitution in position 29297727 of G replaced by A measurement OMOP:19547626 - KEAP1 protein: Frameshift substitution in position 601 of R replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19547759 - RB1 transcript: Deletion in position 1690 measurement OMOP:19547893 - FAT1 on GRCh38 chr4: Insertion in position 186709148 to 186709149 of CTGTA measurement OMOP:19547995 - NF2 protein: Frameshift substitution in position 108 of E replaced by D followed by a new reading frame extending for 15 amino acids measurement OMOP:19548022 - ASXL2 on GRCh38 chr2: Duplication of position 25744149 to 25744171 measurement OMOP:19548081 - HRAS on GRCh38 chr11: Deletion in position 534288 to 534289 and Insertion of TT measurement OMOP:19548178 - MAP2K4 protein: Frameshift substitution in position 161 of I replaced by M followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19548195 - SETD2 protein: Frameshift substitution in position 282 of E replaced by K followed by a new reading frame extending for 19 amino acids measurement OMOP:19548321 - CDH1 protein: Frameshift substitution in position 857 of Q replaced by P followed by a new reading frame extending for 4 amino acids measurement OMOP:19548373 - VHL transcript: Insertion in position 184 to 185 of CCCTGCTGCGCTGCGGTGAG measurement OMOP:19548571 - CEBPA transcript: Deletion in position 756 to 778 measurement OMOP:19548586 - ZFHX3 transcript: Deletion in position 5502 to 5526 measurement OMOP:19548588 - JAK1 protein: Substitution in position 368 of Y replaced by an early stop codon measurement OMOP:19548634 - BCL9L transcript: Substitution in position 3121 of C replaced by T measurement OMOP:19548883 - BAP1 on GRCh38 chr3: Substitution in position 52403449 of C replaced by A measurement OMOP:19548994 - PTPRD transcript: Substitution in position 1279 of C replaced by T measurement OMOP:19549002 - CSMD3 on GRCh38 chr8: Substitution in position 112289390 of C replaced by T measurement OMOP:19549077 - TP53 on GRCh38 chr17: Substitution in position 7675208 of C replaced by T measurement OMOP:19549142 - ARID2 on GRCh38 chr12: Deletion in position 45893686 to 45893695 measurement OMOP:19549325 - TP53 protein: Frameshift substitution in position 15 of S replaced by R followed by a new reading frame extending for 28 amino acids measurement OMOP:19549541 - NF1 protein: Substitution in position 1276 of R replaced by L measurement OMOP:19549567 - PTCH1 transcript: Substitution in position 2190 of G replaced by A measurement OMOP:19549684 - ATRX transcript: Substitution in position 4838 of T replaced by A measurement OMOP:19643118 - t(X;14)(p11;q32) measurement OMOP:19549821 - PRDM2 protein: Frameshift substitution in position 1490 of V replaced by F followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19549926 - MLH1 protein: Substitution in position 359 of M replaced by L measurement OMOP:19549941 - ZMYM3 protein: Substitution in position 43 of R replaced by an early stop codon measurement OMOP:19550112 - TP53 on GRCh38 chr17: Deletion in position 7675095 measurement OMOP:19550120 - MAP3K1 on GRCh38 chr5: Substitution in position 56875228 of C replaced by G measurement OMOP:19550136 - KEAP1 transcript: Substitution in position 574 of G replaced by T measurement OMOP:19550197 - AXIN1 transcript: Substitution in position 1210 of G replaced by T measurement OMOP:19550207 - BTK transcript: Substitution in position 1573 of C replaced by T measurement OMOP:19550285 - BAP1 transcript: Deletion in position 1865 to 1866 measurement OMOP:19550303 - LATS1 protein: Substitution in position 315 of Q replaced by an early stop codon measurement OMOP:19550340 - BCOR on GRCh38 chrX: Substitution in position 40057321 of C replaced by A measurement OMOP:19550462 - WT1 transcript: Substitution in position 1238 of T replaced by G measurement OMOP:19550681 - BRCA1 on GRCh38 chr17: Deletion in position 43091465 to 43091468 measurement OMOP:19550683 - APC protein: Frameshift substitution in position 1438 of T replaced by N followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19550763 - NF2 protein: Frameshift substitution in position 398 of L replaced by G followed by a new reading frame extending for 8 amino acids measurement OMOP:19550766 - TSC1 protein: Substitution in position 328 of Q replaced by an early stop codon measurement OMOP:19550786 - FAT1 on GRCh38 chr4: Deletion in position 186707284 to 186707287 measurement OMOP:19550834 - FANCA protein: Substitution in position 1078 of Y replaced by an early stop codon measurement OMOP:19550871 - KMT2D protein: Frameshift substitution in position 1041 of Q replaced by S followed by a new reading frame extending for 15 amino acids measurement OMOP:19550910 - PTEN transcript: Substitution in position 534 of T replaced by G measurement OMOP:19550979 - FANCA protein: Substitution in position 300 of G replaced by an early stop codon measurement OMOP:19551029 - APC on GRCh38 chr5: Substitution in position 112801348 of G replaced by T measurement OMOP:19551279 - TET2 transcript: Duplication of position 5844 measurement OMOP:19551283 - ASXL1 protein: Frameshift substitution in position 1298 of T replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19551316 - ASXL1 on GRCh38 chr20: Deletion in position 32434599 measurement OMOP:19551535 - AXIN1 on GRCh38 chr16: Duplication of position 346239 measurement OMOP:19551657 - SETD2 transcript: Deletion in position 4168 measurement OMOP:19551705 - VHL protein: Frameshift substitution in position 33 of S replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19551861 - ASXL2 on GRCh38 chr2: Deletion in position 25767634 to 25767638 measurement OMOP:19551867 - PDGFRB on GRCh38 chr5: Substitution in position 150133639 of G replaced by T measurement OMOP:19551913 - LRP1B protein: Substitution in position 669 of I replaced by V measurement OMOP:19551952 - DNM2 on GRCh38 chr19: Deletion in position 10797505 measurement OMOP:19551964 - GATA2 protein: Substitution in position 321 of L replaced by V measurement OMOP:19551986 - CREBBP transcript: Deletion in position 7231 measurement OMOP:19552093 - STK11 protein: Frameshift substitution in position 327 of D replaced by E followed by a new reading frame extending for 10 amino acids measurement OMOP:19552094 - PTPRB on GRCh38 chr12: Deletion in position 70560888 to 70560891 measurement OMOP:19552188 - BRAF on GRCh38 chr7: Deletion in position 140753338 and Insertion of CGTAGTA measurement OMOP:19552231 - APC protein: Frameshift substitution in position 1546 of N replaced by R followed by a new reading frame extending for 9 amino acids measurement OMOP:19552235 - WT1 protein: Frameshift substitution in position 397 of M replaced by H followed by a new reading frame extending for 9 amino acids measurement OMOP:19552241 - ARID1A on GRCh38 chr1: Duplication of position 26779176 measurement OMOP:19552265 - RET on GRCh38 chr10: Substitution in position 43111164 of C replaced by T measurement OMOP:19552317 - APC transcript: Substitution in position 6676 of C replaced by T measurement OMOP:19552471 - RB1 protein: Frameshift substitution in position 150 of R replaced by K followed by a new reading frame extending for 7 amino acids measurement OMOP:19552542 - ARID1A transcript: Deletion in position 694 to 709 measurement OMOP:19552546 - APC transcript: Insertion in position 4221 to 4222 of TG measurement OMOP:19552692 - CTNNB1 protein: Substitution in position 535 of R replaced by an early stop codon measurement OMOP:19552757 - KMT2D transcript: Deletion in position 1720 to 1722 and Insertion of G measurement OMOP:19552775 - DDX3X protein: Frameshift substitution in position 417 of Q replaced by E followed by a new reading frame extending for 16 amino acids measurement OMOP:19552878 - ARHGEF12 protein: Substitution in position 1481 of G replaced by an early stop codon measurement OMOP:19552897 - KMT2C on GRCh38 chr7: Deletion in position 152181921 to 152181925 measurement OMOP:19553015 - IRS4 on GRCh38 chrX: Substitution in position 108733215 of G replaced by A measurement OMOP:19553052 - NF1 protein: Substitution in position 1824 of I replaced by V measurement OMOP:19553071 - LRP1B protein: Substitution in position 3064 of R replaced by an early stop codon measurement OMOP:19553089 - MAP3K1 on GRCh38 chr5: Duplication of position 56872865 measurement OMOP:19553157 - APC transcript: Deletion in position 4467 to 4473 measurement OMOP:19553189 - BARD1 transcript: Deletion in position 453 measurement OMOP:19553220 - RNF43 on GRCh38 chr17: Substitution in position 58363400 of G replaced by A measurement OMOP:19553242 - APC protein: Substitution in position 760 of L replaced by an early stop codon measurement OMOP:19553270 - ARID1A protein: Frameshift substitution in position 1619 of P replaced by Q followed by a new reading frame extending for 7 amino acids measurement OMOP:19553317 - MAP3K1 protein: Frameshift substitution in position 875 of D replaced by M followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19553376 - AXIN2 on GRCh38 chr17: Substitution in position 65557994 of G replaced by T measurement OMOP:19553402 - ATRX on GRCh38 chrX: Substitution in position 77523317 of C replaced by A measurement OMOP:19553412 - EGFR on GRCh38 chr7: [Deletion in position 55174779 to 55174788; Deletion in position 55174790 to 55174794; Substitution in position 55174796 of G replaced by C] OMOP:19553708 - GATA1 on GRCh38 chrX: Insertion in position 48791290 to 48791291 of GCGGCACTGGGGG measurement OMOP:19553720 - CDH1 on GRCh38 chr16: Deletion in position 68823433 measurement OMOP:19553740 - DDX10 transcript: Substitution in position 2263 of G replaced by T measurement OMOP:19553875 - PTEN protein: Frameshift substitution in position 122 of I replaced by W followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19553905 - TET2 on GRCh38 chr4: Substitution in position 105235383 of C replaced by T measurement OMOP:19554151 - NF2 on GRCh38 chr22: Substitution in position 29642211 of C replaced by T measurement OMOP:19554175 - PALB2 on GRCh38 chr16: Substitution in position 23634993 of G replaced by C measurement OMOP:19554189 - CDKN2A protein: Substitution in position 29 of R replaced by W measurement OMOP:19554194 - RB1 transcript: Duplication of position 2258 measurement OMOP:19554331 - del(2)(q37) measurement OMOP:19554368 - NF1 transcript: Substitution in position 6022 of G replaced by C measurement OMOP:19554439 - BCORL1 transcript: Deletion in position 565 measurement OMOP:19554446 - TET2 on GRCh38 chr4: Substitution in position 105243710 of C replaced by A measurement OMOP:19554677 - TET2 on GRCh38 chr4: Deletion in position 105234394 to 105234395 measurement OMOP:19554682 - PTEN transcript: Deletion in position 229 measurement OMOP:19554759 - FH on GRCh38 chr1: Substitution in position 241517298 of G replaced by A measurement OMOP:19554867 - RUNX1 transcript: Insertion in position 423 to 424 of AAGAAGTCTGTTCC measurement OMOP:19554975 - ARHGAP26 transcript: Substitution in position 1423 of A replaced by T measurement OMOP:19554989 - TET2 on GRCh38 chr4: Deletion in position 105275906 to 105275964 measurement OMOP:19555062 - RB1 on GRCh38 chr13: Substitution in position 48459769 of G replaced by A measurement OMOP:19555101 - PTPRD transcript: Substitution in position 1891 of C replaced by T measurement OMOP:19555113 - WT1 protein: Frameshift substitution in position 387 of A replaced by L followed by a new reading frame extending for 4 amino acids measurement OMOP:19555397 - CNOT3 on GRCh38 chr19: Insertion in position 54149585 to 54149586 of G measurement OMOP:19555469 - KMT2D on GRCh38 chr12: Substitution in position 49042181 of C replaced by T measurement OMOP:19555511 - SETD2 transcript: Substitution in position 844 of G replaced by T measurement OMOP:19555799 - STAG2 transcript: Deletion in position 1430 to 1443 measurement OMOP:19555817 - STAG2 on GRCh38 chrX: Substitution in position 124083431 of G replaced by T measurement OMOP:19555995 - MYH9 on GRCh38 chr22: Substitution in position 36300165 of G replaced by A measurement OMOP:19556030 - BRCA1 protein: Frameshift substitution in position 1355 of N replaced by K followed by a new reading frame extending for 10 amino acids measurement OMOP:19556060 - EGFR on GRCh38 chr7: [Deletion in position 55174772 to 55174780; 55174784A=; Substitution in position 55174787 of A replaced by C] OMOP:19556084 - ATR transcript: Deletion in position 2755 measurement OMOP:19556114 - BRCA1 on GRCh38 chr17: Substitution in position 43093200 of A replaced by T measurement OMOP:19556169 - CSMD3 on GRCh38 chr8: Substitution in position 112552675 of A replaced by T measurement OMOP:19556216 - RAD21 transcript: Deletion in position 608 to 611 measurement OMOP:19556826 - VHL on GRCh38 chr3: Deletion in position 10146580 to 10146581 and Insertion of G measurement OMOP:19556928 - KMT2D transcript: Deletion in position 1050 measurement OMOP:19557005 - TSC1 protein: Substitution in position 1065 of T replaced by M measurement OMOP:19557058 - BCORL1 transcript: Substitution in position 2054 of C replaced by A measurement OMOP:19557096 - ARID1A on GRCh38 chr1: Substitution in position 26774371 of A replaced by T measurement OMOP:19557110 - SPEN protein: Frameshift substitution in position 3324 of Q replaced by V followed by a new reading frame extending for 23 amino acids measurement OMOP:19557133 - TSC1 on GRCh38 chr9: Deletion in position 132900783 measurement OMOP:19557169 - TET2 on GRCh38 chr4: Substitution in position 105237111 of G replaced by T measurement OMOP:19557241 - LRP1B protein: Substitution in position 460 of R replaced by an early stop codon measurement OMOP:19557475 - SMARCB1 on GRCh38 chr22: Duplication of position 23834147 measurement OMOP:19557530 - TNFAIP3 transcript: Deletion in position 2111 to 2112 measurement OMOP:19557552 - RUNX1 transcript: Deletion in position 379 to 382 measurement OMOP:19557575 - NOTCH1 transcript: Substitution in position 674 of C replaced by A measurement OMOP:19557622 - APC transcript: Substitution in position 5603 of A replaced by G measurement OMOP:19557688 - ATM protein: Substitution in position 2129 of Y replaced by an early stop codon measurement OMOP:19557704 - STAG2 protein: Frameshift substitution in position 528 of T replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19557707 - CDKN1B protein: Frameshift substitution in position 29 of C replaced by G followed by a new reading frame extending for 12 amino acids measurement OMOP:19557767 - TBX3 on GRCh38 chr12: Duplication of position 114681103 measurement OMOP:19557768 - NCOR2 protein: Frameshift substitution in position 1052 of G replaced by A followed by a new reading frame extending for 11 amino acids measurement OMOP:19557879 - RB1 on GRCh38 chr13: Substitution in position 48307299 of G replaced by T measurement OMOP:19557885 - BAP1 transcript: Deletion in position 839 measurement OMOP:19557902 - DNMT3A protein: Substitution in position 408 of E replaced by an early stop codon measurement OMOP:19557978 - ARID2 protein: Substitution in position 1287 of E replaced by an early stop codon measurement OMOP:19558096 - EP300 transcript: Substitution in position 4173 of G replaced by C measurement OMOP:19558124 - CDH1 protein: Frameshift substitution in position 110 of F replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19558161 - MAP3K1 on GRCh38 chr5: Substitution in position 56865968 of C replaced by A measurement OMOP:19558166 - PTEN on GRCh38 chr10: Duplication of position 87864524 measurement OMOP:19558210 - NF2 on GRCh38 chr22: Deletion in position 29654697 measurement OMOP:19558246 - BCL11B protein: Frameshift substitution in position 241 of Q replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19558287 - NOTCH1 transcript: Substitution in position 898 of C replaced by T measurement OMOP:19558335 - FAT1 transcript: Substitution in position 12487 of G replaced by T measurement OMOP:19558445 - ARID1A on GRCh38 chr1: Duplication of position 26780616 measurement OMOP:19558521 - CDKN2A on GRCh38 chr9: Duplication of position 21971151 measurement OMOP:19558578 - VHL on GRCh38 chr3: Deletion in position 10142156 measurement OMOP:19558604 - SMARCA4 on GRCh38 chr19: Deletion in position 11021839 to 11021857 measurement OMOP:19558840 - COL4A3 transcript: Substitution in position 4793 of T replaced by G measurement OMOP:19558946 - MEN1 on GRCh38 chr11: Deletion in position 64809754 to 64809767 measurement OMOP:19559137 - IKZF3 transcript: Deletion in position 94 measurement OMOP:19559214 - FAT1 transcript: Insertion in position 6835 to 6836 of GT measurement OMOP:19559377 - SETD2 on GRCh38 chr3: Deletion in position 47123842 to 47123855 measurement OMOP:19559468 - CIC transcript: Deletion in position 7189 measurement OMOP:19559577 - ZFHX3 on GRCh38 chr16: Substitution in position 72889866 of G replaced by A measurement OMOP:195597 - Bilateral small kidney OMOP:19559713 - KLF4 protein: Frameshift substitution in position 196 of S replaced by I followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19559726 - MLH1 protein: Substitution in position 117 of T replaced by A measurement OMOP:19559858 - NF1 transcript: Duplication of position 7330 measurement OMOP:19559918 - APC transcript: Substitution in position 3134 of A replaced by G measurement OMOP:19560110 - TET2 transcript: Deletion in position 1906 measurement OMOP:19560154 - WT1 protein: Frameshift substitution in position 376 of V replaced by Y followed by a new reading frame extending for 7 amino acids measurement OMOP:19560161 - STK11 on GRCh38 chr19: Deletion in position 1220594 measurement OMOP:19560256 - SPEN protein: Substitution in position 732 of R replaced by an early stop codon measurement OMOP:19560257 - KDM6A transcript: Insertion in position 3492 to 3493 of T measurement OMOP:19560303 - TET2 protein: Frameshift substitution in position 1049 of K replaced by N followed by a new reading frame extending for 6 amino acids measurement OMOP:19560365 - STK11 protein: Frameshift substitution in position 197 of V replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19560387 - KEAP1 on GRCh38 chr19: Deletion in position 10492012 to 10492016 measurement OMOP:19560389 - ARID2 protein: Substitution in position 293 of L replaced by an early stop codon measurement OMOP:19560413 - CDKN1A on GRCh38 chr6: Insertion in position 36684348 to 36684349 of T measurement OMOP:19560510 - NF1 protein: Substitution in position 845 of C replaced by Y measurement OMOP:19560512 - APC transcript: Deletion in position 4726 measurement OMOP:19560541 - KMT2C transcript: Substitution in position 14629 of C replaced by T measurement OMOP:19560544 - ATM transcript: Deletion in position 1963 measurement OMOP:19560589 - ELF4 on GRCh38 chrX: Substitution in position 130072301 of G replaced by A measurement OMOP:19560621 - PMS2 protein: Substitution in position 376 of P replaced by S measurement OMOP:19560865 - MAP1S protein: Substitution in position 440 of C replaced by Y measurement OMOP:19561149 - ACVR2A protein: Frameshift substitution in position 343 of L replaced by W followed by a new reading frame extending for 3 amino acids measurement OMOP:19561162 - NF1 on GRCh38 chr17: Substitution in position 31330298 of C replaced by G measurement OMOP:19561184 - AXIN2 protein: Substitution in position 659 of R replaced by W measurement OMOP:19561330 - SETD2 on GRCh38 chr3: Duplication of position 47123857 measurement OMOP:19561502 - FLT3 protein: Substitution in position 594 of F replaced by S measurement OMOP:19561514 - NF1 on GRCh38 chr17: Duplication of position 31327699 measurement OMOP:19561521 - APC protein: Frameshift substitution in position 1453 of P replaced by N followed by a new reading frame extending for 19 amino acids measurement OMOP:19561571 - TSC1 on GRCh38 chr9: Deletion in position 132921913 measurement OMOP:19561617 - TET2 on GRCh38 chr4: Substitution in position 105234922 of C replaced by G measurement OMOP:19561667 - CREBBP protein: Frameshift substitution in position 100 of G replaced by V followed by a new reading frame extending for 24 amino acids measurement OMOP:19561730 - NF1 transcript: Deletion in position 5300 to 5317 and Insertion of G measurement OMOP:19561846 - PTEN protein: Substitution in position 101 of I replaced by T measurement OMOP:19561990 - SETD2 protein: Substitution in position 1805 of E replaced by an early stop codon measurement OMOP:19562140 - NOTCH1 protein: Frameshift substitution in position 1595 of E replaced by G followed by a new reading frame extending for 21 amino acids measurement OMOP:19562158 - MAP3K13 on GRCh38 chr3: Duplication of position 185447820 measurement OMOP:19562229 - PTPRC transcript: Substitution in position 2011 of G replaced by T measurement OMOP:19562373 - KMT2D on GRCh38 chr12: Duplication of position 49049690 measurement OMOP:19562460 - MLH1 transcript: Substitution in position 91 of G replaced by A measurement OMOP:19562599 - IRS4 on GRCh38 chrX: Substitution in position 108735403 of A replaced by T measurement OMOP:19562624 - BAP1 on GRCh38 chr3: Deletion in position 52403174 to 52403175 measurement OMOP:19562629 - TP53 protein: Frameshift substitution in position 294 of E replaced by G followed by a new reading frame extending for 12 amino acids measurement OMOP:19562648 - IDH2 protein: Substitution in position 172 of R replaced by W measurement OMOP:19562675 - ERBB2 on GRCh38 chr17: Substitution in position 39715885 of C replaced by T measurement OMOP:19562693 - FUS on GRCh38 chr16: Deletion in position 31184321 to 31184325 measurement OMOP:19562737 - KIT protein: Substitution in position 557 of W replaced by R measurement OMOP:19562823 - TP53 on GRCh38 chr17: Insertion in position 7675168 to 7675169 of AT measurement OMOP:19562922 - CDK12 on GRCh38 chr17: Substitution in position 39471624 of C replaced by T measurement OMOP:19562928 - PIK3R1 transcript: Deletion in position 1889 measurement OMOP:19563096 - KMT2C on GRCh38 chr7: Duplication of position 152252654 measurement OMOP:19563201 - CSMD3 protein: Substitution in position 1222 of C replaced by an early stop codon measurement OMOP:19563207 - PTPN6 on GRCh38 chr12: Duplication of position 6956530 to 6956531 measurement OMOP:19563547 - NBN on GRCh38 chr8: Substitution in position 89943276 of C replaced by A measurement OMOP:19563569 - RB1 on GRCh38 chr13: Substitution in position 48360026 of T replaced by G measurement OMOP:19563595 - APC on GRCh38 chr5: Substitution in position 112838784 of G replaced by T measurement OMOP:19563596 - LATS1 on GRCh38 chr6: Substitution in position 149676561 of G replaced by A measurement OMOP:19563599 - PTPRB protein: Frameshift substitution in position 988 of N replaced by K followed by a new reading frame extending for 7 amino acids measurement OMOP:19563611 - PTCH1 transcript: Deletion in position 3054 to 3055 and Insertion of AA measurement OMOP:19563630 - PMS2 on GRCh38 chr7: Substitution in position 5986946 of C replaced by T measurement OMOP:19563722 - SETD2 transcript: Substitution in position 3766 of A replaced by T measurement OMOP:19563788 - ARID1A on GRCh38 chr1: Substitution in position 26729828 of C replaced by T measurement OMOP:19563800 - ARID1A protein: Frameshift substitution in position 727 of R replaced by W followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19563844 - KDM6A protein: Substitution in position 333 of Q replaced by an early stop codon measurement OMOP:19564045 - CSMD3 protein: Substitution in position 2442 of R replaced by an early stop codon measurement OMOP:19564105 - ARID1B transcript: Insertion in position 2865 to 2866 of T measurement OMOP:19564327 - FANCC on GRCh38 chr9: Substitution in position 95111618 of C replaced by A measurement OMOP:19564447 - KMT2C protein: Substitution in position 2952 of S replaced by an early stop codon measurement OMOP:19564458 - APC protein: Frameshift substitution in position 1642 of Y replaced by L followed by a new reading frame extending for 6 amino acids measurement OMOP:19564462 - APC transcript: Substitution in position 5020 of G replaced by A measurement OMOP:19564561 - PTPN13 on GRCh38 chr4: Substitution in position 86758304 of G replaced by T measurement OMOP:19564611 - STAG2 on GRCh38 chrX: Duplication of position 124066390 to 124066393 measurement OMOP:19564612 - PTPRK on GRCh38 chr6: Substitution in position 128184579 of C replaced by A measurement OMOP:19564653 - ARID1A on GRCh38 chr1: Substitution in position 26779092 of A replaced by T measurement OMOP:19564678 - ZRSR2 on GRCh38 chrX: Duplication of position 15791010 measurement OMOP:19564765 - PRDM1 on GRCh38 chr6: Substitution in position 106105793 of G replaced by T measurement OMOP:19564816 - ARID1A protein: Substitution in position 1172 of Q replaced by an early stop codon measurement OMOP:19564909 - TP53 transcript: Deletion in position 929 measurement OMOP:19565104 - FOXO1 protein: Substitution in position 196 of Y replaced by an early stop codon measurement OMOP:19565233 - IDH1 transcript: Deletion in position 394 to 395 and Insertion of TC measurement OMOP:19565243 - RUNX1 on GRCh38 chr21: Duplication of position 34880666 measurement OMOP:19565417 - BAP1 on GRCh38 chr3: Deletion in position 52407437 to 52407441 measurement OMOP:19565454 - KDM6A transcript: Substitution in position 1324 of C replaced by T measurement OMOP:19565500 - IRS4 transcript: Substitution in position 1781 of C replaced by G measurement OMOP:19565586 - KMT2C on GRCh38 chr7: Deletion in position 152148879 measurement OMOP:19565591 - ASXL1 on GRCh38 chr20: Duplication of position 32434763 measurement OMOP:19565699 - LRP1B on GRCh38 chr2: Substitution in position 140534126 of G replaced by A measurement OMOP:19565767 - CARS1 protein: Substitution in position 362 of E replaced by an early stop codon measurement OMOP:19565859 - PLEC transcript: Substitution in position 3704 of G replaced by A measurement OMOP:19565901 - KMT2D transcript: Substitution in position 3760 of G replaced by T measurement OMOP:19566015 - VHL on GRCh38 chr3: Deletion in position 10142104 to 10142114 measurement OMOP:19566108 - RAD50 transcript: Substitution in position 1958 of C replaced by A measurement OMOP:19566129 - MUC6 transcript: Substitution in position 5966 of T replaced by C measurement OMOP:19566167 - RET on GRCh38 chr10: Substitution in position 43114719 of G replaced by A measurement OMOP:19566219 - RHOH on GRCh38 chr4: Deletion in position 40243758 measurement OMOP:19566306 - PTEN on GRCh38 chr10: Duplication of position 87933059 to 87933090 measurement OMOP:19566334 - SPEN on GRCh38 chr1: Substitution in position 15872868 of G replaced by T measurement OMOP:19566335 - TP53 protein: Frameshift substitution in position 255 of I replaced by T followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19566367 - PTCH1 transcript: Substitution in position 3485 of G replaced by T measurement OMOP:19566380 - ATRX protein: Frameshift substitution in position 883 of Q replaced by R followed by a new reading frame extending for 13 amino acids measurement OMOP:19566411 - KDM6A protein: Frameshift substitution in position 791 of N replaced by T followed by a new reading frame extending for 11 amino acids measurement OMOP:19566422 - KMT2C on GRCh38 chr7: Substitution in position 152176598 of G replaced by C measurement OMOP:19566480 - MED12 on GRCh38 chrX: Substitution in position 71126482 of C replaced by T measurement OMOP:19566481 - GATA1 on GRCh38 chrX: Duplication of position 48791283 to 48791302 measurement OMOP:19566639 - ARID1A protein: Frameshift substitution in position 923 of M replaced by H followed by a new reading frame extending for 13 amino acids measurement OMOP:19566648 - RET on GRCh38 chr10: Substitution in position 43115503 of C replaced by T measurement OMOP:19566757 - BIRC3 transcript: Substitution in position 1471 of C replaced by T measurement OMOP:19566763 - CEBPA protein: Frameshift substitution in position 50 of E replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19566929 - GATA1 transcript: Insertion in position 178 to 179 of AGCCACCGCTGCAGCTGCAC measurement OMOP:19566957 - TRAF7 protein: Substitution in position 429 of Y replaced by an early stop codon measurement OMOP:19566985 - AR protein: Substitution in position 616 of R replaced by C measurement OMOP:19567159 - CUX1 transcript: Substitution in position 3793 of C replaced by T measurement OMOP:19567227 - SMC1A transcript: Substitution in position 3115 of C replaced by T measurement OMOP:19567231 - TSC1 on GRCh38 chr9: Substitution in position 132896491 of G replaced by C measurement OMOP:19567251 - NCOR1 protein: Substitution in position 524 of K replaced by an early stop codon measurement OMOP:19567364 - FANCA transcript: Substitution in position 2529 of C replaced by G measurement OMOP:19567523 - CDKN2A on GRCh38 chr9: Deletion in position 21974700 measurement OMOP:19567531 - PTCH1 transcript: Duplication of position 2752 to 2758 measurement OMOP:19567557 - KMT2C on GRCh38 chr7: Deletion in position 152194517 to 152194520 measurement OMOP:19567629 - CUX1 transcript: Substitution in position 2950 of C replaced by T measurement OMOP:19567647 - ATR transcript: Substitution in position 7435 of G replaced by T measurement OMOP:19567724 - SLC34A2 on GRCh38 chr4: Insertion in position 25673210 to 25673211 of ACTAG measurement OMOP:19567797 - TSC2 protein: Substitution in position 1419 of Q replaced by an early stop codon measurement OMOP:19567923 - ETV6 on GRCh38 chr12: Duplication of position 11853489 measurement OMOP:19568012 - ARID1A protein: Frameshift substitution in position 339 of A replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19568200 - TSC1 protein: Substitution in position 1080 of S replaced by an early stop codon measurement OMOP:19568334 - ARID1B transcript: Substitution in position 7115 of T replaced by A measurement OMOP:19568371 - LRIG3 protein: Frameshift substitution in position 273 of N replaced by T followed by a new reading frame extending for 2 amino acids measurement OMOP:19568688 - KMT2D protein: Substitution in position 5528 of G replaced by an early stop codon measurement OMOP:19568754 - CIITA on GRCh38 chr16: Substitution in position 10907107 of C replaced by T measurement OMOP:19568792 - RUNX1 on GRCh38 chr21: Duplication of position 34792466 measurement OMOP:19568937 - BRCA1 transcript: Substitution in position 4270 of C replaced by T measurement OMOP:19568952 - CHEK2 protein: Substitution in position 394 of E replaced by K measurement OMOP:19569029 - VHL protein: Substitution in position 77 of C replaced by an early stop codon measurement OMOP:19569061 - RET on GRCh38 chr10: Substitution in position 43105191 of G replaced by A measurement OMOP:19569160 - TET2 protein: Frameshift substitution in position 800 of H replaced by L followed by a new reading frame extending for 13 amino acids measurement OMOP:19569170 - PTCH1 transcript: Deletion in position 2635 to 2665 measurement OMOP:19569195 - KMT2D transcript: Substitution in position 11491 of C replaced by T measurement OMOP:19569231 - CREBBP transcript: Substitution in position 1114 of C replaced by T measurement OMOP:19569273 - EBF1 protein: Frameshift substitution in position 35 of G replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19569405 - MYC protein: Substitution in position 73 of T replaced by N measurement OMOP:19569568 - APC transcript: Deletion in position 3814 measurement OMOP:19569570 - SMARCD1 transcript: Duplication of position 68 measurement OMOP:19569571 - TET2 on GRCh38 chr4: Deletion in position 105236482 to 105236485 measurement OMOP:19569659 - NF2 on GRCh38 chr22: Duplication of position 29636865 measurement OMOP:19569664 - TET2 transcript: Substitution in position 1059 of T replaced by A measurement OMOP:19569732 - ARID1A transcript: Substitution in position 1841 of C replaced by G measurement OMOP:19569775 - BRCA2 transcript: Deletion in position 755 to 758 measurement OMOP:19569780 - XRCC2 on GRCh38 chr7: Substitution in position 152648842 of G replaced by A measurement OMOP:19569783 - BRCA1 on GRCh38 chr17: Substitution in position 43091813 of G replaced by A measurement OMOP:19569817 - SETD2 on GRCh38 chr3: Insertion in position 47084266 to 47084267 of G measurement OMOP:19569830 - AMER1 transcript: Deletion in position 1061 measurement OMOP:19569843 - WT1 on GRCh38 chr11: Duplication of position 32396367 to 32396374 measurement OMOP:19570142 - PTPRC transcript: Substitution in position 823 of G replaced by T measurement OMOP:19570229 - ATRX protein: Substitution in position 328 of E replaced by an early stop codon measurement OMOP:19570267 - BAZ1A on GRCh38 chr14: Deletion in position 34862318 measurement OMOP:19570466 - PTEN on GRCh38 chr10: Deletion in position 87957931 measurement OMOP:19570648 - PTEN on GRCh38 chr10: Substitution in position 87933018 of C replaced by T measurement OMOP:19570661 - TET2 transcript: Duplication of position 5632 to 5633 measurement OMOP:19570688 - PRDM1 on GRCh38 chr6: Substitution in position 106099485 of G replaced by A measurement OMOP:19570713 - CCDC6 on GRCh38 chr10: Substitution in position 59852678 of C replaced by A measurement OMOP:19570726 - ERCC2 on GRCh38 chr19: Substitution in position 45370197 of T replaced by C measurement OMOP:19570764 - NF1 protein: Frameshift substitution in position 2481 of G replaced by V followed by a new reading frame extending for 8 amino acids measurement OMOP:19570912 - B2M on GRCh38 chr15: Substitution in position 44715521 of G replaced by T measurement OMOP:19570931 - PMS2 protein: Substitution in position 756 of D replaced by N measurement OMOP:19570981 - RB1 protein: Frameshift substitution in position 649 of L replaced by F followed by a new reading frame extending for 11 amino acids measurement OMOP:19571061 - SETD1B on GRCh38 chr12: Deletion in position 121823344 measurement OMOP:19571193 - CDKN1A on GRCh38 chr6: Deletion in position 36684147 to 36684148 measurement OMOP:19571208 - RBM10 protein: Substitution in position 98 of R replaced by an early stop codon measurement OMOP:19571273 - APC on GRCh38 chr5: Duplication of position 112840261 measurement OMOP:19571315 - TET2 on GRCh38 chr4: Deletion in position 105275363 to 105275366 measurement OMOP:19571344 - FANCE transcript: Substitution in position 833 of T replaced by A measurement OMOP:19571372 - TP53 on GRCh38 chr17: Deletion in position 7676096 to 7676105 measurement OMOP:19571457 - FBXW7 on GRCh38 chr4: Duplication of position 152326196 measurement OMOP:19571515 - PHF6 transcript: Substitution in position 877 of G replaced by T measurement OMOP:19571597 - PTCH1 protein: Frameshift substitution in position 1202 of S replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19571601 - ATRX transcript: Insertion in position 2658 to 2659 of GA measurement OMOP:19571608 - TP53 transcript: Deletion in position 694 to 701 measurement OMOP:19571657 - FAT1 protein: Substitution in position 3654 of E replaced by an early stop codon measurement OMOP:19571731 - EBF1 transcript: Deletion in position 1542 measurement OMOP:19571768 - AMER1 on GRCh38 chrX: Insertion in position 64192691 to 64192692 of CT measurement OMOP:19571893 - PTEN transcript: Duplication of position 21 measurement OMOP:19571955 - PAX5 protein: Frameshift substitution in position 381 of P replaced by H followed by a new reading frame extending for 22 amino acids measurement OMOP:19572009 - RUNX1 protein: Frameshift substitution in position 250 of R replaced by P followed by a new reading frame extending for 2 amino acids measurement OMOP:19572013 - JAK2 on GRCh38 chr9: Substitution in position 5077568 of C replaced by A measurement OMOP:19572061 - KMT2D transcript: Substitution in position 2434 of G replaced by T measurement OMOP:19572297 - FAT4 transcript: Substitution in position 12918 of G replaced by A measurement OMOP:19572589 - SDHD on GRCh38 chr11: Substitution in position 112086908 of A replaced by T measurement OMOP:19572596 - TET1 on GRCh38 chr10: Substitution in position 68690970 of C replaced by G measurement OMOP:19572628 - MSH6 transcript: Deletion in position 3111 to 3118 measurement OMOP:19572677 - CDH1 transcript: Deletion in position 2406 measurement OMOP:19572710 - ZFHX3 protein: Frameshift substitution in position 225 of S replaced by T followed by a new reading frame extending for 17 amino acids measurement OMOP:19572715 - SMAD4 protein: Substitution in position 249 of Q replaced by an early stop codon measurement OMOP:19572785 - APC on GRCh38 chr5: Substitution in position 112839087 of A replaced by T measurement OMOP:19572954 - KMT2D protein: Frameshift substitution in position 2343 of P replaced by R followed by a new reading frame extending for 5 amino acids measurement OMOP:19573091 - FLT3 on GRCh38 chr13: Substitution in position 28034118 of G replaced by A measurement OMOP:19573092 - TP53 on GRCh38 chr17: Substitution in position 7676059 of G replaced by T measurement OMOP:19573171 - CDH1 transcript: Deletion in position 610 to 611 measurement OMOP:19573238 - ASXL1 protein: Substitution in position 1350 of Q replaced by an early stop codon measurement OMOP:19573255 - BCL11B transcript: Deletion in position 814 measurement OMOP:19573305 - BUB1B protein: Substitution in position 309 of Q replaced by an early stop codon measurement OMOP:19573335 - KMT2C on GRCh38 chr7: Deletion in position 152146695 measurement OMOP:19573516 - NFE2L2 protein: Substitution in position 31 of G replaced by R measurement OMOP:19573763 - VHL on GRCh38 chr3: Deletion in position 10142081 to 10142084 measurement OMOP:19573835 - ASXL2 on GRCh38 chr2: Insertion in position 25744365 to 25744366 of TC measurement OMOP:19573840 - POLE transcript: Substitution in position 6433 of C replaced by T measurement OMOP:19573895 - SDHB transcript: Substitution in position 343 of C replaced by T measurement OMOP:19573973 - KDM6A protein: Substitution in position 363 of E replaced by an early stop codon measurement OMOP:19573995 - GNAQ transcript: Substitution in position 627 of A replaced by T measurement OMOP:19574136 - MAP3K1 transcript: Deletion in position 3439 to 3446 and Insertion of A measurement OMOP:19574286 - ARID1A transcript: Deletion in position 4839 to 4840 and Insertion of TT measurement OMOP:19574311 - HRAS protein: Substitution in position 12 of G replaced by R measurement OMOP:19574388 - DAXX on GRCh38 chr6: Substitution in position 33319725 of A replaced by T measurement OMOP:19574505 - KMT2D transcript: Insertion in position 12823 to 12824 of T measurement OMOP:19574602 - SETBP1 on GRCh38 chr18: Substitution in position 44951949 of G replaced by A measurement OMOP:19574689 - TSC2 on GRCh38 chr16: Substitution in position 2084273 of G replaced by T measurement OMOP:19574751 - DNM2 transcript: Substitution in position 2308 of C replaced by T measurement OMOP:19575059 - SETD1B transcript: Deletion in position 4082 measurement OMOP:19575125 - APC transcript: Insertion in position 4086 to 4087 of T measurement OMOP:19575175 - TET2 protein: Substitution in position 803 of Q replaced by an early stop codon measurement OMOP:19575263 - APOBEC3B on GRCh38 chr22: Duplication of position 38986082 measurement OMOP:19575270 - CACNA1B protein: Substitution in position 996 of T replaced by A measurement OMOP:19575283 - ARID1A transcript: Deletion in position 318 to 335 and Insertion of A measurement OMOP:19575308 - EGFR on GRCh38 chr7: [Deletion in position 55174779 to 55174788; Deletion in position 55174790 to 55174794; Substitution in position 55174796 of G replaced by A] OMOP:19575609 - SETD2 protein: Substitution in position 1598 of R replaced by an early stop codon measurement OMOP:19575684 - EP300 protein: Substitution in position 896 of Q replaced by an early stop codon measurement OMOP:19575852 - ERICH6B on GRCh38 chr13: Substitution in position 45596593 of T replaced by C measurement OMOP:19575926 - CDK12 transcript: Deletion in position 77 measurement OMOP:19576041 - PRDM1 transcript: Duplication of position 331 to 334 measurement OMOP:19576065 - RSPO2 protein: Substitution in position 127 of E replaced by an early stop codon measurement OMOP:19576218 - SMARCA4 transcript: Substitution in position 4555 of C replaced by T measurement OMOP:19576283 - NOTCH2 transcript: Deletion in position 4749 to 4750 and Insertion of TT measurement OMOP:19576335 - PTEN protein: Frameshift substitution in position 234 of R replaced by S followed by a new reading frame extending for 12 amino acids measurement OMOP:19576401 - ARID1A on GRCh38 chr1: Deletion in position 26729695 to 26729711 measurement OMOP:19576429 - ERCC3 protein: Frameshift substitution in position 266 of Q replaced by D followed by a new reading frame extending for 7 amino acids measurement OMOP:19576473 - LATS2 protein: Frameshift substitution in position 476 of A replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19576666 - TET2 on GRCh38 chr4: Deletion in position 105236746 to 105236747 measurement OMOP:19576744 - ETV6 on GRCh38 chr12: Deletion in position 11869783 to 11869817 measurement OMOP:19576749 - ROBO2 protein: Frameshift substitution in position 576 of A replaced by Q followed by a new reading frame extending for 4 amino acids measurement OMOP:19576834 - SETD2 protein: Frameshift substitution in position 2162 of H replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19576840 - ARID1A transcript: Substitution in position 88 of C replaced by T measurement OMOP:19576944 - LRIG3 transcript: Substitution in position 2270 of C replaced by G measurement OMOP:19577166 - CNTNAP2 transcript: Duplication of position 3337 measurement OMOP:19577181 - RUNX1 on GRCh38 chr21: Deletion in position 34880611 measurement OMOP:19577237 - TNFRSF14 transcript: Deletion in position 359 measurement OMOP:19577382 - BIRC3 on GRCh38 chr11: Substitution in position 102336121 of G replaced by T measurement OMOP:19577411 - SETD2 transcript: Substitution in position 868 of G replaced by T measurement OMOP:19577423 - ATRX on GRCh38 chrX: Duplication of position 77654145 measurement OMOP:19577427 - CACNA1D transcript: Substitution in position 313 of G replaced by T measurement OMOP:19577511 - BLM transcript: Deletion in position 2008 to 2021 measurement OMOP:19577563 - FGFR3 on GRCh38 chr4: Substitution in position 1806548 of G replaced by T measurement OMOP:19577597 - APC on GRCh38 chr5: Duplication of position 112840237 measurement OMOP:19577645 - AR transcript: Substitution in position 2164 of G replaced by A measurement OMOP:19577729 - CBLB on GRCh38 chr3: Deletion in position 105670271 to 105670272 measurement OMOP:19577739 - KDM6A protein: Frameshift substitution in position 1191 of P replaced by Q followed by a new reading frame extending for 19 amino acids measurement OMOP:19577757 - FANCA transcript: Substitution in position 3064 of C replaced by T measurement OMOP:19577764 - ALK on GRCh38 chr2: Deletion in position 29695006 measurement OMOP:19577988 - TP53 protein: Substitution in position 16 of Q replaced by an early stop codon measurement OMOP:19577997 - CREBBP protein: Substitution in position 1808 of C replaced by an early stop codon measurement OMOP:19578069 - LRP1B on GRCh38 chr2: Substitution in position 140989601 of T replaced by A measurement OMOP:19578077 - ATM protein: Frameshift substitution in position 932 of D replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19578244 - TET2 on GRCh38 chr4: Duplication of position 105234716 measurement OMOP:19578317 - PTEN on GRCh38 chr10: Deletion in position 87957995 measurement OMOP:19578416 - NOTCH1 protein: Frameshift substitution in position 270 of G replaced by V followed by a new reading frame extending for 7 amino acids measurement OMOP:19578433 - PTEN on GRCh38 chr10: Substitution in position 87957904 of C replaced by A measurement OMOP:19578475 - BAP1 transcript: Deletion in position 989 measurement OMOP:19578554 - RB1 transcript: Substitution in position 1535 of T replaced by A measurement OMOP:19578631 - ARID1A transcript: Deletion in position 1848 measurement OMOP:19578639 - RB1 protein: Substitution in position 864 of E replaced by an early stop codon measurement OMOP:19578785 - TENT5C transcript: Substitution in position 873 of C replaced by A measurement OMOP:19578799 - WIPI2 protein: Substitution in position 324 of R replaced by P measurement OMOP:19578825 - IKZF1 on GRCh38 chr7: Substitution in position 50391764 of G replaced by T measurement OMOP:19578844 - TSC2 transcript: Substitution in position 1494 of G replaced by A measurement OMOP:19578903 - ACVR2A on GRCh38 chr2: Substitution in position 147927260 of G replaced by T measurement OMOP:19578945 - BRCA2 transcript: Deletion in position 4478 to 4481 measurement OMOP:19579001 - ARID2 transcript: Substitution in position 4942 of C replaced by T measurement OMOP:19579056 - TET2 protein: Frameshift substitution in position 1420 of L replaced by F followed by a new reading frame extending for 28 amino acids measurement OMOP:19579097 - PALB2 on GRCh38 chr16: Deletion in position 23634984 measurement OMOP:19579113 - GATA1 protein: Frameshift substitution in position 19 of V replaced by G followed by a new reading frame extending for 20 amino acids measurement OMOP:19579114 - TP53 protein: Substitution in position 136 of Q replaced by E measurement OMOP:19579215 - CDKN1A transcript: Deletion in position 216 to 217 measurement OMOP:19579247 - BRCA1 transcript: Substitution in position 505 of C replaced by T measurement OMOP:19579320 - VHL transcript: Substitution in position 475 of A replaced by T measurement OMOP:19579384 - MLH1 protein: Substitution in position 234 of E replaced by an early stop codon measurement OMOP:19579387 - IRS4 on GRCh38 chrX: Substitution in position 108734472 of G replaced by A measurement OMOP:19579420 - FUS on GRCh38 chr16: Substitution in position 31190791 of A replaced by T measurement OMOP:19579454 - TSKS on GRCh38 chr19: Substitution in position 49746648 of T replaced by C measurement OMOP:19579465 - TSC2 on GRCh38 chr16: Substitution in position 2065630 of C replaced by T measurement OMOP:19579546 - NOTCH2 transcript: Deletion in position 6867 to 6871 measurement OMOP:19579701 - RUNX1 transcript: Deletion in position 436 to 437 measurement OMOP:19579841 - KDR on GRCh38 chr4: Substitution in position 55090053 of C replaced by T measurement OMOP:19579952 - PDGFRB protein: Substitution in position 370 of R replaced by C measurement OMOP:19579953 - KMT2D on GRCh38 chr12: Substitution in position 49034171 of G replaced by A measurement OMOP:19579971 - CDH1 protein: Frameshift substitution in position 137 of A replaced by E followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19580019 - APC transcript: Substitution in position 7225 of G replaced by A measurement OMOP:19580040 - TP53 on GRCh38 chr17: Insertion in position 7673598 to 7673599 of A measurement OMOP:19580085 - SOS1 protein: Substitution in position 215 of Y replaced by H measurement OMOP:19580165 - FANCA protein: Substitution in position 103 of S replaced by an early stop codon measurement OMOP:19580166 - NCOR2 transcript: Duplication of position 210 measurement OMOP:19580172 - NF1 protein: Frameshift substitution in position 2270 of I replaced by F followed by a new reading frame extending for 10 amino acids measurement OMOP:19580199 - PTCH1 protein: Frameshift substitution in position 585 of F replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19580265 - KMT2D protein: Frameshift substitution in position 3176 of S replaced by M followed by a new reading frame extending for 21 amino acids measurement OMOP:19580473 - KMT2D transcript: Deletion in position 15108 measurement OMOP:19583996 - BRCA2 protein: Substitution in position 2873 of F replaced by C measurement OMOP:19580620 - FAT1 protein: Frameshift substitution in position 3698 of V replaced by C followed by a new reading frame extending for 6 amino acids measurement OMOP:19580727 - MORC1 protein: Substitution in position 878 of E replaced by K measurement OMOP:19580760 - SPEN transcript: Deletion in position 7789 to 7790 measurement OMOP:19580863 - MEN1 on GRCh38 chr11: Substitution in position 64804645 of G replaced by A measurement OMOP:19581042 - FAT1 protein: Frameshift substitution in position 396 of S replaced by F followed by a new reading frame extending for 8 amino acids measurement OMOP:19581075 - BMPR1A transcript: Substitution in position 3 of G replaced by T measurement OMOP:19581091 - RANBP2 protein: Frameshift substitution in position 3068 of F replaced by L followed by a new reading frame extending for 10 amino acids measurement OMOP:19581095 - FAT4 on GRCh38 chr4: Insertion in position 125320820 to 125320821 of AGAGA measurement OMOP:19581213 - PTPRT on GRCh38 chr20: Substitution in position 42080912 of G replaced by T measurement OMOP:19581221 - SPEN protein: Substitution in position 3450 of Q replaced by an early stop codon measurement OMOP:19581272 - PTEN transcript: Duplication of position 491 measurement OMOP:19581311 - TET2 on GRCh38 chr4: Substitution in position 105275131 of C replaced by T measurement OMOP:19581434 - ZFHX3 transcript: Substitution in position 5635 of A replaced by T measurement OMOP:19581679 - NF2 transcript: Deletion in position 281 to 290 measurement OMOP:19581721 - CEBPA on GRCh38 chr19: Duplication of position 33302127 measurement OMOP:19581795 - APC transcript: Substitution in position 799 of G replaced by T measurement OMOP:19581799 - TP53 on GRCh38 chr17: Duplication of position 7673755 to 7673756 measurement OMOP:19581848 - BMPR1A on GRCh38 chr10: Substitution in position 86917257 of G replaced by T measurement OMOP:19581992 - CDKN1B transcript: Duplication of position 49 measurement OMOP:19582056 - MLH1 transcript: Deletion in position 2059 measurement OMOP:19582065 - CNTNAP2 protein: Substitution in position 442 of M replaced by an early stop codon measurement OMOP:19582074 - CTNNA1 on GRCh38 chr5: Duplication of position 138917813 measurement OMOP:19582227 - APC on GRCh38 chr5: Substitution in position 112839939 of A replaced by T measurement OMOP:19582279 - CDKN2A transcript: Deletion in position 282 measurement OMOP:19582309 - BTK transcript: Deletion in position 1055 measurement OMOP:19582357 - CREBBP transcript: Substitution in position 2965 of G replaced by T measurement OMOP:19582361 - KNL1 transcript: Deletion in position 220 to 221 measurement OMOP:19582526 - NOTCH1 on GRCh38 chr9: Substitution in position 136508110 of C replaced by A measurement OMOP:19582562 - SETD2 protein: Frameshift substitution in position 1000 of F replaced by I followed by a new reading frame extending for 5 amino acids measurement OMOP:19582577 - STK11 on GRCh38 chr19: Substitution in position 1222988 of G replaced by A measurement OMOP:19582583 - FAT4 transcript: Substitution in position 14701 of G replaced by T measurement OMOP:19582613 - RB1 protein: Substitution in position 825 of M replaced by an early stop codon measurement OMOP:19582704 - EPS15 protein: Substitution in position 278 of S replaced by an early stop codon measurement OMOP:19582738 - FAT4 transcript: Substitution in position 9915 of C replaced by G measurement OMOP:19582864 - BAP1 protein: Frameshift substitution in position 636 of L replaced by R followed by a new reading frame extending for 17 amino acids measurement OMOP:19582946 - TET2 transcript: Deletion in position 4474 measurement OMOP:19582980 - CDK12 on GRCh38 chr17: Deletion in position 39471112 measurement OMOP:19582996 - CSMD3 protein: Substitution in position 2395 of C replaced by an early stop codon measurement OMOP:19583162 - CEBPA on GRCh38 chr19: Deletion in position 33302072 to 33302080 and Insertion of C measurement OMOP:19583297 - RB1 protein: Substitution in position 574 of K replaced by an early stop codon measurement OMOP:19583332 - DNM2 on GRCh38 chr19: Substitution in position 10718315 of C replaced by T measurement OMOP:19583427 - PTEN protein: Frameshift substitution in position 247 of L replaced by C followed by a new reading frame extending for 4 amino acids measurement OMOP:19583540 - IPO4 transcript: Substitution in position 1738 of C replaced by G measurement OMOP:19583585 - TET2 protein: Frameshift substitution in position 602 of S replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19583605 - BRCA2 on GRCh38 chr13: [Duplication of position 32340300; Substitution in position 32340301 of T replaced by G; Deletion in position 32340303] OMOP:19583656 - APC transcript: Substitution in position 7942 of G replaced by A measurement OMOP:19583681 - ERBB3 on GRCh38 chr12: Substitution in position 56087606 of C replaced by T measurement OMOP:19583712 - EZH2 transcript: Substitution in position 100 of C replaced by T measurement OMOP:19583735 - DNMT3A protein: Frameshift substitution in position 557 of C replaced by F followed by a new reading frame extending for 20 amino acids measurement OMOP:19583755 - BCL10 transcript: Substitution in position 407 of C replaced by G measurement OMOP:19583771 - ALK on GRCh38 chr2: Substitution in position 29251069 of T replaced by C measurement OMOP:19583830 - B2M on GRCh38 chr15: Deletion in position 44711562 measurement OMOP:19583861 - DNM2 on GRCh38 chr19: Insertion in position 10783068 to 10783069 of TTCTATCT measurement OMOP:19583899 - EZH2 on GRCh38 chr7: Deletion in position 148828778 to 148828779 measurement OMOP:19583916 - APC on GRCh38 chr5: Substitution in position 112835075 of G replaced by A measurement OMOP:19584196 - WT1 transcript: Substitution in position 640 of C replaced by T measurement OMOP:19584334 - ARID1B transcript: Substitution in position 6364 of G replaced by T measurement OMOP:19584348 - CDH11 protein: Frameshift substitution in position 595 of C replaced by A followed by a new reading frame extending for 3 amino acids measurement OMOP:19584414 - SMAD2 transcript: Duplication of position 363 measurement OMOP:19584441 - MYCN on GRCh38 chr2: Substitution in position 15942544 of C replaced by A measurement OMOP:19584633 - CIITA protein: Frameshift substitution in position 655 of G replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19584660 - CSMD3 transcript: Substitution in position 1471 of G replaced by T measurement OMOP:19584664 - NOTCH1 on GRCh38 chr9: Duplication of position 136496403 to 136496407 measurement OMOP:19584697 - ERBB3 transcript: Substitution in position 994 of G replaced by A measurement OMOP:19584740 - GRIN2A protein: Frameshift substitution in position 819 of G replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19584772 - CTCF protein: Substitution in position 625 of E replaced by an early stop codon measurement OMOP:19584803 - PRF1 transcript: Substitution in position 86 of C replaced by G measurement OMOP:19584861 - KDM6A protein: Frameshift substitution in position 611 of R replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19584975 - APC transcript: Deletion in position 3074 measurement OMOP:19584978 - RAD21 protein: Substitution in position 433 of Q replaced by an early stop codon measurement OMOP:19585189 - AKT1 on GRCh38 chr14: Substitution in position 104775853 of C replaced by A measurement OMOP:19585202 - TET2 transcript: Deletion in position 2083 to 2084 measurement OMOP:19585224 - APC protein: Frameshift substitution in position 1407 of S replaced by V followed by a new reading frame extending for 8 amino acids measurement OMOP:19585257 - PTCH1 transcript: Deletion in position 50 measurement OMOP:19585274 - TNFRSF14 transcript: Deletion in position 2 to 12 measurement OMOP:19585303 - ROS1 transcript: Substitution in position 1191+8 of C replaced by T measurement OMOP:19585348 - ARID1A on GRCh38 chr1: Duplication of position 26731457 measurement OMOP:19585498 - JAK1 protein: Frameshift substitution in position 246 of D replaced by I followed by a new reading frame extending for 3 amino acids measurement OMOP:19585519 - BTG1 on GRCh38 chr12: Substitution in position 92145424 of G replaced by A measurement OMOP:19585622 - NOTCH2 on GRCh38 chr1: Deletion in position 119916317 to 119916318 measurement OMOP:19585623 - PTCH1 transcript: Substitution in position 1810 of G replaced by T measurement OMOP:19585630 - ATM protein: Frameshift substitution in position 1192 of K replaced by R followed by a new reading frame extending for 3 amino acids measurement OMOP:19585646 - ERCC5 transcript: Substitution in position 1096 of C replaced by T measurement OMOP:19585677 - SMARCA4 on GRCh38 chr19: Deletion in position 11021821 measurement OMOP:19585860 - RAD21 on GRCh38 chr8: Insertion in position 116857312 to 116857313 of ACGAA measurement OMOP:19585992 - POLQ on GRCh38 chr3: Substitution in position 121496871 of G replaced by A measurement OMOP:19586100 - WRN transcript: Substitution in position 1871 of C replaced by G measurement OMOP:19586108 - TET2 transcript: Substitution in position 4624 of C replaced by T measurement OMOP:19586120 - AMER1 transcript: Deletion in position 498 measurement OMOP:19586149 - NF2 protein: Frameshift substitution in position 91 of P replaced by Q followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19586632 - NCOR1 protein: Frameshift substitution in position 608 of P replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19586676 - NTRK1 protein: Substitution in position 593 of R replaced by L measurement OMOP:19586685 - ARID1A on GRCh38 chr1: Deletion in position 26780531 to 26780532 and Insertion of TT measurement OMOP:195867 - Noninflammatory disorder of the vagina OMOP:19586710 - NCOR1 on GRCh38 chr17: Substitution in position 16039466 of G replaced by A measurement OMOP:19586822 - NF2 protein: Frameshift substitution in position 247 of E replaced by R followed by a new reading frame extending for 4 amino acids measurement OMOP:19586830 - KDM5C transcript: Deletion in position 813 measurement OMOP:19586930 - TCF3 on GRCh38 chr19: Deletion in position 1632079 to 1632080 measurement OMOP:19586953 - FBXW7 transcript: Substitution in position 1309 of G replaced by T measurement OMOP:19587129 - SUZ12 transcript: Insertion in position 504 to 505 of A measurement OMOP:19587130 - RNF43 on GRCh38 chr17: Substitution in position 58358822 of C replaced by G measurement OMOP:19587216 - CREBBP on GRCh38 chr16: Duplication of position 3729218 measurement OMOP:19587380 - NOTCH2 on GRCh38 chr1: Deletion in position 119922742 to 119922745 measurement OMOP:19587414 - SMAD3 on GRCh38 chr15: Substitution in position 67181297 of G replaced by T measurement OMOP:19587551 - KMT2D transcript: Insertion in position 5561 to 5562 of TCAGTGC measurement OMOP:19587685 - BMPR1A transcript: Substitution in position 528 of C replaced by A measurement OMOP:19587733 - FBXW7 transcript: Duplication of position 1417 measurement OMOP:19587755 - CDK12 transcript: Duplication of position 4382 measurement OMOP:19587769 - B2M on GRCh38 chr15: Deletion in position 44715460 measurement OMOP:19587803 - IKZF1 transcript: Substitution in position 1517 of C replaced by A measurement OMOP:19587873 - MSH6 protein: Substitution in position 1048 of Q replaced by an early stop codon measurement OMOP:19587884 - CDKN2A transcript: Insertion in position 249 to 250 of TT measurement OMOP:19587930 - PTEN on GRCh38 chr10: Duplication of position 87960925 measurement OMOP:19587942 - CAMTA1 transcript: Substitution in position 1999 of G replaced by T measurement OMOP:19587971 - TP53 transcript: Deletion in position 680 measurement OMOP:19587976 - AMER1 transcript: Substitution in position 1504 of G replaced by T measurement OMOP:19588034 - STAG1 on GRCh38 chr3: Substitution in position 136377722 of T replaced by A measurement OMOP:19588051 - FOXO4 transcript: Substitution in position 988 of C replaced by T measurement OMOP:19588237 - STAG1 transcript: Deletion in position 372 measurement OMOP:19588246 - ATR transcript: Substitution in position 4975 of G replaced by T measurement OMOP:19588289 - LATS1 on GRCh38 chr6: Substitution in position 149679903 of C replaced by T measurement OMOP:19588408 - CNTNAP2 protein: Substitution in position 882 of W replaced by an early stop codon measurement OMOP:19588517 - LATS2 transcript: Substitution in position 2206 of C replaced by T measurement OMOP:19588550 - USP44 on GRCh38 chr12: Substitution in position 95533260 of G replaced by A measurement OMOP:19588645 - CHEK2 protein: Substitution in position 471 of P replaced by L measurement OMOP:19588722 - BRCA2 on GRCh38 chr13: Substitution in position 32398516 of G replaced by T measurement OMOP:19588855 - MAP3K1 transcript: Deletion in position 3826 measurement OMOP:19588897 - FANCA on GRCh38 chr16: Deletion in position 89814589 measurement OMOP:19589049 - ARID1B on GRCh38 chr6: Deletion in position 156778450 measurement OMOP:19589112 - CSMD3 transcript: Substitution in position 6088 of C replaced by T measurement OMOP:19589306 - PTPN13 on GRCh38 chr4: Substitution in position 86807660 of C replaced by A measurement OMOP:19589499 - TBX3 transcript: Insertion in position 363 to 364 of TC measurement OMOP:19589676 - SMARCA4 on GRCh38 chr19: Deletion in position 11041391 to 11041410 measurement OMOP:19589705 - ERBB3 transcript: Deletion in position 309 to 310 and Insertion of AT measurement OMOP:19589757 - NCOR1 protein: Frameshift substitution in position 1618 of I replaced by L followed by a new reading frame extending for 8 amino acids measurement OMOP:19589791 - TMPRSS13 transcript: Substitution in position 230 of C replaced by G measurement OMOP:19589830 - ATRX transcript: Substitution in position 1483 of A replaced by T measurement OMOP:19589952 - KMT2D protein: Frameshift substitution in position 4532 of L replaced by E followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19590049 - LRP1B transcript: Substitution in position 10266 of T replaced by A measurement OMOP:19590124 - PTPRK on GRCh38 chr6: Substitution in position 127991361 of C replaced by T measurement OMOP:19590245 - TET2 transcript: Deletion in position 3295 measurement OMOP:19590255 - PIK3CA protein: Substitution in position 111 of K replaced by N measurement OMOP:19590262 - GNAS protein: Substitution in position 870 of Q replaced by L measurement OMOP:19590294 - ETV6 protein: Substitution in position 76 of E replaced by an early stop codon measurement OMOP:19590433 - ROS1 transcript: Substitution in position 5760-137 of G replaced by A measurement OMOP:19590480 - ERBB4 protein: Substitution in position 359 of C replaced by an early stop codon measurement OMOP:19590500 - IKZF3 on GRCh38 chr17: Insertion in position 39765873 to 39765874 of TACATGTT measurement OMOP:19590511 - GPRIN1 on GRCh38 chr5: Substitution in position 176599137 of T replaced by A measurement OMOP:19590583 - BRCA2 protein: Substitution in position 1442 of S replaced by an early stop codon measurement OMOP:19590593 - NF1 transcript: Substitution in position 1639 of G replaced by T measurement OMOP:19590687 - ARID2 on GRCh38 chr12: Substitution in position 45850047 of G replaced by T measurement OMOP:19590698 - BTG2 transcript: Insertion in position 118 to 119 of CCCCG measurement OMOP:19590791 - ERBB4 on GRCh38 chr2: Substitution in position 212124899 of A replaced by T measurement OMOP:19590862 - SPOP on GRCh38 chr17: Substitution in position 49600425 of G replaced by A measurement OMOP:19590907 - ARID2 on GRCh38 chr12: Substitution in position 45850102 of C replaced by G measurement OMOP:19590966 - PDGFRB protein: Substitution in position 1031 of E replaced by K measurement OMOP:19591026 - ATM protein: Frameshift substitution in position 1257 of P replaced by H followed by a new reading frame extending for 4 amino acids measurement OMOP:19591034 - CPEB3 protein: Frameshift substitution in position 336 of D replaced by A followed by a new reading frame extending for 18 amino acids measurement OMOP:19591093 - APC protein: Frameshift substitution in position 1578 of C replaced by L followed by a new reading frame extending for 13 amino acids measurement OMOP:19591152 - FAT1 protein: Frameshift substitution in position 2360 of V replaced by C followed by a new reading frame extending for 5 amino acids measurement OMOP:19591214 - MSH6 protein: Substitution in position 552 of H replaced by R measurement OMOP:19591245 - MEN1 transcript: Deletion in position 1431 to 1440 measurement OMOP:19591363 - PTEN on GRCh38 chr10: Insertion in position 87957918 to 87957919 of CGCTCGAC measurement OMOP:19591399 - CACNA1D protein: Substitution in position 747 of F replaced by V measurement OMOP:19591527 - RUNX1 protein: Substitution in position 168 of G replaced by R measurement OMOP:19591599 - KMT2C protein: Substitution in position 467 of C replaced by an early stop codon measurement OMOP:19591615 - PTEN protein: Frameshift substitution in position 268 of D replaced by G followed by a new reading frame extending for 30 amino acids measurement OMOP:19591631 - TMPRSS2 transcript: Deletion in position -57+3179 measurement OMOP:19591760 - APC protein: Frameshift substitution in position 416 of Y replaced by K followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19591769 - CREBBP protein: Frameshift substitution in position 1125 of Y replaced by I followed by a new reading frame extending for 5 amino acids measurement OMOP:19591792 - FAT1 transcript: Deletion in position 6671 measurement OMOP:19591793 - TCF3 protein: Substitution in position 621 of R replaced by an early stop codon measurement OMOP:19591863 - APC transcript: Substitution in position 5098 of G replaced by T measurement OMOP:19591891 - WRN transcript: Substitution in position 1744 of C replaced by T measurement OMOP:19592028 - TET2 protein: Frameshift substitution in position 1746 of N replaced by Q followed by a new reading frame extending for 7 amino acids measurement OMOP:19592107 - CREB3L1 protein: Frameshift substitution in position 228 of S replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19592120 - RPL22 protein: Substitution in position 41 of Q replaced by an early stop codon measurement OMOP:19592125 - TNFAIP3 transcript: Duplication of position 379 to 382 measurement OMOP:19592273 - RBM10 on GRCh38 chrX: Substitution in position 47185542 of G replaced by A measurement OMOP:19592407 - TET2 protein: Substitution in position 708 of S replaced by an early stop codon measurement OMOP:19592429 - MSH6 transcript: Deletion in position 3209 measurement OMOP:19592475 - APC transcript: Substitution in position 5117 of C replaced by A measurement OMOP:19592644 - CDKN1A on GRCh38 chr6: Deletion in position 36684145 to 36684161 measurement OMOP:19592745 - NF2 on GRCh38 chr22: Deletion in position 29673423 measurement OMOP:19592901 - GATA3 protein: Frameshift substitution in position 355 of L replaced by P followed by a new reading frame extending for 17 amino acids measurement OMOP:19592922 - PPP6C transcript: Substitution in position 423 of C replaced by A measurement OMOP:19592946 - ARID1A transcript: Deletion in position 2223 measurement OMOP:19592959 - BTG1 on GRCh38 chr12: Deletion in position 92145390 to 92145409 measurement OMOP:19592962 - RSPO2 transcript: Substitution in position 379 of G replaced by T measurement OMOP:19593145 - BRCA2 on GRCh38 chr13: Deletion in position 32380095 to 32380098 measurement OMOP:19593158 - SETD2 transcript: Substitution in position 7569 of C replaced by A measurement OMOP:19593200 - ARID1A protein: Substitution in position 521 of Q replaced by an early stop codon measurement OMOP:19593233 - NF2 transcript: Deletion in position 1407 to 1417 measurement OMOP:19593246 - SMC1A protein: Substitution in position 278 of Q replaced by an early stop codon measurement OMOP:19593336 - APC transcript: Substitution in position 4217 of A replaced by G measurement OMOP:19593419 - KMT2D protein: Substitution in position 52 of Q replaced by an early stop codon measurement OMOP:19593469 - EED transcript: Deletion in position 256 to 259 measurement OMOP:19593500 - MLH1 on GRCh38 chr3: Substitution in position 37014521 of G replaced by A measurement OMOP:19593533 - NF1 on GRCh38 chr17: Duplication of position 31358498 measurement OMOP:19593611 - BAP1 protein: Substitution in position 200 of E replaced by an early stop codon measurement OMOP:19593698 - SPEN transcript: Substitution in position 5279 of C replaced by A measurement OMOP:19593892 - CTCF transcript: Deletion in position 219 measurement OMOP:19593944 - PTPRB protein: Substitution in position 747 of R replaced by an early stop codon measurement OMOP:19593990 - APC protein: Frameshift substitution in position 1428 of G replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19594047 - CASP8 on GRCh38 chr2: Substitution in position 201284884 of C replaced by T measurement OMOP:19594050 - TP53 transcript: Deletion in position 699 to 705 measurement OMOP:19594055 - RNF43 protein: Frameshift substitution in position 92 of N replaced by K followed by a new reading frame extending for 4 amino acids measurement OMOP:19594154 - BRCA1 protein: Frameshift substitution in position 989 of F replaced by L followed by a new reading frame extending for 11 amino acids measurement OMOP:19594179 - APC protein: Substitution in position 1376 of Y replaced by an early stop codon measurement OMOP:19594212 - DNMT3A on GRCh38 chr2: Substitution in position 25274950 of C replaced by T measurement OMOP:19594249 - RECQL4 on GRCh38 chr8: Substitution in position 144517129 of G replaced by A measurement OMOP:19594287 - LATS2 protein: Substitution in position 324 of A replaced by V measurement OMOP:19594331 - ATRX on GRCh38 chrX: Substitution in position 77520880 of G replaced by A measurement OMOP:19594414 - VHL transcript: Deletion in position 319 to 340 measurement OMOP:19594463 - A1CF transcript: Substitution in position 100 of G replaced by A measurement OMOP:19594540 - ARID1A protein: Frameshift substitution in position 280 of S replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19594549 - ETV6 transcript: Insertion in position 195 to 196 of AGGT measurement OMOP:19594763 - FBLN2 on GRCh38 chr3: Substitution in position 13621816 of C replaced by T measurement OMOP:19594833 - SMARCA4 on GRCh38 chr19: Deletion in position 11021805 and Insertion of ACC measurement OMOP:19594924 - ELF3 protein: Substitution in position 315 of W replaced by an early stop codon measurement OMOP:19594981 - STK11 transcript: Deletion in position 267 measurement OMOP:19594993 - JAK1 on GRCh38 chr1: Substitution in position 64850866 of G replaced by A measurement OMOP:19594994 - CDK12 on GRCh38 chr17: Deletion in position 39471445 measurement OMOP:19595013 - ATR protein: Substitution in position 706 of E replaced by an early stop codon measurement OMOP:19595061 - LATS2 on GRCh38 chr13: Substitution in position 20981516 of G replaced by C measurement OMOP:19595200 - AXIN2 protein: Substitution in position 684 of A replaced by V measurement OMOP:19595213 - ATRX on GRCh38 chrX: Deletion in position 77593738 to 77593742 measurement OMOP:19595262 - ZMYM3 protein: Substitution in position 777 of S replaced by an early stop codon measurement OMOP:19595299 - WT1 protein: Frameshift substitution in position 268 of V replaced by T followed by a new reading frame extending for 32 amino acids measurement OMOP:19595421 - SMARCD1 protein: Substitution in position 488 of Q replaced by an early stop codon measurement OMOP:19595455 - CSMD3 transcript: Substitution in position 4018 of G replaced by T measurement OMOP:19595671 - CDKN2A on GRCh38 chr9: Substitution in position 21971165 of A replaced by G measurement OMOP:19595720 - GATA1 on GRCh38 chrX: Duplication of position 48791111 measurement OMOP:19595876 - APC on GRCh38 chr5: Substitution in position 112840620 of A replaced by G measurement OMOP:19595927 - TNFAIP3 on GRCh38 chr6: Duplication of position 137874906 to 137874909 measurement OMOP:19595959 - KMT2D on GRCh38 chr12: Deletion in position 49030400 measurement OMOP:19596148 - VHL transcript: Deletion in position 216 to 217 measurement OMOP:19596167 - APC transcript: Substitution in position 2220 of C replaced by A measurement OMOP:19596195 - CNTNAP2 transcript: Substitution in position 2512 of G replaced by T measurement OMOP:19596284 - TP53 transcript: Deletion in position 449 measurement OMOP:19596360 - LRP1B protein: Substitution in position 2522 of E replaced by an early stop codon measurement OMOP:19596457 - B2M transcript: Deletion in position 305 to 306 measurement OMOP:19596482 - APC transcript: Deletion in position 4243 to 4249 measurement OMOP:19596514 - CYLD protein: Substitution in position 720 of E replaced by an early stop codon measurement OMOP:19596528 - CEBPA transcript: Duplication of position 122 to 128 measurement OMOP:19596532 - CLTC on GRCh38 chr17: Duplication of position 59693773 measurement OMOP:19596697 - PTCH1 on GRCh38 chr9: Substitution in position 95479077 of C replaced by A measurement OMOP:19596739 - APC on GRCh38 chr5: Substitution in position 112841995 of C replaced by G measurement OMOP:19596823 - OR2V2 transcript: Substitution in position 662 of A replaced by G measurement OMOP:19596962 - GATA3 on GRCh38 chr10: Duplication of position 8069550 measurement OMOP:19596999 - ARID1A protein: Substitution in position 334 of S replaced by an early stop codon measurement OMOP:19597007 - NF2 protein: Frameshift substitution in position 218 of G replaced by V followed by a new reading frame extending for 2 amino acids measurement OMOP:19597043 - KNL1 transcript: Duplication of position 3199 measurement OMOP:19597067 - ARID1A protein: Frameshift substitution in position 1216 of N replaced by I followed by a new reading frame extending for 5 amino acids measurement OMOP:19597078 - ARID1B protein: Substitution in position 1556 of Q replaced by an early stop codon measurement OMOP:19597401 - MTOR protein: Substitution in position 1888 of F replaced by L measurement OMOP:19597504 - NF1 protein: Frameshift substitution in position 1520 of Q replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19597593 - TGFBR2 protein: Substitution in position 381 of K replaced by an early stop codon measurement OMOP:19597640 - ZFHX3 transcript: Duplication of position 731 measurement OMOP:19597762 - CDH1 protein: Substitution in position 633 of G replaced by R measurement OMOP:19597840 - APC protein: Frameshift substitution in position 772 of T replaced by I followed by a new reading frame extending for 5 amino acids measurement OMOP:19598021 - MEN1 protein: Frameshift substitution in position 1 of M replaced by F followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19598187 - PTCH1 on GRCh38 chr9: Deletion in position 95459709 to 95459710 and Insertion of TT measurement OMOP:19598397 - PRDM1 protein: Frameshift substitution in position 460 of M replaced by H followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19598443 - RANBP2 protein: Substitution in position 596 of R replaced by an early stop codon measurement OMOP:19598532 - SETD2 protein: Substitution in position 722 of Q replaced by an early stop codon measurement OMOP:19598551 - BIRC6 protein: Substitution in position 2291 of R replaced by C measurement OMOP:19598563 - DICER1 protein: Frameshift substitution in position 1773 of V replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19598577 - PTEN protein: Frameshift substitution in position 158 of V replaced by G followed by a new reading frame extending for 22 amino acids measurement OMOP:19598715 - VHL on GRCh38 chr3: Deletion in position 10149811 measurement OMOP:19598750 - GATA3 transcript: Deletion in position 1223 measurement OMOP:19598791 - BRAF protein: Substitution in position 637 of L replaced by Q measurement OMOP:19599058 - TET2 on GRCh38 chr4: Deletion in position 105275215 to 105275216 measurement OMOP:19599298 - CDH1 protein: Frameshift substitution in position 283 of E replaced by T followed by a new reading frame extending for 4 amino acids measurement OMOP:19643142 - t(X;20)(p11.2;q13.3) measurement OMOP:19599414 - BCOR transcript: Substitution in position 2029 of G replaced by T measurement OMOP:19599415 - MAP3K1 protein: Frameshift substitution in position 1408 of Q replaced by N followed by a new reading frame extending for 14 amino acids measurement OMOP:19599460 - APC on GRCh38 chr5: Deletion in position 112840223 measurement OMOP:19599591 - NF1 transcript: Deletion in position 909 to 910 and Insertion of TT measurement OMOP:19599633 - FAT1 on GRCh38 chr4: Deletion in position 186636733 to 186636734 measurement OMOP:19599659 - CUX1 protein: Substitution in position 74 of E replaced by an early stop codon measurement OMOP:19599803 - PTPRK transcript: Substitution in position 1114 of G replaced by T measurement OMOP:19599886 - RAD50 protein: Substitution in position 656 of R replaced by an early stop codon measurement OMOP:19600008 - CBL on GRCh38 chr11: Substitution in position 119278293 of G replaced by A measurement OMOP:19600545 - ATM transcript: Deletion in position 3403-16 to 3403-15 measurement OMOP:19600602 - CDKN2A transcript: Deletion in position 162 to 163 and Insertion of A measurement OMOP:19600614 - NRAS protein: Substitution in position 12 of G replaced by S measurement OMOP:19600767 - TARS3 protein: Substitution in position 96 of A replaced by G measurement OMOP:19600794 - RBM10 on GRCh38 chrX: Deletion in position 47147494 measurement OMOP:19600830 - RB1 on GRCh38 chr13: Deletion in position 48307346 to 48307359 measurement OMOP:19600849 - CTCF on GRCh38 chr16: Substitution in position 67611988 of C replaced by A measurement OMOP:19600966 - FBXW7 protein: Substitution in position 306 of Q replaced by an early stop codon measurement OMOP:19600992 - PTEN transcript: Deletion in position 170 measurement OMOP:19601092 - MAP3K1 on GRCh38 chr5: Duplication of position 56885987 measurement OMOP:19601114 - GRIN2A on GRCh38 chr16: Deletion in position 10180153 to 10180160 measurement OMOP:19601197 - EPAS1 on GRCh38 chr2: Substitution in position 46378702 of A replaced by T measurement OMOP:19601308 - FANCA on GRCh38 chr16: Substitution in position 89782861 of C replaced by A measurement OMOP:19601428 - NOTCH2 transcript: Substitution in position 2811 of C replaced by A measurement OMOP:19601535 - KMT2C protein: Substitution in position 2379 of E replaced by an early stop codon measurement OMOP:19601567 - RBM10 transcript: Deletion in position 1599 to 1605 measurement OMOP:19601599 - CSMD3 transcript: Substitution in position 9482 of G replaced by A measurement OMOP:19601706 - DDR2 on GRCh38 chr1: Substitution in position 162778598 of A replaced by C measurement OMOP:19601718 - PTPRK transcript: Substitution in position 1015 of G replaced by T measurement OMOP:19601801 - VHL protein: Frameshift substitution in position 187 of D replaced by V followed by a new reading frame extending for 15 amino acids measurement OMOP:19601897 - BRCA1 protein: Frameshift substitution in position 968 of P replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19601979 - ATRX protein: Substitution in position 1656 of L replaced by an early stop codon measurement OMOP:19602018 - FAT1 protein: Substitution in position 1908 of S replaced by an early stop codon measurement OMOP:19602215 - ASXL2 on GRCh38 chr2: Duplication of position 25799410 measurement OMOP:19602278 - TP53 transcript: Deletion in position 526 to 535 measurement OMOP:19602548 - RNF43 transcript: Deletion in position 982 to 984 and Insertion of TCTTACCAAG measurement OMOP:19602557 - ARID1A transcript: Substitution in position 4417 of C replaced by T measurement OMOP:19602594 - ASXL1 on GRCh38 chr20: Deletion in position 32434459 to 32434469 measurement OMOP:19602679 - RB1 on GRCh38 chr13: Deletion in position 48362843 to 48362856 measurement OMOP:19602696 - PTEN protein: Frameshift substitution in position 174 of Y replaced by C followed by a new reading frame extending for 5 amino acids measurement OMOP:19602740 - CUL3 transcript: Deletion in position 1121 to 1122 measurement OMOP:19602754 - ATM protein: Frameshift substitution in position 1152 of S replaced by T followed by a new reading frame extending for 11 amino acids measurement OMOP:19602769 - TBX3 transcript: Insertion in position 1531 to 1532 of GCTAG measurement OMOP:19602871 - BRCA2 on GRCh38 chr13: Deletion in position 32398222 measurement OMOP:19602955 - FAT4 transcript: Insertion in position 10866 to 10867 of CCTCA measurement OMOP:19602977 - ARID1B protein: Substitution in position 508 of S replaced by an early stop codon measurement OMOP:19603010 - TET2 on GRCh38 chr4: Deletion in position 105235724 measurement OMOP:19603027 - KMT2D transcript: Duplication of position 3619 measurement OMOP:19603085 - KNL1 transcript: Deletion in position 2044 to 2047 measurement OMOP:19603101 - TP53 on GRCh38 chr17: Deletion in position 7675169 to 7675172 measurement OMOP:19603130 - BIRC3 transcript: Insertion in position 1619 to 1620 of T measurement OMOP:19603231 - ARID1A protein: Frameshift substitution in position 900 of A replaced by P followed by a new reading frame extending for 19 amino acids measurement OMOP:19603253 - APC transcript: Substitution in position 2938 of A replaced by T measurement OMOP:19603434 - NDUFS4 on GRCh38 chr5: Substitution in position 53683207 of G replaced by T measurement OMOP:19603636 - APC transcript: Substitution in position 5378 of C replaced by G measurement OMOP:19603709 - DNM2 transcript: Deletion in position 2460 measurement OMOP:19603810 - PTCH1 protein: Frameshift substitution in position 480 of S replaced by Q followed by a new reading frame extending for 8 amino acids measurement OMOP:19603832 - ETV6 transcript: Deletion in position 775 measurement OMOP:19603961 - GATA1 transcript: Duplication of position 150 measurement OMOP:19604122 - BRCA2 transcript: Substitution in position 8777 of T replaced by G measurement OMOP:19604202 - PTEN transcript: Insertion in position 395 to 396 of GTGG measurement OMOP:19604233 - TNFAIP3 transcript: Duplication of position 570 measurement OMOP:19604292 - STAG2 on GRCh38 chrX: Substitution in position 124065906 of C replaced by T measurement OMOP:19604299 - CRNKL1 on GRCh38 chr20: Substitution in position 20052443 of G replaced by A measurement OMOP:19604317 - BRCA2 transcript: Deletion in position 5385 measurement OMOP:19604322 - NOTCH1 protein: Frameshift substitution in position 2422 of S replaced by A followed by a new reading frame extending for 13 amino acids measurement OMOP:19604323 - GRIN2A transcript: Substitution in position 4334 of T replaced by G measurement OMOP:19604351 - MAP2K4 on GRCh38 chr17: Deletion in position 12020955 measurement OMOP:19604445 - NF1 on GRCh38 chr17: Deletion in position 31169952 to 31169958 measurement OMOP:19604541 - BAP1 on GRCh38 chr3: Deletion in position 52403787 to 52403788 measurement OMOP:19604565 - WT1 protein: Frameshift substitution in position 375 of R replaced by P followed by a new reading frame extending for 12 amino acids measurement OMOP:19604579 - KMT2C protein: Frameshift substitution in position 2265 of L replaced by V followed by a new reading frame extending for 6 amino acids measurement OMOP:19604600 - ARID1A protein: Substitution in position 790 of Q replaced by an early stop codon measurement OMOP:19604630 - AXIN1 protein: Frameshift substitution in position 137 of R replaced by T followed by a new reading frame extending for 4 amino acids measurement OMOP:19604667 - RB1 protein: Frameshift substitution in position 416 of L replaced by R followed by a new reading frame extending for 4 amino acids measurement OMOP:19604710 - KMT2C protein: Frameshift substitution in position 3901 of P replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19604713 - AR on GRCh38 chrX: Deletion in position 67545316 and Insertion of AGCAGCAGCA measurement OMOP:19604802 - CTNNB1 transcript: Deletion in position 95 to 96 and Insertion of TA measurement OMOP:19604843 - APC on GRCh38 chr5: Deletion in position 112839131 to 112839137 measurement OMOP:19604875 - SMAD4 on GRCh38 chr18: Substitution in position 51067047 of G replaced by T measurement OMOP:19604899 - SMARCD1 transcript: Substitution in position 907 of C replaced by T measurement OMOP:19604992 - TP53 transcript: Insertion in position 291 to 292 of TA measurement OMOP:19605136 - MYC protein: Substitution in position 74 of P replaced by T measurement OMOP:19605214 - FAM110C protein: Substitution in position 164 of I replaced by T measurement OMOP:19605227 - ZNRF3 on GRCh38 chr22: Deletion in position 29044807 measurement OMOP:19605243 - KMT2C protein: Substitution in position 2776 of E replaced by an early stop codon measurement OMOP:19605253 - ARID1A protein: Substitution in position 617 of S replaced by an early stop codon measurement OMOP:19605276 - LRP1B transcript: Substitution in position 6840 of G replaced by A measurement OMOP:19605312 - DNMT3A protein: Frameshift substitution in position 256 of P replaced by L followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19605346 - AGFG2 transcript: Substitution in position 116 of G replaced by C measurement OMOP:19605353 - BIRC3 protein: Substitution in position 440 of E replaced by an early stop codon measurement OMOP:19605359 - SMAD3 protein: Frameshift substitution in position 182 of P replaced by L followed by a new reading frame extending for 4 amino acids measurement OMOP:19605548 - CUL3 on GRCh38 chr2: Substitution in position 224506887 of C replaced by A measurement OMOP:19605585 - EZH2 protein: Substitution in position 741 of Y replaced by an early stop codon measurement OMOP:19605630 - TP53 transcript: Substitution in position 154 of C replaced by T measurement OMOP:19605716 - APC transcript: Duplication of position 4737 measurement OMOP:19605820 - NF1 transcript: Substitution in position 3208 of C replaced by T measurement OMOP:19605969 - JAK1 on GRCh38 chr1: Substitution in position 64883373 of C replaced by A measurement OMOP:19606017 - AR on GRCh38 chrX: Substitution in position 67545308 of G replaced by T measurement OMOP:19606049 - PRDM1 transcript: Substitution in position 457 of G replaced by T measurement OMOP:19606307 - HS6ST1 transcript: Substitution in position 261 of C replaced by A measurement OMOP:19606396 - RANBP2 on GRCh38 chr2: Substitution in position 108748962 of T replaced by A measurement OMOP:19606455 - SPEN on GRCh38 chr1: Substitution in position 15931519 of C replaced by A measurement OMOP:19606542 - NF1 protein: Substitution in position 786 of Q replaced by an early stop codon measurement OMOP:19606692 - RUNX1 transcript: Insertion in position 619 to 620 of CCTTTAA measurement OMOP:19606898 - NF2 on GRCh38 chr22: Deletion in position 29674928 measurement OMOP:19607016 - EP300 transcript: Insertion in position 1501 to 1502 of G measurement OMOP:19607139 - RIT1 protein: Substitution in position 38 of T replaced by A measurement OMOP:19607144 - SMAD2 transcript: Substitution in position 5 of C replaced by A measurement OMOP:19607225 - RB1 transcript: Substitution in position 1660 of G replaced by T measurement OMOP:19607245 - EPS15 transcript: Substitution in position 2299 of G replaced by T measurement OMOP:19607271 - APC protein: Frameshift substitution in position 1447 of Q replaced by L followed by a new reading frame extending for 27 amino acids measurement OMOP:19607304 - EGFR on GRCh38 chr7: [Substitution in position 55174771 of A replaced by G; Deletion in position 55174776 to 55174784] OMOP:19607350 - HRAS transcript: Deletion in position 37 to 39 and Insertion of AAG measurement OMOP:19607482 - MAP3K13 transcript: Substitution in position 1753 of C replaced by T measurement OMOP:19607491 - FANCA protein: Substitution in position 940 of Q replaced by an early stop codon measurement OMOP:19607505 - MAP3K1 transcript: Substitution in position 3595 of C replaced by T measurement OMOP:19607580 - FGFR2 on GRCh38 chr10: Deletion in position 121503765 to 121503766 measurement OMOP:19607586 - TSC2 protein: Frameshift substitution in position 1561 of I replaced by P followed by a new reading frame extending for 4 amino acids measurement OMOP:19607680 - CDH1 transcript: Deletion in position 1254 to 1255 measurement OMOP:19607785 - TBX3 on GRCh38 chr12: Duplication of position 114674716 measurement OMOP:19607878 - APC on GRCh38 chr5: Substitution in position 112780901 of C replaced by T measurement OMOP:19607919 - LRP1B transcript: Substitution in position 10906 of C replaced by T measurement OMOP:19608078 - NUDT15 transcript: Substitution in position 415 of C replaced by T measurement OMOP:19608103 - KMT2D transcript: Substitution in position 14644 of G replaced by T measurement OMOP:19608137 - NF2 protein: Frameshift substitution in position 19 of P replaced by D followed by a new reading frame extending for 28 amino acids measurement OMOP:19608315 - APC on GRCh38 chr5: Substitution in position 112827160 of G replaced by A measurement OMOP:19608339 - PALB2 transcript: Substitution in position 2866 of G replaced by T measurement OMOP:19608347 - TCF3 protein: Frameshift substitution in position 634 of Q replaced by R followed by a new reading frame extending for 11 amino acids measurement OMOP:19608397 - ARHGAP35 on GRCh38 chr19: Deletion in position 46921207 measurement OMOP:19608483 - DDB2 protein: Frameshift substitution in position 79 of G replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19608583 - GATA1 transcript: Deletion in position 90 to 91 measurement OMOP:19608606 - DNMT3A protein: Frameshift substitution in position 808 of T replaced by L followed by a new reading frame extending for 2 amino acids measurement OMOP:19608785 - NCOR1 protein: Frameshift substitution in position 962 of R replaced by G followed by a new reading frame extending for 23 amino acids measurement OMOP:19608797 - CAMTA1 protein: Frameshift substitution in position 827 of Q replaced by S followed by a new reading frame extending for 7 amino acids measurement OMOP:19608826 - KMT2C on GRCh38 chr7: Substitution in position 152205130 of C replaced by A measurement OMOP:19608877 - BAP1 protein: Frameshift substitution in position 254 of T replaced by Q followed by a new reading frame extending for 3 amino acids measurement OMOP:19608955 - APC on GRCh38 chr5: Insertion in position 112839931 to 112839932 of A measurement OMOP:19608975 - KMT2D transcript: Duplication of position 6834 measurement OMOP:19608986 - PHF6 protein: Substitution in position 313 of Y replaced by an early stop codon measurement OMOP:19609238 - TP53 transcript: Deletion in position 742 to 744 and Insertion of TGC measurement OMOP:19609241 - SETD2 on GRCh38 chr3: Substitution in position 47123600 of C replaced by A measurement OMOP:19609247 - BCORL1 on GRCh38 chrX: Substitution in position 130016181 of A replaced by T measurement OMOP:19609253 - ATR on GRCh38 chr3: Substitution in position 142498756 of C replaced by T measurement OMOP:19609269 - EZH2 protein: Frameshift substitution in position 22 of E replaced by V followed by a new reading frame extending for 14 amino acids measurement OMOP:19609358 - IL7R on GRCh38 chr5: Substitution in position 35874468 of A replaced by C measurement OMOP:19609405 - DNMT3A on GRCh38 chr2: Deletion in position 25246292 measurement OMOP:19609445 - TRIM24 transcript: Duplication of position 1213 measurement OMOP:19609488 - APC protein: Frameshift substitution in position 1465 of S replaced by E followed by a new reading frame extending for 4 amino acids measurement OMOP:19609512 - NOTCH1 transcript: Duplication of position 7409 to 7410 measurement OMOP:19609620 - ZFHX3 transcript: Substitution in position 364 of G replaced by T measurement OMOP:19609675 - BRIP1 protein: Substitution in position 251 of R replaced by C measurement OMOP:19609698 - TP53 on GRCh38 chr17: [Duplication of position 7674892; Substitution in position 7674893 of C replaced by G; Deletion in position 7674898] OMOP:19609873 - TET2 protein: Frameshift substitution in position 1244 of L replaced by T followed by a new reading frame extending for 24 amino acids measurement OMOP:19609964 - FBXW7 transcript: Substitution in position 1170 of T replaced by A measurement OMOP:19610083 - GATA3 transcript: Insertion in position 1199 to 1200 of ACATGTCCTCCCT measurement OMOP:19610321 - NKX2-1 protein: Frameshift substitution in position 368 of A replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19610431 - ARID2 transcript: Deletion in position 234 measurement OMOP:19610432 - DNMT3A protein: Substitution in position 223 of G replaced by an early stop codon measurement OMOP:19610440 - IRS4 transcript: Substitution in position 1873 of C replaced by T measurement OMOP:19610573 - NOTCH1 transcript: Insertion in position 1030 to 1031 of C measurement OMOP:19610583 - RAP1B on GRCh38 chr12: Substitution in position 68648759 of G replaced by A measurement OMOP:19610684 - DROSHA on GRCh38 chr5: Substitution in position 31472134 of G replaced by A measurement OMOP:19610729 - NCOR1 on GRCh38 chr17: Deletion in position 16039558 to 16039577 measurement OMOP:19610756 - RET on GRCh38 chr10: Substitution in position 43123838 of C replaced by T measurement OMOP:19610859 - CIC protein: Frameshift substitution in position 2246 of P replaced by A followed by a new reading frame extending for 8 amino acids measurement OMOP:19610896 - RFWD3 protein: Substitution in position 744 of Q replaced by an early stop codon measurement OMOP:19610977 - TP53 transcript: Duplication of position 580 to 581 measurement OMOP:19611087 - SETD2 protein: Frameshift substitution in position 2034 of E replaced by G followed by a new reading frame extending for 6 amino acids measurement OMOP:19611123 - PTEN on GRCh38 chr10: Substitution in position 87952134 of G replaced by A measurement OMOP:19611147 - EP300 protein: Substitution in position 1062 of L replaced by an early stop codon measurement OMOP:19611195 - KMT2C protein: Frameshift substitution in position 4267 of S replaced by I followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19611197 - STAT6 protein: Substitution in position 286 of Q replaced by R measurement OMOP:19611430 - BCOR on GRCh38 chrX: Substitution in position 40064348 of G replaced by A measurement OMOP:19611466 - FES protein: Substitution in position 46 of G replaced by an early stop codon measurement OMOP:19611541 - KMT2D protein: Substitution in position 2915 of R replaced by an early stop codon measurement OMOP:19611542 - OLIG2 protein: Substitution in position 309 of A replaced by S measurement OMOP:19611583 - TET2 protein: Frameshift substitution in position 1890 of N replaced by T followed by a new reading frame extending for 3 amino acids measurement OMOP:19611595 - FLT3 transcript: Substitution in position 2028 of C replaced by A measurement OMOP:19611652 - CDKN2A transcript: Deletion in position 30 measurement OMOP:19611670 - MSH2 protein: Frameshift substitution in position 64 of I replaced by G followed by a new reading frame extending for 19 amino acids measurement OMOP:19611715 - EGFR on GRCh38 chr7: Substitution in position 55163768 of T replaced by C measurement OMOP:19611736 - BRCA1 transcript: Substitution in position 514 of C replaced by T measurement OMOP:19611879 - WT1 transcript: Duplication of position 648 to 654 measurement OMOP:19612002 - RUNX1 protein: Frameshift substitution in position 448 of N replaced by K followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19612184 - CHEK2 transcript: Substitution in position 49 of G replaced by T measurement OMOP:19612254 - NF2 protein: Frameshift substitution in position 389 of Q replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19612264 - CDKN1A transcript: Deletion in position 253 to 260 measurement OMOP:19612266 - CDH1 protein: Frameshift substitution in position 315 of N replaced by K followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19612329 - SMAD4 protein: Frameshift substitution in position 529 of L replaced by Y followed by a new reading frame extending for 8 amino acids measurement OMOP:19612377 - CHEK2 protein: Substitution in position 57 of S replaced by F measurement OMOP:19612435 - KMT2C transcript: Insertion in position 14299 to 14300 of T measurement OMOP:19612556 - NOTCH1 on GRCh38 chr9: Substitution in position 136496269 of G replaced by C measurement OMOP:19612637 - NRAS on GRCh38 chr1: Substitution in position 114708522 of T replaced by C measurement OMOP:19612670 - CDKN1B on GRCh38 chr12: Deletion in position 12718879 measurement OMOP:19612779 - BRIP1 on GRCh38 chr17: Deletion in position 61684063 to 61684066 measurement OMOP:19612805 - PTPRB on GRCh38 chr12: Substitution in position 70587016 of C replaced by A measurement OMOP:19612852 - PTCH1 on GRCh38 chr9: Duplication of position 95449272 measurement OMOP:19612872 - B2M transcript: Duplication of position 122 measurement OMOP:19612894 - TP63 protein: Frameshift substitution in position 108 of Y replaced by K followed by a new reading frame extending for 29 amino acids measurement OMOP:19612984 - KMT2C protein: Frameshift substitution in position 4185 of H replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19613140 - TERT protein: Substitution in position 460 of Q replaced by K measurement OMOP:19613199 - AMER1 protein: Substitution in position 616 of W replaced by an early stop codon measurement OMOP:19613210 - TARS3 protein: Substitution in position 39 of A replaced by S measurement OMOP:19613276 - KMT2C transcript: Substitution in position 262 of C replaced by T measurement OMOP:19613286 - SIRPA transcript: Substitution in position 1255 of G replaced by T measurement OMOP:19613319 - CNTNAP2 transcript: Substitution in position 205 of G replaced by T measurement OMOP:19613456 - RUNX1 transcript: Substitution in position 601 of C replaced by G measurement OMOP:19613484 - NKX2-1 on GRCh38 chr14: Duplication of position 36517386 measurement OMOP:19613502 - BMPR1A protein: Frameshift substitution in position 367 of N replaced by T followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19613561 - TSC1 protein: Substitution in position 447 of P replaced by L measurement OMOP:19613607 - NCOR1 on GRCh38 chr17: Duplication of position 16086359 measurement OMOP:19613671 - TBX3 on GRCh38 chr12: Substitution in position 114680895 of G replaced by C measurement OMOP:19613727 - NOTCH1 transcript: Deletion in position 1176 to 1179 measurement OMOP:19613754 - MED12 transcript: Substitution in position 4543 of C replaced by T measurement OMOP:19613812 - NF1 protein: Frameshift substitution in position 1970 of R replaced by S followed by a new reading frame extending for 6 amino acids measurement OMOP:19613840 - TSC2 transcript: Substitution in position 4432 of G replaced by A measurement OMOP:19613891 - APC transcript: Deletion in position 4359 measurement OMOP:19613896 - SETD2 on GRCh38 chr3: Duplication of position 47067084 measurement OMOP:19613976 - ARID1A transcript: Duplication of position 595 measurement OMOP:19613992 - SMAD4 protein: Substitution in position 183 of Q replaced by an early stop codon measurement OMOP:19614042 - CDH1 protein: Substitution in position 185 of E replaced by V measurement OMOP:19614056 - KMT2D on GRCh38 chr12: Substitution in position 49037608 of C replaced by A measurement OMOP:19614149 - EED protein: Substitution in position 373 of W replaced by an early stop codon measurement OMOP:19614184 - APC on GRCh38 chr5: Substitution in position 112823397 of C replaced by A measurement OMOP:19614259 - PTPRC on GRCh38 chr1: Substitution in position 198744111 of G replaced by T measurement OMOP:19614291 - BRCA2 protein: Frameshift substitution in position 863 of N replaced by K followed by a new reading frame extending for 18 amino acids measurement OMOP:19614374 - APC on GRCh38 chr5: Deletion in position 112838291 measurement OMOP:19614485 - FLT3 on GRCh38 chr13: Substitution in position 28034148 of A replaced by C measurement OMOP:19614574 - CUX1 on GRCh38 chr7: Substitution in position 102104380 of C replaced by T measurement OMOP:19614630 - APC transcript: Deletion in position 5293 to 5296 measurement OMOP:19614689 - ARHGAP26 protein: Frameshift substitution in position 305 of Q replaced by K followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19614796 - TP53 on GRCh38 chr17: Deletion in position 7674265 to 7674266 measurement OMOP:19614805 - CUX1 on GRCh38 chr7: Deletion in position 102201602 measurement OMOP:19614905 - ARHGEF12 transcript: Substitution in position 2498 of C replaced by A measurement OMOP:19615051 - ASXL1 on GRCh38 chr20: Deletion in position 32434612 to 32434634 measurement OMOP:19615062 - SETD2 protein: Frameshift substitution in position 2004 of D replaced by I followed by a new reading frame extending for 13 amino acids measurement OMOP:19615084 - MLH1 transcript: Substitution in position 933 of G replaced by T measurement OMOP:19615293 - STAG2 protein: Substitution in position 815 of Y replaced by an early stop codon measurement OMOP:19615307 - PTEN on GRCh38 chr10: Insertion in position 87957956 to 87957957 of CT measurement OMOP:19615326 - MSH2 on GRCh38 chr2: Substitution in position 47403221 of G replaced by T measurement OMOP:19615413 - PRDM2 protein: Frameshift substitution in position 1227 of G replaced by L followed by a new reading frame extending for 6 amino acids measurement OMOP:19615536 - EP300 transcript: Substitution in position 6994 of C replaced by T measurement OMOP:19615635 - VHL transcript: Deletion in position 303 to 321 measurement OMOP:19615649 - VHL protein: Frameshift substitution in position 162 of C replaced by A followed by a new reading frame extending for 8 amino acids measurement OMOP:19615740 - WT1 on GRCh38 chr11: Insertion in position 32428042 to 32428043 of AGCCCCC measurement OMOP:19615781 - CDKN2A transcript: Deletion in position 242 to 243 measurement OMOP:19615828 - APC protein: Frameshift substitution in position 461 of E replaced by D followed by a new reading frame extending for 6 amino acids measurement OMOP:19615924 - SETD2 transcript: Substitution in position 4474 of C replaced by T measurement OMOP:19615947 - CSMD3 protein: Substitution in position 642 of Q replaced by an early stop codon measurement OMOP:19616047 - ARID1A on GRCh38 chr1: Deletion in position 26779417 measurement OMOP:19616120 - KMT2D protein: Frameshift substitution in position 2279 of G replaced by W followed by a new reading frame extending for 20 amino acids measurement OMOP:19616203 - APC protein: Substitution in position 2418 of R replaced by G measurement OMOP:19616261 - BCOR on GRCh38 chrX: Deletion in position 40062806 measurement OMOP:19616331 - TET2 protein: Substitution in position 632 of Q replaced by an early stop codon measurement OMOP:19616434 - AMER1 protein: Substitution in position 384 of E replaced by an early stop codon measurement OMOP:19616467 - PTEN transcript: Duplication of position 897 to 898 measurement OMOP:19616564 - KMT2C on GRCh38 chr7: Substitution in position 152235888 of C replaced by A measurement OMOP:19616570 - KAT6B on GRCh38 chr10: Substitution in position 75025034 of C replaced by A measurement OMOP:19616643 - DYRK1A protein: Substitution in position 179 of K replaced by I measurement OMOP:19616726 - LRP1B transcript: Substitution in position 3311 of G replaced by A measurement OMOP:19616745 - TOP2A on GRCh38 chr17: Substitution in position 40415939 of T replaced by C measurement OMOP:19616756 - APC on GRCh38 chr5: Deletion in position 112839870 measurement OMOP:19616796 - del(11)(q13q22) measurement OMOP:19616949 - MAP3K1 transcript: Duplication of position 2915 measurement OMOP:19616972 - DNMT3A protein: Substitution in position 371 of E replaced by an early stop codon measurement OMOP:19617013 - CSMD3 transcript: Substitution in position 7516 of G replaced by T measurement OMOP:19617089 - ASXL1 protein: Frameshift substitution in position 828 of G replaced by A followed by a new reading frame extending for 10 amino acids measurement OMOP:19617239 - MSH6 transcript: Substitution in position 3700 of G replaced by T measurement OMOP:19617263 - CNOT3 protein: Frameshift substitution in position 478 of T replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19617276 - SMARCD1 on GRCh38 chr12: Deletion in position 50094499 to 50094500 measurement OMOP:19617317 - EP300 transcript: Substitution in position 7 of G replaced by T measurement OMOP:19617341 - KMT2C on GRCh38 chr7: Insertion in position 152248021 to 152248022 of GG measurement OMOP:19617359 - STAG2 protein: Frameshift substitution in position 1132 of L replaced by S followed by a new reading frame extending for 9 amino acids measurement OMOP:19617439 - KDM6A transcript: Duplication of position 1704 measurement OMOP:19617462 - PTCH1 on GRCh38 chr9: Deletion in position 95458100 to 95458101 and Insertion of TT measurement OMOP:19617468 - RHOA protein: Substitution in position 54 of E replaced by an early stop codon measurement OMOP:19617501 - RB1 protein: Frameshift substitution in position 832 of L replaced by F followed by a new reading frame extending for 5 amino acids measurement OMOP:19617506 - BCL11B transcript: Substitution in position 2668 of C replaced by T measurement OMOP:19617509 - GATA3 transcript: Insertion in position 1223 to 1224 of A measurement OMOP:19617539 - CDC73 transcript: Substitution in position 904 of G replaced by T measurement OMOP:19617702 - ROS1 on GRCh38 chr6: Substitution in position 117320167 of C replaced by T measurement OMOP:19617741 - KMT2D protein: Frameshift substitution in position 2763 of P replaced by Q followed by a new reading frame extending for 24 amino acids measurement OMOP:19617903 - GATA3 protein: Frameshift substitution in position 362 of I replaced by A followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19617927 - FBXW7 transcript: Insertion in position 1395 to 1396 of CCGATGCGGT measurement OMOP:19618133 - MUTYH protein: Frameshift substitution in position 41 of A replaced by C followed by a new reading frame extending for 24 amino acids measurement OMOP:19618137 - ARID1A on GRCh38 chr1: Deletion in position 26696914 measurement OMOP:19618396 - STK11 transcript: Substitution in position 412 of G replaced by T measurement OMOP:19618498 - SMAD4 protein: Frameshift substitution in position 199 of A replaced by S followed by a new reading frame extending for 7 amino acids measurement OMOP:19618514 - MAP3K1 transcript: Substitution in position 1603 of C replaced by T measurement OMOP:19618577 - MED12 on GRCh38 chrX: Deletion in position 71136568 measurement OMOP:19618686 - NF1 protein: Substitution in position 1258 of W replaced by an early stop codon measurement OMOP:19618747 - KMT2C protein: Substitution in position 1006 of E replaced by an early stop codon measurement OMOP:19618759 - FBXW7 on GRCh38 chr4: Substitution in position 152337831 of G replaced by A measurement OMOP:19618860 - GRIN2A transcript: Deletion in position 3891 measurement OMOP:19618895 - AXIN1 protein: Substitution in position 559 of Q replaced by an early stop codon measurement OMOP:19618900 - ARHGAP35 on GRCh38 chr19: Substitution in position 46919000 of C replaced by T measurement OMOP:19618947 - SPEN transcript: Substitution in position 1168 of G replaced by T measurement OMOP:19618948 - KAT6B on GRCh38 chr10: Deletion in position 75030470 measurement OMOP:19618976 - TP53 on GRCh38 chr17: Substitution in position 7670699 of C replaced by T measurement OMOP:19619104 - TMPRSS2 on GRCh38 chr21: Substitution in position 41486587 of T replaced by C measurement OMOP:19619223 - BRCA1 on GRCh38 chr17: Duplication of position 43091737 to 43091738 measurement OMOP:19619224 - APC protein: Frameshift substitution in position 1332 of T replaced by P followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19619225 - TET2 on GRCh38 chr4: Duplication of position 105234753 to 105234759 measurement OMOP:19619260 - PTPN11 protein: Substitution in position 503 of G replaced by A measurement OMOP:19619318 - KMT2D protein: Frameshift substitution in position 179 of G replaced by V followed by a new reading frame extending for 25 amino acids measurement OMOP:19619359 - RB1 transcript: Substitution in position 1421 of G replaced by T measurement OMOP:19619380 - TNFRSF14 transcript: Substitution in position 495 of C replaced by A measurement OMOP:19619392 - APC on GRCh38 chr5: Substitution in position 112839636 of A replaced by G measurement OMOP:19619448 - CIC on GRCh38 chr19: Deletion in position 42290946 to 42290950 measurement OMOP:19619611 - TP53 on GRCh38 chr17: Deletion in position 7675139 to 7675152 measurement OMOP:19619641 - JAK1 transcript: Insertion in position 1281 to 1282 of C measurement OMOP:19619687 - CASC3 protein: Substitution in position 603 of P replaced by L measurement OMOP:19619863 - TBX3 transcript: Duplication of position 1701 to 1707 measurement OMOP:19619984 - PIK3R1 transcript: Deletion in position 1393 to 1409 measurement OMOP:19620176 - TSC1 protein: Substitution in position 1020 of T replaced by I measurement OMOP:19620287 - CREBBP transcript: Insertion in position 5140 to 5141 of C measurement OMOP:19620293 - TET2 protein: Substitution in position 819 of Y replaced by an early stop codon measurement OMOP:19620322 - TP53 on GRCh38 chr17: Deletion in position 7673740 and Insertion of AA measurement OMOP:19620390 - ASXL1 protein: Substitution in position 634 of R replaced by an early stop codon measurement OMOP:19620407 - TET2 protein: Frameshift substitution in position 691 of T replaced by I followed by a new reading frame extending for 6 amino acids measurement OMOP:19620441 - KMT2D protein: Substitution in position 3788 of Q replaced by an early stop codon measurement OMOP:19620484 - TGFBR2 transcript: Deletion in position 1403 to 1404 measurement OMOP:19620490 - TGFBR2 protein: Frameshift substitution in position 237 of H replaced by Q followed by a new reading frame extending for 29 amino acids measurement OMOP:19624355 - ARID1B on GRCh38 chr6: Deletion in position 157207153 to 157207154 measurement OMOP:19620541 - SPEN protein: Frameshift substitution in position 216 of H replaced by Y followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19620656 - RB1 on GRCh38 chr13: Substitution in position 48473383 of C replaced by A measurement OMOP:19620704 - INSL3 on GRCh38 chr19: Substitution in position 17821329 of T replaced by C measurement OMOP:19620714 - MSH2 on GRCh38 chr2: Substitution in position 47480770 of A replaced by T measurement OMOP:19620857 - KMT2D transcript: Substitution in position 10841 of C replaced by G measurement OMOP:19620892 - KMT2D protein: Frameshift substitution in position 4132 of H replaced by P followed by a new reading frame extending for 11 amino acids measurement OMOP:19620897 - AR protein: Substitution in position 631 of K replaced by R measurement OMOP:19620926 - TSC1 transcript: Substitution in position 838 of C replaced by T measurement OMOP:19620989 - TET2 transcript: Deletion in position 444 to 447 measurement OMOP:19621017 - WT1 protein: Frameshift substitution in position 373 of V replaced by D followed by a new reading frame extending for 6 amino acids measurement OMOP:19621099 - TSC2 protein: Substitution in position 587 of Y replaced by C measurement OMOP:19621121 - ZNF331 transcript: Substitution in position 96 of G replaced by A measurement OMOP:19621179 - ACVR2A on GRCh38 chr2: Substitution in position 147917304 of G replaced by T measurement OMOP:19621261 - SETD2 on GRCh38 chr3: Deletion in position 47101461 measurement OMOP:19621313 - TSC2 transcript: Insertion in position 5167 to 5168 of TA measurement OMOP:19621507 - FLT3 protein: Substitution in position 599 of Y replaced by C measurement OMOP:19621556 - RET protein: Substitution in position 281 of A replaced by D measurement OMOP:19621628 - RUNX1 protein: Frameshift substitution in position 98 of L replaced by A followed by a new reading frame extending for 25 amino acids measurement OMOP:19621650 - SPEN transcript: Substitution in position 5168 of C replaced by A measurement OMOP:19621849 - RNF43 on GRCh38 chr17: Substitution in position 58363276 of C replaced by T measurement OMOP:19621903 - KDM5C protein: Frameshift substitution in position 1130 of T replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19621985 - PIK3R1 transcript: Substitution in position 1528 of G replaced by T measurement OMOP:19622010 - SMARCB1 on GRCh38 chr22: Deletion in position 23791771 to 23791789 measurement OMOP:19622035 - CDKN2A on GRCh38 chr9: Deletion in position 21974680 to 21974681 and Insertion of AT measurement OMOP:19622045 - PTPRB protein: Frameshift substitution in position 2201 of N replaced by K followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19622135 - KDM5C on GRCh38 chrX: Deletion in position 53211827 to 53211831 measurement OMOP:19622170 - KMT2C transcript: Insertion in position 2464 to 2465 of G measurement OMOP:19622198 - NF1 transcript: Substitution in position 1070 of T replaced by C measurement OMOP:19622205 - CASP8 protein: Substitution in position 227 of Q replaced by an early stop codon measurement OMOP:19622240 - KDM6A on GRCh38 chrX: Deletion in position 45069641 measurement OMOP:19622448 - ATRX protein: Substitution in position 1002 of V replaced by an early stop codon measurement OMOP:19622521 - COL4A3 transcript: Substitution in position 4486 of C replaced by T measurement OMOP:19622617 - FH transcript: Substitution in position 1315 of C replaced by T measurement OMOP:19622635 - EZH2 protein: Frameshift substitution in position 715 of I replaced by F followed by a new reading frame extending for 25 amino acids measurement OMOP:19622745 - CBFA2T3 protein: Frameshift substitution in position 363 of R replaced by P followed by a new reading frame extending for 29 amino acids measurement OMOP:19622783 - BRCA1 transcript: Substitution in position 5444 of G replaced by A measurement OMOP:19622913 - TSC2 transcript: Substitution in position 5365 of G replaced by T measurement OMOP:19623050 - BAP1 transcript: Duplication of position 878 measurement OMOP:19623229 - NOTCH1 on GRCh38 chr9: Duplication of position 136496510 to 136496511 measurement OMOP:19623260 - PIK3R1 on GRCh38 chr5: Deletion in position 68294543 to 68294546 measurement OMOP:19623305 - SDHA on GRCh38 chr5: Substitution in position 225478 of C replaced by A measurement OMOP:19623328 - ETV6 on GRCh38 chr12: Substitution in position 11853525 of C replaced by T measurement OMOP:19623329 - DICER1 on GRCh38 chr14: Substitution in position 95111382 of C replaced by A measurement OMOP:19623358 - N4BP2 on GRCh38 chr4: Substitution in position 40121419 of C replaced by A measurement OMOP:196236 - Septic shock OMOP:19623627 - EP300 on GRCh38 chr22: Substitution in position 41172613 of G replaced by T measurement OMOP:19623628 - KDM5C on GRCh38 chrX: Deletion in position 53194614 to 53194615 measurement OMOP:19623719 - KDM5C protein: Substitution in position 1171 of K replaced by an early stop codon measurement OMOP:19623787 - WRN transcript: Substitution in position 3330 of T replaced by A measurement OMOP:19623895 - SOCS1 protein: Frameshift substitution in position 90 of H replaced by P followed by a new reading frame extending for 43 amino acids measurement OMOP:19623908 - APC on GRCh38 chr5: Deletion in position 112792490 measurement OMOP:19624079 - TNFRSF14 on GRCh38 chr1: Deletion in position 2560663 measurement OMOP:19624151 - VHL protein: Frameshift substitution in position 80 of S replaced by T followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19624344 - SPEN protein: Substitution in position 2501 of W replaced by an early stop codon measurement OMOP:19624429 - MAX transcript: Deletion in position 203 to 204 measurement OMOP:19624539 - PTEN on GRCh38 chr10: Deletion in position 87933157 to 87933161 measurement OMOP:19624608 - PTEN protein: Frameshift substitution in position 173 of R replaced by A followed by a new reading frame extending for 10 amino acids measurement OMOP:19624735 - RB1 transcript: Duplication of position 983 measurement OMOP:19624819 - PTCH1 transcript: Substitution in position 1196 of G replaced by A measurement OMOP:19624874 - FAS on GRCh38 chr10: Insertion in position 89014343 to 89014344 of A measurement OMOP:19624906 - CDH1 on GRCh38 chr16: Deletion in position 68801717 measurement OMOP:19625042 - CBFA2T3 protein: Frameshift substitution in position 297 of D replaced by T followed by a new reading frame extending for 25 amino acids measurement OMOP:19625055 - del(8)(p23) measurement OMOP:19625074 - PTEN on GRCh38 chr10: Substitution in position 87960939 of C replaced by T measurement OMOP:19625119 - WT1 on GRCh38 chr11: Duplication of position 32434940 measurement OMOP:19625129 - BAP1 transcript: Deletion in position 216 measurement OMOP:19625166 - ARID1A protein: Substitution in position 586 of Q replaced by an early stop codon measurement OMOP:19625214 - CHD2 transcript: Substitution in position 2425 of C replaced by T measurement OMOP:19625242 - TSC2 on GRCh38 chr16: Substitution in position 2086849 of A replaced by G measurement OMOP:19625422 - FOXO1 on GRCh38 chr13: Deletion in position 40560195 measurement OMOP:19625434 - PER1 on GRCh38 chr17: Deletion in position 8149770 to 8149771 measurement OMOP:19625495 - LATS2 transcript: Substitution in position 2320 of G replaced by T measurement OMOP:19625499 - MEN1 protein: Substitution in position 235 of E replaced by K measurement OMOP:19625618 - PMS2 on GRCh38 chr7: Duplication of position 5995573 measurement OMOP:19625833 - SMAD3 protein: Substitution in position 368 of R replaced by an early stop codon measurement OMOP:19625888 - APC on GRCh38 chr5: Substitution in position 112839153 of A replaced by G measurement OMOP:19625933 - NOTCH1 transcript: Substitution in position 2041 of G replaced by T measurement OMOP:19625946 - ATR transcript: Substitution in position 442 of G replaced by T measurement OMOP:19625984 - TSC2 on GRCh38 chr16: Deletion in position 2084501 measurement OMOP:19625990 - KMT2D transcript: Deletion in position 7548 measurement OMOP:19626145 - TET2 on GRCh38 chr4: Deletion in position 105237211 measurement OMOP:19626234 - GATA1 transcript: Deletion in position 160 to 163 and Insertion of GCAGTGGCT measurement OMOP:19626336 - NCOR1 on GRCh38 chr17: Deletion in position 16101494 measurement OMOP:19626383 - RNF43 on GRCh38 chr17: Deletion in position 58357737 measurement OMOP:19626496 - TP53 protein: Frameshift substitution in position 194 of L replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19626520 - NF2 transcript: Deletion in position 1636 measurement OMOP:19626685 - TSC1 protein: Frameshift substitution in position 231 of P replaced by T followed by a new reading frame extending for 11 amino acids measurement OMOP:19626736 - WT1 on GRCh38 chr11: Deletion in position 32396368 and Insertion of TCA measurement OMOP:19626754 - KMT2C on GRCh38 chr7: Substitution in position 152152816 of G replaced by A measurement OMOP:19626841 - RB1 transcript: Substitution in position 2384 of C replaced by A measurement OMOP:19626844 - RHOA protein: Substitution in position 17 of G replaced by L measurement OMOP:19626873 - CTNNA1 protein: Substitution in position 332 of R replaced by an early stop codon measurement OMOP:19626901 - MSH6 on GRCh38 chr2: Duplication of position 47804947 measurement OMOP:19626953 - CEBPA transcript: Deletion in position 130 measurement OMOP:19627228 - TET1 protein: Frameshift substitution in position 1155 of S replaced by I followed by a new reading frame extending for 18 amino acids measurement OMOP:19627329 - ALK transcript: Deletion in position 3067+190 measurement OMOP:19627367 - BCORL1 protein: Frameshift substitution in position 1050 of K replaced by G followed by a new reading frame extending for 10 amino acids measurement OMOP:19627374 - STAG1 transcript: Deletion in position 2438 measurement OMOP:19627384 - KDM6A transcript: Substitution in position 622 of C replaced by T measurement OMOP:19627397 - CDH1 transcript: Substitution in position 1596 of G replaced by A measurement OMOP:19627410 - ATR protein: Substitution in position 1277 of E replaced by an early stop codon measurement OMOP:19627541 - LRP1B protein: Substitution in position 1045 of E replaced by an early stop codon measurement OMOP:19627626 - CDK12 on GRCh38 chr17: Substitution in position 39462809 of T replaced by A measurement OMOP:19627723 - TP53 transcript: Deletion in position 1041 measurement OMOP:19627853 - TET2 protein: Frameshift substitution in position 1596 of N replaced by T followed by a new reading frame extending for 14 amino acids measurement OMOP:19627933 - MAP3K1 on GRCh38 chr5: Substitution in position 56882684 of G replaced by T measurement OMOP:19627934 - APC on GRCh38 chr5: Deletion in position 112839951 to 112839964 measurement OMOP:19627953 - SMARCA4 protein: Substitution in position 1005 of R replaced by an early stop codon measurement OMOP:19628048 - ARID1A on GRCh38 chr1: Deletion in position 26773356 to 26773357 measurement OMOP:19628131 - ZNRF3 transcript: Substitution in position 631 of C replaced by T measurement OMOP:19628158 - BCORL1 transcript: Deletion in position 1355 to 1373 measurement OMOP:19642982 - t(9;12)(p23;q15) measurement OMOP:19628212 - PTEN transcript: [Duplication of position 383; Substitution in position 387 of A replaced by C; Deletion in position 391] OMOP:19628328 - BRCA1 on GRCh38 chr17: Substitution in position 43045728 of G replaced by A measurement OMOP:19628440 - TP53 transcript: Insertion in position 904 to 905 of TG measurement OMOP:19628597 - MSH2 protein: Substitution in position 741 of K replaced by an early stop codon measurement OMOP:19628613 - KDM6A transcript: Duplication of position 254 measurement OMOP:19628666 - RET on GRCh38 chr10: Substitution in position 43116080 of G replaced by A measurement OMOP:19628831 - PTCH1 on GRCh38 chr9: Substitution in position 95485872 of C replaced by A measurement OMOP:19628961 - PTCH1 transcript: Substitution in position 466 of C replaced by T measurement OMOP:19629049 - TET2 on GRCh38 chr4: Substitution in position 105235052 of T replaced by A measurement OMOP:19629180 - NOTCH1 transcript: Substitution in position 6969 of C replaced by G measurement OMOP:19629460 - CHEK2 transcript: Substitution in position 1591 of G replaced by T measurement OMOP:19629511 - ROS1 on GRCh38 chr6: Substitution in position 117321255 of A replaced by C measurement OMOP:19629680 - PMS2 transcript: Deletion in position 2192 to 2196 measurement OMOP:19629760 - POLQ on GRCh38 chr3: Substitution in position 121510039 of C replaced by A measurement OMOP:19629822 - WT1 transcript: Deletion in position 1151 to 1158 measurement OMOP:19629853 - SPEN on GRCh38 chr1: Substitution in position 15928740 of C replaced by T measurement OMOP:19630002 - TNFAIP3 protein: Frameshift substitution in position 18 of A replaced by S followed by a new reading frame extending for 14 amino acids measurement OMOP:19630009 - CUL3 on GRCh38 chr2: Deletion in position 224535599 to 224535602 and Insertion of AAA measurement OMOP:19630075 - APC protein: Substitution in position 1055 of I replaced by V measurement OMOP:19630097 - BRCA2 transcript: Deletion in position 1454 measurement OMOP:19630100 - BAZ1A transcript: Deletion in position 3263 to 3264 measurement OMOP:19630348 - TP63 protein: Substitution in position 511 of P replaced by T measurement OMOP:19630461 - SETD2 transcript: Insertion in position 4361 to 4362 of AAAGC measurement OMOP:19630486 - SMAD4 on GRCh38 chr18: Substitution in position 51067027 of T replaced by G measurement OMOP:19630563 - APC transcript: Duplication of position 606 measurement OMOP:19630620 - PTPN11 protein: Substitution in position 60 of G replaced by V measurement OMOP:19630653 - IDH2 on GRCh38 chr15: Substitution in position 90085412 of C replaced by T measurement OMOP:19630789 - TP53 transcript: Deletion in position 121 measurement OMOP:19630964 - AMER1 transcript: Substitution in position 2212 of G replaced by T measurement OMOP:19631059 - STK11 transcript: Substitution in position 1111 of C replaced by T measurement OMOP:19631141 - DAXX transcript: Deletion in position 593 to 594 measurement OMOP:19631269 - MAP3K1 on GRCh38 chr5: Deletion in position 56881870 measurement OMOP:19631302 - KMT2D transcript: Substitution in position 5260 of C replaced by T measurement OMOP:19631305 - FGFR3 on GRCh38 chr4: Substitution in position 1801837 of C replaced by T measurement OMOP:19631343 - APC on GRCh38 chr5: Deletion in position 112835025 to 112835026 measurement OMOP:19631359 - RNF43 on GRCh38 chr17: Deletion in position 58415386 measurement OMOP:19631512 - CSMD3 transcript: Substitution in position 3451 of G replaced by T measurement OMOP:19631540 - KLF4 on GRCh38 chr9: Deletion in position 107488231 measurement OMOP:19631628 - CREBBP transcript: Deletion in position 695 measurement OMOP:19631707 - ATM transcript: Deletion in position 8750 measurement OMOP:19631709 - ERBB4 protein: Substitution in position 879 of G replaced by an early stop codon measurement OMOP:19631996 - WT1 protein: Frameshift substitution in position 90 of S replaced by G followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19632054 - NF2 protein: Frameshift substitution in position 465 of E replaced by S followed by a new reading frame extending for 20 amino acids measurement OMOP:19632125 - ARID2 on GRCh38 chr12: Substitution in position 45860936 of C replaced by T measurement OMOP:19632161 - VHL on GRCh38 chr3: Duplication of position 10142071 measurement OMOP:19632169 - NF2 on GRCh38 chr22: Deletion in position 29678223 to 29678227 measurement OMOP:19632273 - JAK2 on GRCh38 chr9: Substitution in position 5080574 of A replaced by G measurement OMOP:19632292 - CDKN2A protein: Substitution in position 145 of I replaced by T measurement OMOP:19632371 - SMARCA4 protein: Frameshift substitution in position 554 of L replaced by F followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19632389 - NOTCH1 on GRCh38 chr9: Deletion in position 136504915 measurement OMOP:19632395 - APC protein: Substitution in position 443 of E replaced by an early stop codon measurement OMOP:19632486 - SPOP protein: Substitution in position 50 of E replaced by K measurement OMOP:19632655 - PTEN protein: Frameshift substitution in position 264 of M replaced by C followed by a new reading frame extending for 2 amino acids measurement OMOP:19632678 - IDH1 protein: Substitution in position 132 of R replaced by L measurement OMOP:19632800 - TSC2 protein: Substitution in position 1127 of R replaced by Q measurement OMOP:19632817 - DNMT3A on GRCh38 chr2: Substitution in position 25248201 of G replaced by A measurement OMOP:19632883 - PHF6 protein: Frameshift substitution in position 28 of C replaced by R followed by a new reading frame extending for 15 amino acids measurement OMOP:19632950 - POLE transcript: Substitution in position 4288 of C replaced by T measurement OMOP:19633005 - FOXL2 transcript: Duplication of position 642 measurement OMOP:19633027 - RUNX1 transcript: Duplication of position 430 to 434 measurement OMOP:19633065 - TNFAIP3 transcript: Deletion in position 382 measurement OMOP:19633184 - POLD1 on GRCh38 chr19: Deletion in position 50401922 measurement OMOP:19633302 - LATS2 protein: Frameshift substitution in position 177 of G replaced by R followed by a new reading frame extending for 22 amino acids measurement OMOP:19633367 - PIK3R1 protein: Frameshift substitution in position 478 of Q replaced by K followed by a new reading frame extending for 2 amino acids measurement OMOP:19633407 - PRDM1 on GRCh38 chr6: Duplication of position 106088298 measurement OMOP:19633408 - ARHGAP35 transcript: Deletion in position 4276 measurement OMOP:19633504 - PHF6 transcript: Substitution in position 565 of G replaced by T measurement OMOP:19633522 - NF2 protein: Frameshift substitution in position 422 of E replaced by R followed by a new reading frame extending for 4 amino acids measurement OMOP:19633525 - APC protein: Substitution in position 2014 of V replaced by I measurement OMOP:19633679 - IRS4 on GRCh38 chrX: Substitution in position 108736093 of G replaced by C measurement OMOP:19633831 - MLF1 transcript: Substitution in position 610 of G replaced by T measurement OMOP:19633858 - RB1 protein: Frameshift substitution in position 126 of I replaced by N followed by a new reading frame extending for 5 amino acids measurement OMOP:19633901 - CIC on GRCh38 chr19: Deletion in position 42295147 measurement OMOP:19633903 - RAD21 protein: Substitution in position 358 of K replaced by an early stop codon measurement OMOP:19633921 - PTEN transcript: Substitution in position 228 of T replaced by G measurement OMOP:19634063 - BAP1 protein: Frameshift substitution in position 411 of N replaced by K followed by a new reading frame extending for 7 amino acids measurement OMOP:19634159 - PIK3R1 transcript: Duplication of position 1191 measurement OMOP:19634267 - WT1 on GRCh38 chr11: Deletion in position 32434970 measurement OMOP:19634369 - COL25A1 transcript: Substitution in position 1303 of C replaced by G measurement OMOP:19634442 - ARHGEF12 on GRCh38 chr11: Substitution in position 120484480 of G replaced by T measurement OMOP:19634476 - FGFR3 protein: Substitution in position 650 of K replaced by E measurement OMOP:19634505 - MSH6 protein: Substitution in position 1139 of G replaced by D measurement OMOP:19634637 - EGFR protein: Deletion in position 746 to 751 and Insertion of A measurement OMOP:19634659 - CDKN1B transcript: Substitution in position 514 of G replaced by T measurement OMOP:19634722 - PML protein: Frameshift substitution in position 764 of Q replaced by S followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19634808 - ERBB2 on GRCh38 chr17: Substitution in position 39706998 of G replaced by T measurement OMOP:19634815 - EGFR protein: Substitution in position 613 of A replaced by T measurement OMOP:19634827 - BCOR transcript: Substitution in position 2836 of G replaced by T measurement OMOP:19634849 - TET2 transcript: Substitution in position 4532 of T replaced by A measurement OMOP:19634947 - ELF3 protein: Substitution in position 85 of Y replaced by an early stop codon measurement OMOP:19634978 - EGFR transcript: [Substitution in position 2303 of G replaced by C; Substitution in position 2305 of G replaced by T; Deletion in position 2309 to 2310 and insertion of CCAGCGTGGAT] OMOP:19635039 - FBXW7 on GRCh38 chr4: Substitution in position 152411674 of G replaced by A measurement OMOP:19635094 - TRIM33 on GRCh38 chr1: Duplication of position 114510876 measurement OMOP:19635217 - ATRX protein: Frameshift substitution in position 479 of P replaced by Q followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19635312 - KMT2C protein: Frameshift substitution in position 218 of D replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19635348 - PTPRT transcript: Deletion in position 1364 to 1365 measurement OMOP:19635364 - CDKN2A protein: Frameshift substitution in position 7 of S replaced by H followed by a new reading frame extending for 6 amino acids measurement OMOP:19635371 - FBXW7 transcript: Substitution in position 550 of G replaced by T measurement OMOP:19635457 - APC on GRCh38 chr5: Deletion in position 112839712 measurement OMOP:19635460 - RB1 transcript: Substitution in position 619 of C replaced by T measurement OMOP:19635502 - PTEN on GRCh38 chr10: Insertion in position 87933191 to 87933192 of G measurement OMOP:19635508 - PTEN on GRCh38 chr10: Duplication of position 87952156 to 87952157 measurement OMOP:19635546 - KDM5C protein: Frameshift substitution in position 1359 of S replaced by V followed by a new reading frame extending for 5 amino acids measurement OMOP:19635620 - CREBBP on GRCh38 chr16: Substitution in position 3769347 of G replaced by A measurement OMOP:19635651 - FANCA protein: Substitution in position 169 of E replaced by an early stop codon measurement OMOP:19635667 - KMT2D on GRCh38 chr12: Deletion in position 49052307 measurement OMOP:19635695 - COL4A5 protein: Substitution in position 195 of G replaced by V measurement OMOP:19635698 - VHL on GRCh38 chr3: Duplication of position 10142051 measurement OMOP:19635745 - NOTCH1 transcript: Insertion in position 2067 to 2068 of A measurement OMOP:19635780 - ATRX on GRCh38 chrX: Deletion in position 77681693 measurement OMOP:19635833 - CDKN2A transcript: Duplication of position 278 measurement OMOP:19642985 - t(9;12)(q33;q14) measurement OMOP:19635926 - KEAP1 on GRCh38 chr19: Substitution in position 10499745 of T replaced by A measurement OMOP:19635947 - LATS2 on GRCh38 chr13: Substitution in position 20975091 of C replaced by A measurement OMOP:19635950 - TP53 protein: Frameshift substitution in position 165 of Q replaced by S followed by a new reading frame extending for 5 amino acids measurement OMOP:19635973 - NOTCH2 protein: Frameshift substitution in position 1527 of C replaced by W followed by a new reading frame extending for 10 amino acids measurement OMOP:19636026 - FGFR2 transcript: Substitution in position 2301+63 of T replaced by C measurement OMOP:19636066 - CDKN2A transcript: Deletion in position 274 to 325 measurement OMOP:19636303 - MAP3K1 protein: Frameshift substitution in position 1235 of Q replaced by T followed by a new reading frame extending for 11 amino acids measurement OMOP:19636323 - GATA3 transcript: Insertion in position 1203 to 1204 of AG measurement OMOP:19636398 - MLH1 protein: Substitution in position 600 of E replaced by K measurement OMOP:19636464 - PIK3R1 protein: Frameshift substitution in position 579 of Q replaced by P followed by a new reading frame extending for 2 amino acids measurement OMOP:19636470 - ARID1B protein: Frameshift substitution in position 1918 of N replaced by Q followed by a new reading frame extending for 6 amino acids measurement OMOP:19636542 - ABL2 protein: Substitution in position 889 of K replaced by Q measurement OMOP:19636683 - CSMD3 transcript: Substitution in position 8122 of C replaced by T measurement OMOP:19636708 - KMT2D protein: Frameshift substitution in position 315 of W replaced by L followed by a new reading frame extending for 27 amino acids measurement OMOP:19636751 - MEN1 on GRCh38 chr11: Deletion in position 64804498 to 64804504 measurement OMOP:19636797 - CREBBP transcript: Substitution in position 5333 of C replaced by A measurement OMOP:19636854 - PTEN protein: Frameshift substitution in position 247 of L replaced by D followed by a new reading frame extending for 11 amino acids measurement OMOP:19636868 - IKZF1 on GRCh38 chr7: Substitution in position 50400565 of C replaced by T measurement OMOP:19636874 - TSC1 transcript: Deletion in position 1388 measurement OMOP:19636918 - TP53 on GRCh38 chr17: Deletion in position 7676064 measurement OMOP:19637057 - RNF43 on GRCh38 chr17: Deletion in position 58415462 measurement OMOP:19637161 - ARNT transcript: Insertion in position 1175 to 1176 of G measurement OMOP:19637179 - APC on GRCh38 chr5: Duplication of position 112835023 measurement OMOP:19637198 - LRP1B transcript: Deletion in position 10313 to 10317 measurement OMOP:19637200 - CEBPA protein: Frameshift substitution in position 275 of K replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19637211 - CTNNA1 transcript: Deletion in position 2008 measurement OMOP:19637294 - EPAS1 transcript: Substitution in position 859 of G replaced by T measurement OMOP:19637303 - KMT2D protein: Substitution in position 2811 of Q replaced by an early stop codon measurement OMOP:19637322 - WT1 on GRCh38 chr11: Insertion in position 32434743 to 32434744 of A measurement OMOP:19637328 - EGFR protein: Substitution in position 750 of A replaced by E measurement OMOP:19637351 - ARHGAP35 protein: Substitution in position 993 of Y replaced by an early stop codon measurement OMOP:19637710 - DNMT3A on GRCh38 chr2: Deletion in position 25240421 measurement OMOP:19637721 - NCOR2 protein: Frameshift substitution in position 150 of P replaced by S followed by a new reading frame extending for 8 amino acids measurement OMOP:19637810 - ITGAE on GRCh38 chr17: Substitution in position 3724179 of C replaced by T measurement OMOP:19637926 - PRF1 on GRCh38 chr10: Deletion in position 70598438 measurement OMOP:19637932 - PIK3R1 protein: Substitution in position 348 of R replaced by an early stop codon measurement OMOP:19638008 - TP53 on GRCh38 chr17: Duplication of position 7676159 measurement OMOP:19638014 - FANCA protein: Frameshift substitution in position 17 of G replaced by A followed by a new reading frame extending for 27 amino acids measurement OMOP:19638028 - TP53 protein: Frameshift substitution in position 185 of S replaced by R followed by a new reading frame extending for 23 amino acids measurement OMOP:19638141 - MTOR on GRCh38 chr1: Substitution in position 11204570 of G replaced by A measurement OMOP:19638246 - ASXL1 protein: Frameshift substitution in position 626 of G replaced by V followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19638261 - DICER1 on GRCh38 chr14: Insertion in position 95096268 to 95096269 of AGCA measurement OMOP:19638315 - GATA3 on GRCh38 chr10: Duplication of position 8063998 measurement OMOP:19638404 - RAD51C protein: Substitution in position 287 of T replaced by A measurement OMOP:19638472 - SMARCB1 protein: Frameshift substitution in position 67 of S replaced by V followed by a new reading frame extending for 4 amino acids measurement OMOP:19638484 - GRIN2A on GRCh38 chr16: Substitution in position 10180096 of G replaced by A measurement OMOP:19638544 - CDKN2A transcript: Insertion in position 249 to 250 of T measurement OMOP:19638639 - TSC2 on GRCh38 chr16: Substitution in position 2088246 of A replaced by G measurement OMOP:19638748 - KMT2D transcript: Substitution in position 8659 of G replaced by T measurement OMOP:19638779 - KMT2D on GRCh38 chr12: Deletion in position 49038628 to 49038631 measurement OMOP:19639087 - KMT2D on GRCh38 chr12: Substitution in position 49026756 of A replaced by T measurement OMOP:19639095 - DAXX transcript: Substitution in position 922 of C replaced by T measurement OMOP:19639163 - ZFHX3 transcript: Deletion in position 8353 measurement OMOP:19639167 - TET2 on GRCh38 chr4: Deletion in position 105272847 measurement OMOP:19639224 - KMT2C protein: Frameshift substitution in position 2700 of D replaced by M followed by a new reading frame extending for 13 amino acids measurement OMOP:19639270 - KDM6A on GRCh38 chrX: Deletion in position 45063443 to 45063446 measurement OMOP:19639288 - KMT2C transcript: Substitution in position 12586 of C replaced by T measurement OMOP:19639325 - GATA3 protein: Frameshift substitution in position 391 of S replaced by R followed by a new reading frame extending for an uncertain number of amino acids measurement OMOP:19639373 - CDH1 protein: Substitution in position 649 of S replaced by F measurement OMOP:19639420 - TGFBR2 on GRCh38 chr3: Deletion in position 30688468 measurement OMOP:19639426 - POT1 protein: Substitution in position 250 of S replaced by an early stop codon measurement OMOP:19639438 - SETD2 on GRCh38 chr3: Deletion in position 47084368 to 47084369 measurement OMOP:19639537 - CDKN2A on GRCh38 chr9: Substitution in position 21968220 of C replaced by T measurement OMOP:19639766 - KEAP1 protein: Substitution in position 542 of E replaced by an early stop codon measurement OMOP:19639892 - MSH2 protein: Frameshift substitution in position 497 of I replaced by K followed by a new reading frame extending for 15 amino acids measurement OMOP:19639916 - PALB2 transcript: Deletion in position 3105 measurement OMOP:19640038 - PTPRB protein: Substitution in position 1961 of R replaced by an early stop codon measurement OMOP:19640048 - WT1 protein: Frameshift substitution in position 439 of R replaced by H followed by a new reading frame extending for 17 amino acids measurement OMOP:19640099 - KDM6A transcript: Deletion in position 866 measurement OMOP:19640170 - TBX3 transcript: Deletion in position 678 to 679 measurement OMOP:19640178 - APC transcript: Duplication of position 3827 to 3828 measurement OMOP:19640186 - ARID1A transcript: Duplication of position 2401 to 2402 measurement OMOP:19640241 - GATA3 on GRCh38 chr10: Insertion in position 8069540 to 8069541 of C measurement OMOP:19640371 - CDKN1A on GRCh38 chr6: Substitution in position 36684247 of G replaced by A measurement OMOP:19640484 - GATA3 transcript: Duplication of position 431 measurement OMOP:19640547 - RB1 transcript: Deletion in position 2062 measurement OMOP:19640571 - NF2 on GRCh38 chr22: Substitution in position 29639152 of T replaced by A measurement OMOP:19640600 - FANCE on GRCh38 chr6: Deletion in position 35456234 to 35456236 measurement OMOP:19640721 - PTEN on GRCh38 chr10: Deletion in position 87961024 to 87961043 measurement OMOP:19640726 - KMT2D on GRCh38 chr12: Duplication of position 49049733 measurement OMOP:19640775 - IRF4 protein: Frameshift substitution in position 126 of R replaced by K followed by a new reading frame extending for 5 amino acids measurement OMOP:19640819 - NF2 transcript: Deletion in position 1336 to 1337 measurement OMOP:19640844 - ARHGAP35 on GRCh38 chr19: Substitution in position 46920923 of C replaced by T measurement OMOP:19640856 - ARID1B on GRCh38 chr6: Duplication of position 157207695 measurement OMOP:19640969 - CYLD transcript: Deletion in position 454 to 455 measurement OMOP:19640989 - NOTCH1 on GRCh38 chr9: Duplication of position 136513393 measurement OMOP:19641022 - APC protein: Frameshift substitution in position 1455 of N replaced by A followed by a new reading frame extending for 19 amino acids measurement OMOP:19641027 - RGS9BP protein: Substitution in position 96 of A replaced by S measurement OMOP:19641036 - FBXW7 transcript: Substitution in position 994 of G replaced by T measurement OMOP:19641053 - KDM5C on GRCh38 chrX: Deletion in position 53195383 measurement OMOP:19641117 - del(1)(p21p11) measurement OMOP:19641325 - dic(14;19)(p11;q13) measurement OMOP:19641337 - dic(17;20)(p12;q11) measurement OMOP:19641385 - dic(9;12)(p13;p13) measurement OMOP:19641491 - der(1;15)(q10;p10) measurement OMOP:19641500 - der(1;19)(q10;p10) measurement OMOP:19641502 - der(1;2)(q10;p10) measurement OMOP:19641547 - der(15;22)(q10;q10) measurement OMOP:19641571 - der(3;12)(q10;q10) measurement OMOP:19641688 - ins(10;11)(p11;q23q13) measurement OMOP:19641748 - inv(16)(p13.1q22.1) measurement OMOP:19641853 - t(1;12)(p33;q15) measurement OMOP:19641905 - t(1;17)(q42.3;q21.2) measurement OMOP:19641919 - t(1;19)(q23;q13) measurement OMOP:19641950 - t(1;22)(p36;q11) measurement OMOP:19641957 - t(1;3)(p34;p21) measurement OMOP:19641967 - t(1;4)(p32;p12) measurement OMOP:19642050 - t(10;15)(q26;q14) measurement OMOP:19642177 - t(12;16)(q13;p11) measurement OMOP:19642203 - t(12;22)(p13;q13) measurement OMOP:19642250 - t(14;21)(q11;q22) measurement OMOP:19642264 - t(15;17)(q24;q21) measurement OMOP:19642311 - t(19;22)(q13.3;q11) measurement OMOP:19642328 - t(2;12)(p11;p12) measurement OMOP:19642411 - t(2;4)(p23;q25q35) measurement OMOP:19642437 - t(2;8)(p11;q24) measurement OMOP:19642537 - t(3;21)(q26;q11) measurement OMOP:19642540 - t(3;21)(q27;q22) measurement OMOP:19642589 - t(3;8)(p21;q12) measurement OMOP:19642611 - t(3;9;22)(q26;q34;q11) measurement OMOP:19642719 - t(5;9;22)(q13;q34;q11) measurement OMOP:19642922 - t(8;22) measurement OMOP:19643184 - CDKN2B gene deletion measurement OMOP:19643296 - TLK2 gene amplification measurement OMOP:19643351 - CLP1 gene rearrangement measurement OMOP:19643390 - FGFR2 gene rearrangement measurement OMOP:19643415 - HIP1 gene rearrangement measurement OMOP:19643456 - MAP2K2 gene rearrangement measurement OMOP:19643474 - MYB gene rearrangement measurement OMOP:19643496 - NUP214 gene rearrangement measurement OMOP:19643517 - PIM1 gene rearrangement measurement OMOP:19643611 - ASXL1 exon 13 mutation measurement OMOP:19643669 - STK11 exon 1 mutation measurement OMOP:19643760 - LEPR protein expression measurement OMOP:19643762 - MAGEH1 protein expression measurement OMOP:19643914 - CDK6::KMT2A gene fusion measurement OMOP:19643958 - CSF2RA::CRLF2 gene fusion measurement OMOP:19644010 - ETV6::ABL2 gene fusion measurement OMOP:19644022 - ETV6::MECOM gene fusion measurement OMOP:19644034 - EWSR1::ATF1 gene fusion measurement OMOP:19644188 - IGH::TNFSF13 gene fusion measurement OMOP:19644232 - ITM2B::RB1 gene fusion measurement OMOP:19644264 - KMT2A::BCL9L gene fusion measurement OMOP:19644371 - MDM4::DNMT3B gene fusion measurement OMOP:19644381 - MEF2D::HNRNPM gene fusion measurement OMOP:19644393 - MKRN1::BRAF gene fusion measurement OMOP:19644396 - MLLT10::CLP1 gene fusion measurement OMOP:19644403 - MLLT10::UBE4A gene fusion measurement OMOP:19644468 - NT5C2::KMT2A gene fusion measurement OMOP:19644477 - NUP98::CADM1 gene fusion measurement OMOP:19644479 - NUP98::HOXA13 gene fusion measurement OMOP:19644526 - PAX5::ZCCHC7 gene fusion measurement OMOP:19644538 - PICALM::MLLT10 gene fusion measurement OMOP:19644562 - PPP2R1B::SIK3 gene fusion measurement OMOP:19644587 - RABEP1::PDGFRB gene fusion measurement OMOP:19644686 - ST6GAL1::BCL6 gene fusion measurement OMOP:196523 - Diarrhea OMOP:196856 - Crushing injury of trunk OMOP:197050 - Abnormality of organs AND/OR soft tissues of pelvis affecting pregnancy OMOP:197138 - Open wound of buttock with complication OMOP:197163 - Burn of trunk OMOP:197206 - Balantidiasis OMOP:197349 - Perineal hematoma OMOP:197381 - Epigastric pain OMOP:197440 - Nonvenomous insect bite of trunk without infection OMOP:197494 - Viral hepatitis C OMOP:197654 - Congenital cystic disease of liver OMOP:197676 - Large liver OMOP:198019 - Iliac blood vessel injury OMOP:198702 - Lymphosarcoma of lymph nodes of inguinal region and lower limb OMOP:1988076 - Left eye Fixation point [Angle] OMOP:1988116 - Acceptance of loss total score [R-Outcomes] OMOP:1988167 - Axis II: Spatial aspects score [Mainz Pain Staging System] OMOP:1988231 - Amoxicillin IgG Ab [Mass/volume] in Serum OMOP:1988237 - Motor nerve conduction velocity Right median nerve OMOP:1988239 - Entity State OMOP:1988298 - Effectiveness of avoiding public spaces, gatherings, and crowds to keep safe from condition of interest OMOP:1988433 - Prothionamide [Susceptibility] OMOP:1988474 - Near divergence break by Phoropter OMOP:1988521 - How bothersome have halos been when not wearing corrective lenses in past 7 days OMOP:1988526 - Feel disconnected from others since illness OMOP:1988561 - Know possible benefits of treatment plan OMOP:1988605 - Acceptance of loss panel [R-Outcomes] OMOP:198861 - Congenital anomaly of fallopian tubes OMOP:1988630 - Leukocyte clumps [Presence] in Body fluid by Automated OMOP:1988641 - Outcome and assessment information set (OASIS) form - version E - Follow Up during assessment period [CMS Assessment] OMOP:1988663 - Cariprazine [Mass/volume] in Urine by Confirmatory method OMOP:1988724 - Lost some close relationships before illness OMOP:1988820 - OASIS E - Special Treatment, Procedures, and Programs - discharge from agency during assessment period [CMS Assessment] OMOP:1988839 - Transforming growth factor beta [Mass/volume] in Serum or Plasma OMOP:1988868 - Satisfaction with personal relationships in last 2 weeks OMOP:1988888 - Gastrin releasing polypeptide [Units/volume] in Serum or Plasma OMOP:1988981 - I am embarrassed by using my oxygen in public in past 7 days OMOP:1989019 - Far infravergence break by Phoropter OMOP:1989105 - Entity Address OMOP:1989125 - Sensory nerve action potential amplitude Right radial nerve OMOP:1989257 - 6-Hydroxybuspirone [Mass/volume] in Urine by Confirmatory method OMOP:1989261 - Frequency of conveying meaningful complex messages in low demand situations OMOP:1989271 - Bracing while at rest OMOP:1989319 - Worried about housing stability in next 2 months OMOP:1989413 - Lost some close relationships since illness OMOP:1989416 - Received or applied for paycheck protection since the beginning of the pandemic OMOP:1989425 - Weight of Liver OMOP:1989434 - Triple phosphate crystals [#/volume] in Urine sediment by Computer assisted method OMOP:1989447 - Agreement with statement: most people believe that people who used to have condition of interest are dangerous OMOP:199079 - Hypertrophy of clitoris OMOP:199744 - Carcinoma liver and/or biliary system OMOP:199879 - Fistula of the female genital organs OMOP:199891 - Rhesus isoimmunization affecting pregnancy OMOP:199978 - Contusion of lower limb OMOP:199991 - Disorder of transplanted kidney OMOP:200200 - Lumbar spina bifida with hydrocephalus OMOP:200450 - Disorder of urethra OMOP:200461 - Endometriosis of uterus OMOP:200687 - Renal disorder due to type 1 diabetes mellitus OMOP:201043 - Dissection of iliac artery OMOP:201072 - Benign prostatic hyperplasia without outflow obstruction OMOP:201093 - Infection of skin and/or subcutaneous tissue OMOP:201345 - Fistula of urinary bladder OMOP:201399 - Congenital anomaly of adrenal gland OMOP:201478 - Traumatic shock OMOP:201530 - Hyperosmolar coma due to type 2 diabetes mellitus OMOP:201637 - Failed attempted termination of pregnancy complicated by shock OMOP:201813 - Mycosis fungoides of intra-abdominal lymph nodes OMOP:201837 - Abnormality of secretion of glucagon OMOP:201898 - Gastroptosis OMOP:21490533 - Post-discharge provider practice address OMOP:21490591 - Skin temperature --in microenvironment OMOP:21490692 - Gas delivery system inspiratory Nitrous oxide setting [VFr/PPres] OMOP:21490742 - Airway resistance --during inspiration OMOP:21490808 - Carbon dioxide [VFr/PPres] in Gas delivery system.expiratory limb --during expiration OMOP:21490837 - Xenon gas delivered during case [Volume] from Gas delivery system OMOP:21490924 - Infusion time.programmed Infusion pump OMOP:21490978 - Salicylurate/Creatinine [Molar ratio] in Urine OMOP:21490990 - Pulmonary vein A-wave duration by Ultrasound.doppler.PW OMOP:21491012 - Adenovirus Ag [Presence] in Stool by Rapid immunoassay OMOP:21491065 - Decenedioate [Moles/volume] in Serum or Plasma OMOP:21491212 - N,N'-dimethylarginine [Moles/volume] in Serum or Plasma OMOP:21491430 - Potassium [Mass/mass] in Hair OMOP:21491552 - Yellow fever virus ns5 gene [Presence] in Cerebral spinal fluid by NAA with non-probe detection OMOP:21491643 - Left eye Cylinder--WO cycloplegia by Objective refraction OMOP:21491649 - Right eye Axis--W cycloplegia by Subjective refraction OMOP:21491751 - Left anterior chamber Cells Slit lamp biomicroscopy OMOP:21491777 - Are you able to carry two bags filled with groceries 100 yards (100 m) [PROMIS] OMOP:21491793 - I could pick up coins from a table in past 7 days [PROMIS.PEDS] OMOP:21491891 - Type of Strabismus OMOP:21491912 - a-wave implicit time Left retina light-adapted by ERG OMOP:21491922 - Left retina Oscillatory potentials by ERG OMOP:21491950 - My family showed that they cared about me in past 4 weeks [PROMIS.PEDS] OMOP:21491972 - My child knew what he or she could expect from others in our family in past 4 weeks [PROMIS.PARENTPROXY] OMOP:21491984 - Are you able to clean up after a meal [PROMIS] OMOP:21491996 - Are you able to lift small objects (such as a can of soup) above your shoulder [PROMIS] OMOP:21492007 - Are you able to reach above your head [PROMIS] OMOP:21492048 - My child felt he or she was really important to our family in past 4 weeks [PROMIS.PARENTPROXY] OMOP:21492078 - Are you able to use a moving escalator safely [PROMIS] OMOP:21492083 - Are you able to get into a vehicle [PROMIS] OMOP:21492086 - How much difficulty do you currently have playing cards or Bingo or other light recreational activities [PROMIS] OMOP:21492136 - Heart ventricle Left apex Segmental wall motion by US OMOP:21492150 - Cells.9q34 chromosome region deletion/Cells counted in Blood or Tissue by FISH OMOP:21492164 - MLL gene rearrangements [Interpretation] in Blood or Tissue by FISH Narrative OMOP:21492182 - Can recall John [GPCOG] OMOP:21492245 - Do you feel stress - tense, restless, nervous, or anxious, or unable to sleep at night because your mind is troubled all the time - these days [OSQ] OMOP:21492305 - Nortriptyline and E-10-hydroxynortriptyline and Z-10-hydroxynortriptyline panel - Serum or Plasma OMOP:21492313 - Cherry recombinant (rPru av) 3 IgE Ab [Units/volume] in Serum OMOP:21492341 - Somatotropin [Mass/volume] in Serum or Plasma --2.25 hours post dose arginine+insulin OMOP:21492503 - Catheterization and angiography procedures performed panel OMOP:21492629 - Bilirubin.conjugated [Moles/volume] in Peritoneal fluid OMOP:21492802 - Activities of daily living score change [KOOS] OMOP:21492811 - Staphylococcus aureus capsular polysaccharide enzyme cpe gene [Presence] in Nose by NAA with probe detection OMOP:21492846 - Environment temperature during transport OMOP:21492853 - Chlamydia trachomatis+Neisseria gonorrhoeae rRNA [Presence] in Anorectal by NAA with probe detection OMOP:21492881 - Additional pathological findings [Identifier] in Specimen OMOP:21492916 - Near death thoughts and feelings to be shared [Reported] OMOP:21492973 - Phosphorus intake 24 hour Estimated OMOP:21492990 - Choriogonadotropin (pregnancy test) [Presence] in Urine by Rapid immunoassay OMOP:21493032 - Personal advance care plan signer for declarant [Reported] OMOP:21493046 - Occupational Allergen Mix 5 (Isocyanate HDI+MDI+TDI+Phthalic anhydride) IgE Ab RAST class [Presence] in Serum by Multidisk OMOP:21493399 - B IgG Ab [Presence] in Serum or Plasma OMOP:21493489 - Headaches [NDI] OMOP:21493537 - Everolimus [Mass] of Dose OMOP:21493601 - My ability to concentrate has been good in past 7 days [PROMIS] OMOP:21493633 - Measured Activity metabolic rate/Population RMR [Relative energy/Time] OMOP:21493635 - Reported Activity metabolic rate/Population RMR [Relative energy/Time] OMOP:21493848 - Transfer summary note - recommended C-CDA R2.1 sections OMOP:21493850 - Differential panel - Bronchial specimen OMOP:21493962 - Preoperative verification process panel OMOP:21493974 - Microsatellite instability marker BAT25 in Cancer specimen Qualitative OMOP:21493978 - Microsatellite instability marker MONO27 in Cancer specimen Qualitative OMOP:21494024 - Left pulmonary artery Diameter at end systole by US 2D OMOP:21494070 - Birth year OMOP:21494072 - Bridged race [CDC] OMOP:21494215 - cefTAZidime free [Mass/volume] in Serum or Plasma OMOP:21494231 - International Prostate Symptom Score [IPSS] OMOP:21494238 - Chloride intake 24 hour Measured OMOP:21494321 - Right atrial Minor axis at end systole [Length] by US.2D.A4C OMOP:21494347 - Stereopsis by Titmus OMOP:21494401 - Fructose intake 24 hour Estimated OMOP:21494430 - GDAP1 gene targeted mutation analysis in Blood or Tissue by Molecular genetics method OMOP:21494513 - Antihistamines [Presence] in Blood by Screen method OMOP:21494536 - Selenium intake 24 hour Estimated OMOP:21494539 - If you were to spend the rest of your life with your urinary condition just the way it is now, how would you feel about that [IPSS] OMOP:21494542 - Tricuspid valve Effective regurgitant orifice area by US.doppler+Calculated by PISA method OMOP:21494575 - Provider race OMB.1997 OMOP:21494588 - Omega-3 fatty acid intake 24 hour Estimated OMOP:21494601 - Essential amino acid intake panel OMOP:21494668 - Xanthopterin/Creatinine [Molar ratio] in Urine OMOP:21494751 - Time of death [ClockTime] OMOP:21494817 - Type of Left coronary artery catheter OMOP:21494980 - Cardiovascular physiologic assessment [Interpretation] OMOP:21495046 - Precision of boundaries Nominal OMOP:21495344 - Aortic valve Maximum regurgitant blood flow velocity during diastole by US.doppler continuous wave OMOP:23325 - Heartburn OMOP:24230 - Foreign body in larynx OMOP:24970 - Chronic laryngitis OMOP:254830 - Foreign body in lung OMOP:255348 - Polymyalgia rheumatica OMOP:25572 - Disorder of salivary gland OMOP:256531 - Head and neck swelling OMOP:256622 - Pulmonary disease caused by Mycobacteria OMOP:256717 - Bronchospasm OMOP:256722 - Bronchopneumonia OMOP:257007 - Allergic rhinitis OMOP:257012 - Chronic sinusitis OMOP:257315 - Bacterial pneumonia OMOP:25844 - Ulcer of esophagus OMOP:259748 - Primary malignant neoplasm of accessory sinus OMOP:259862 - Malocclusion, Angle class I OMOP:260139 - Acute bronchitis OMOP:260245 - Traumatic hemothorax with open wound into thorax OMOP:260315 - Tuberculosis of lung with cavitation OMOP:260754 - Haemophilus influenzae pneumonia OMOP:260915 - Burn of larynx, trachea and lung OMOP:261528 - Carcinoma in situ of respiratory tract OMOP:2615414 - Primary physician OMOP:2615491 - The beneficiary has been informed of the purchase and rental options and after 30 days has not informed the supplier of his/her decision OMOP:2617636 - Patient not documented to have received prescription for anticoagulant therapy at discharge (Deprecated) OMOP:2617638 - CLINICIAN DOCUMENTED THAT PATIENT WAS NOT AN ELIGIBLE CANDIDATE FOR ANTICOAGULANT THERAPY AT DISCHARGE (Deprecated) OMOP:2617644 - PATIENT NOT RECEIVING OR INELIGIBLE TO RECEIVE FOOD MOUTH (Deprecated) OMOP:2617659 - Patient not documented to have received an esophageal biopsy when suspicion of barrett's esophagus is indicated in the endoscopy report (Deprecated) OMOP:2617664 - CLINICIAN DOCUMENTED RECONCILIATION OF DISCHARGE MEDICATIONS WITH CURRENT MEDICATION LIST IN MEDICAL RECORD (Deprecated) OMOP:2617685 - PATIENT WAS NOT AN ELIGIBLE CANDIDATE FOR MEDICAL HISTORY REVIEW WITH ASSESSMENT OF NEW OR CHANGING MOLES (Deprecated) OMOP:2617693 - Patient not documented to have received pharmacologic therapy (Deprecated) OMOP:2617724 - CLINICIAN HAS NOT PROVIDED CARE FOR THE AGE-RELATED MACULAR DEGENERATION PATIENT FOR THE REQUIRED TIME FOR MACULAR EXAMINATION MEASUREMENT (Deprecated) OMOP:2617785 - Clinician documentation that patient was not an eligible candidate for radiation therapy measure (Deprecated) OMOP:2617786 - Documentation of radiation therapy recommended within 12 months of first office visit (Deprecated) OMOP:2617787 - For patients with er or pr positive, stage ic-iii breast cancer, clinician did not document that the patient received or was prescribed tamoxifen or aromatase inhibitor (Deprecated) OMOP:2617904 - DOCUMENTATION THAT PROPHYLACTIC ANTIBIOTIC WAS NOT GIVEN WITHIN ONE HOUR (IF FLUOROQUINOLONE OR VANCOMYCIN, TWO HOURS) PRIOR TO SURGICAL INCISION (OR START OF PROCEDURE WHEN NO INCISION IS REQUIRED), REASON NOT SPECIFIED (Deprecated) OMOP:2617921 - CLINICIAN DOCUMENTED THAT PATIENT WAS NOT AN ELIGIBLE CANDIDATE FOR ANTIPLATELET THERAPY (Deprecated) OMOP:2617927 - CLINICIAN DOCUMENTED THAT PATIENT WAS INELIGIBLE FOR PROPHYLACTIC ANTIBIOTIC SELECTION MEASURE (Deprecated) OMOP:2617996 - Oncology; practice guidelines; management differs from guidelines for other reason(s) not listed (for use in a medicare-approved demonstration project) OMOP:2618150 - Prenatal care, at-risk assessment OMOP:2618175 - Ongoing support to maintain employment, per 15 minutes OMOP:2618193 - Mental health program OMOP:2618207 - Family/couple without client present OMOP:26942 - Hemoglobin SS disease with crisis OMOP:2719408 - Beneficiary resides in a competitive bidding area and travels outside that competitive bidding area and receives a competitive bid item OMOP:2719409 - Dmepos item subject to dmepos competitive bidding program number 3 OMOP:2720486 - Lease/rental (use the 'll' modifier when dme equipment rental is to be applied against the purchase price) OMOP:2721318 - Wellness assessment, performed by non-physician OMOP:2721432 - Global fee urgent care centers OMOP:2721604 - Services provided by registered nurse with specialized, highly technical home infusion training OMOP:2721768 - Medicaid level of care 10, as defined by each state OMOP:28716 - Benign neoplasm of aortic body OMOP:3000129 - Organochlorine pesticides [Presence] in Tissue by Screen method OMOP:3000239 - Coxsackievirus A9 Ab [Titer] in Cerebral spinal fluid by Complement fixation OMOP:3000276 - Heart rate Peripheral artery by US.doppler OMOP:3000290 - Yellow fever virus IgG Ab [Units/volume] in Serum OMOP:3000368 - Left pulmonary artery Systolic blood pressure OMOP:3000474 - Date and time of cleaning Endoscopy device OMOP:3000505 - Urea nitrogen [Mass/volume] in Peritoneal dialysis fluid --8th specimen OMOP:3000549 - Teicoplanin [Moles/volume] in Serum or Plasma --peak OMOP:3000556 - Microscopic observation [Identifier] in Aspirate by Gram stain OMOP:3000837 - Albumin/Creatinine [Presence] in Urine by Test strip OMOP:3000874 - Acetylene [Mass/volume] in Serum or Plasma OMOP:3000883 - Phentermine [Mass/volume] in Serum or Plasma OMOP:3000893 - History of Behavior disorders OMOP:3000905 - Leukocytes [#/volume] in Blood by Automated count OMOP:3000956 - Chlorate [Presence] in Blood OMOP:3001034 - Specimen site Narrative OMOP:3001070 - Echinococcus granulosus IgE Ab [Units/volume] in Serum OMOP:3001128 - ALPRAZolam [Mass] of Dose OMOP:3001214 - ED problem (narrative) OMOP:3001291 - Threonine [Moles/time] in 24 hour Urine OMOP:3001350 - Dezocine [Presence] in Urine OMOP:3001369 - Heavy metals negative [Identifier] in Urine by Screen method OMOP:3001372 - Albumin/Globulin [Mass Ratio] in Semen OMOP:3001568 - R' wave duration in lead V4 OMOP:3001610 - Norepinephrine [Mass/volume] in Plasma --4 hours post XXX challenge OMOP:3001634 - Amobarbital [Presence] in Urine by Screen method OMOP:3001673 - CD103 cells/100 cells in Specimen OMOP:3001694 - CD3+CD4+ (T4 helper) cells [#/volume] in Specimen OMOP:3001745 - CBS gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3001768 - Bordetella avium Ab [Presence] in Serum by Immunoassay OMOP:3001811 - Heart rate minimum setting Apnea Monitor Alarm OMOP:3001920 - 17-Hydroxyprogesterone [Mass/time] in 24 hour Urine OMOP:3002016 - Taurine/Creatinine [Molar ratio] in 24 hour Urine OMOP:3002095 - CD94 cells/100 cells in Blood OMOP:3002105 - Porcine parvovirus Ab [Units/volume] in Serum OMOP:3002446 - Reagin Ab [Presence] in Cerebral spinal fluid by VDRL OMOP:3002513 - Dehydroepiandrosterone (DHEA).unconjugated [Mass/time] in 24 hour Urine OMOP:3002582 - Erythrocytes [#/volume] in Urine OMOP:3002708 - Liver kidney microsomal 1 Ab [Presence] in Serum OMOP:3002719 - Hemoglobin [Mass/volume] in Urine OMOP:3002806 - History of Kidney disorders OMOP:3002927 - HLA-DQ2 [Presence] in Donor OMOP:3003045 - Thyroxine (T4) [Mass/volume] in Serum or Plasma --baseline OMOP:3003178 - Pea IgG Ab [Units/volume] in Serum OMOP:3003188 - Pulmonic valve Maximum regurgitant blood flow velocity during diastole by US.doppler OMOP:3003320 - Ovine progressive pneumonia virus Ab [Presence] in Serum by Immunoassay OMOP:3003533 - Parainfluenza virus 1 IgM Ab [Titer] in Serum OMOP:3003641 - Methyl amyl ketone [Mass/volume] in Urine OMOP:3003696 - Oxygen content in Right pulmonary artery OMOP:3003798 - Blood pressure method OMOP:3003888 - Timothy IgE Ab [Units/volume] in Serum OMOP:3004116 - Swiss Cheese IgG Ab [Units/volume] in Serum OMOP:3004201 - Nickel [Mass/volume] in Blood OMOP:3004283 - EKG Report (narrative) OMOP:3004338 - Enolase.neuron specific [Units/volume] in Serum or Plasma OMOP:3004341 - History of Hereditary disorders OMOP:3004360 - Oxalate/Creatinine [Mass Ratio] in Urine OMOP:3004414 - Oxazepam [Presence] in Urine by Screen method OMOP:3004438 - Meprobamate [Presence] in Urine OMOP:3004474 - Bovine diarrhea virus Ag [Presence] in Blood by Immunoassay OMOP:3004621 - Rickettsia typhi Ab [Presence] in Serum by Immunofluorescence OMOP:3004641 - Pneumocystis jiroveci Ag [Presence] in Throat OMOP:3005105 - Blasts [#/volume] in Blood OMOP:3005315 - Microscopic observation [Identifier] in Cerebral spinal fluid by KOH preparation OMOP:3005462 - Campylobacter sp Ab [Presence] in Serum OMOP:3005545 - Pesticides [Identifier] in Urine OMOP:3005644 - Hantavirus Ab [Units/volume] in Serum OMOP:3005787 - Glucose [Mass/volume] in Serum or Plasma --15 minutes post XXX challenge OMOP:3005862 - Adefovir [Susceptibility] by Phenotype method OMOP:3005948 - Herpes simplex virus Ag [Presence] in Skin by Immunofluorescence OMOP:3006002 - Alkalase IgE Ab [Units/volume] in Serum OMOP:3006011 - Ax Ag [Presence] on Red Blood Cells OMOP:3006028 - Cotinine [Mass/volume] in Serum or Plasma OMOP:3006114 - Trypanosoma congolense DNA [Presence] in Blood by NAA with probe detection OMOP:3006160 - Chlamydia trachomatis Ag [Presence] in Stool by Immunofluorescence OMOP:3006171 - Site of distant metastasis Cancer OMOP:3006188 - Chinchilla IgE Ab [Units/volume] in Serum OMOP:3006313 - Specimen source [Identifier] in Cervical or vaginal smear or scraping by Cyto stain OMOP:3006336 - Allergens tested for in Serum OMOP:3006358 - Streptococcus pneumoniae Ab [Presence] in Serum OMOP:3006369 - Airway pressure --at zero inspiratory flow on ventilator OMOP:3006837 - Nutrition Knowledge Family [OMAHA] OMOP:3006961 - Chicken triggered histamine release [Units/volume] in Blood OMOP:3007047 - ST wave mid displacement in lead V6 OMOP:3007063 - Naltrexone cutoff [Mass/volume] in Urine for Screen method OMOP:3007073 - Distant metastases.other [Class] Cancer OMOP:3007085 - hydrALAZINE [Presence] in Urine OMOP:3007092 - Glucose [Mass/volume] in Serum or Plasma --2 hours post 1.2 g/kg lactose PO OMOP:3007166 - CD55 cells/100 cells in Blood OMOP:3007196 - Creatinine [Moles/volume] in Dialysis fluid OMOP:3007222 - Microscopic observation [Identifier] in Tissue by Silver nitrate stain OMOP:3007379 - Bougainvillea IgE Ab [Units/volume] in Serum OMOP:3007406 - Tetrahydrocannabinol [Presence] in Stool by Screen method OMOP:3007573 - Schistosoma sp identified in Stool by Concentration OMOP:3007604 - Yersinia sp IgG Ab [Units/volume] in Serum OMOP:3007703 - Pressure device type [Text] Perimetry OMOP:3007765 - Date.vaccination contraindication/precaution effective OMOP:3007788 - Serology studies (set) OMOP:3007838 - Sheep milk IgE Ab [Units/volume] in Serum OMOP:3007851 - Pulmonary artery Deceleration slope [Velocity] by US OMOP:3008023 - Influenza virus A Mississippi Ab [Units/volume] in Serum by Hemagglutination inhibition OMOP:3008026 - Epithelial cells.renal [Presence] in Urine sediment by Light microscopy OMOP:3008041 - Mung Bean IgG Ab [Units/volume] in Serum OMOP:3008218 - Thiazides screen method [Identifier] in Urine OMOP:3008380 - ED clinical finding practitioner profession OMOP:3008419 - Leishmania sp Ab [Presence] in Serum OMOP:3008501 - Sanitation Status [OMAHA] OMOP:3008519 - ALPRAZolam [Mass/volume] in Vitreous fluid OMOP:3008521 - Argininosuccinate/Creatinine [Ratio] in Urine OMOP:3008625 - EPINEPHrine [Mass/volume] in Plasma OMOP:3008700 - Salmonella typhi H D Ab [Titer] in Serum OMOP:3008778 - Blood group antigens present [Identifier] in Blood product unit OMOP:3008900 - Fetal Body weight estimated from Abdominal circumference on US by Warsof 1977 method OMOP:3009019 - Cortisol [Moles/volume] in Serum or Plasma --8 hours post 2 mg dexamethasone PO 2.5 day high dose q6h OMOP:3009020 - Benzoylecgonine cutoff [Mass/volume] in Urine OMOP:3009138 - Fluid intake total 12 hour OMOP:3009139 - Allobarbital [Moles/volume] in Serum or Plasma OMOP:3009182 - Posterior tibial artery - left Mean blood pressure OMOP:3009194 - Reagin Ab [Presence] in Cerebral spinal fluid OMOP:3009269 - Right eye Argon laser coagulation treatment localization OMOP:3009299 - Lupus anticoagulant neutralization platelet [Time] in Platelet poor plasma by Coagulation assay OMOP:3009304 - Tritrichomonas foetus [Presence] in Placenta by Organism specific culture OMOP:3009352 - Podiatry Episode of care medical records OMOP:3009382 - Toxoplasma gondii IgA Ab [Units/volume] in Serum by Immunoassay OMOP:3009462 - Sporothrix schenckii IgA Ab [Units/volume] in Serum OMOP:3009466 - Valproate [Moles/volume] in Serum or Plasma OMOP:3009587 - IO tube Vendor serial number OMOP:3009730 - Sexuality Status Family [OMAHA] OMOP:3009733 - Amdinocillin [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:3009811 - Nasogastric tube Vendor serial number OMOP:3009812 - [#] Births.live OMOP:3009839 - Tritrichomonas foetus [Presence] in Genital fluid by Organism specific culture OMOP:3009875 - Benzfetamine [Mass/volume] in Milk OMOP:3009963 - Timothy recombinant (rPhl p) 7 IgE Ab [Units/volume] in Serum OMOP:3010189 - Epithelial cells [#/area] in Urine sediment by Microscopy high power field OMOP:3027913 - Serine [Moles/volume] in Cerebral spinal fluid OMOP:3010284 - Plasmodium ovale Ab [Titer] in Serum by Immunofluorescence OMOP:3010286 - Cysteate/Creatinine [Molar ratio] in 24 hour Urine OMOP:3010296 - Alpha-1-Fetoprotein [Mass/volume] in Amniotic fluid OMOP:3010387 - Salmonella paratyphi C H Ab [Presence] in Serum by Latex agglutination OMOP:3010439 - Inspiratory capacity by Helium rebreathing OMOP:3010529 - Creatinine [Mass/time] in 48 hour Urine OMOP:3010633 - Mycoplasma sp Ab [Presence] in Serum OMOP:3010646 - Polarization.binocular Eye Phoropter OMOP:3010777 - Beta globulin [Mass/volume] in 24 hour Urine OMOP:3010787 - Urea nitrogen [Mass/volume] in Peritoneal dialysis fluid --1st specimen OMOP:3010863 - Cefadroxil [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:3010871 - Adenovirus IgM Ab [Titer] in Serum OMOP:3010902 - Mycoplasma synoviae Ab [Presence] in Serum by Hemagglutination OMOP:3010979 - Physical findings Narrative OMOP:3010980 - Borrelia burgdorferi 93kD IgG Ab [Presence] in Serum by Immunoblot OMOP:3011057 - Calcitonin [Mass/volume] in Serum or Plasma --4th specimen post XXX challenge OMOP:3011079 - History of Occupation OMOP:3011106 - Venezuelan equine encephalitis virus IgG Ab [Units/volume] in Serum OMOP:3011166 - Borrelia burgdorferi Ab [Presence] in Cerebral spinal fluid OMOP:3011289 - Herpes simplex virus 1 Ag [Presence] in Genital specimen OMOP:3011319 - Myelin associated glycoprotein IgM Ab [Titer] in Serum OMOP:3011332 - Leishmania sp identified in Tissue by Electrophoresis OMOP:3011356 - Myelin associated glycoprotein/Sulfated glucuronic paragloboside IgM Ab [Units/volume] in Serum OMOP:3011417 - Gas flow FEV 25%-75% OMOP:3011737 - Meperidine [Mass] of Dose OMOP:3011884 - Cholesterol in HDL [Presence] in Serum or Plasma OMOP:3012160 - HIV 2 p41 Ab [Presence] in Serum by Immunoblot OMOP:3012189 - Blood product.pooled [Identifier] OMOP:3012207 - Calcium [Moles/volume] in Serum or Plasma --10 minutes post 2.4 mg/kg calcium short IV OMOP:3012231 - Boron [Mass/volume] in Blood OMOP:3012317 - Brucella ovis Ab [Titer] in Serum OMOP:3012365 - Jamestown canyon virus IgG Ab [Units/volume] in Cerebral spinal fluid OMOP:3012424 - Food Allergen Mix 8 (Brazil nut+Orange+Hazelnut+Apple+Cocoa) IgE Ab [Presence] in Serum by Multidisk OMOP:3012493 - Arterial pulse quality by palpation OMOP:3012499 - Coxsackievirus B2 Ab [Titer] in Serum by Complement fixation --1st specimen OMOP:3012687 - Menstrual status - Reported OMOP:3012691 - Cefetamet [Susceptibility] OMOP:3012732 - Epstein Barr virus nuclear IgM Ab [Presence] in Serum OMOP:3012751 - Measles virus Ag [Presence] in Throat OMOP:3012803 - Propoxyphene [Mass/volume] in Urine by Confirmatory method OMOP:3012875 - Cortisol [Mass/volume] in Urine OMOP:3012913 - Androsterone/Creatinine [Mass Ratio] in Urine OMOP:3012955 - Saint Louis encephalitis virus RNA [Presence] in Cerebral spinal fluid by Probe OMOP:3013230 - HIV 1 p24 Ab [Titer] in Serum by Immunoblot OMOP:3013252 - metroNIDAZOLE [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:3013316 - Ampicillin+Sulbactam [Susceptibility] by Minimum lethal concentration (MLC) OMOP:3013401 - Ribulose [Mass/volume] in Serum OMOP:3013494 - Arsenic.inorganic [Mass/volume] in Urine OMOP:3013495 - Streptokinase Ab [Units/volume] in Serum OMOP:3013496 - Delta 5-Pregnanetriol [Mass/time] in 24 hour Urine OMOP:3013515 - Cortisol [Mass/volume] in Serum or Plasma --3 days post 500 ug corticotropin IM OMOP:3013536 - Phenmetrazine cutoff [Mass/volume] in Urine for Confirmatory method OMOP:3013746 - Methyl propyl ketone [Mass/volume] in Blood OMOP:3013861 - Lipoprotein a [Mass/volume] in Serum or Plasma OMOP:3013991 - Echovirus 6+18+30 Ab [Units/volume] in Serum OMOP:3014024 - Disopyramide [Mass/volume] in Gastric fluid OMOP:3014185 - Influenza virus A Victoria Ab [Units/volume] in Serum by Hemagglutination inhibition OMOP:3014259 - Candida sp IgM Ab [Units/volume] in Serum OMOP:3014313 - prescription Glasses type [Text] OMOP:3014319 - Ovarian artery - right Mean blood flow velocity US.doppler OMOP:3014329 - Fluid intake oral 8 hour OMOP:3014383 - Highlands J virus Ab [Titer] in Serum OMOP:3014509 - Role Change Knowledge [OMAHA] OMOP:3014548 - Right contact lens Manufacturer code OMOP:3014642 - D-Lactate [Moles/volume] in Serum or Plasma --2nd specimen post excercise OMOP:3014665 - Left ventricular Stroke volume index by US.2D+Calculated by biplane ellipse method OMOP:3014712 - Kaolin activated time [Units/volume] in Platelet poor plasma OMOP:3014746 - Phencyclidine [Presence] in Unknown substance OMOP:3014811 - Ova and parasites identified in Stool by Trichrome stain--2nd specimen OMOP:3014836 - Do sup(a) Ab [Presence] in Serum or Plasma from Blood product unit OMOP:3014887 - Endophyte identified in Plant OMOP:3014989 - Candida albicans triggered histamine release [Units/volume] in Blood OMOP:3015052 - Nitrofurantoin [Mass/volume] in Serum or Plasma OMOP:3015081 - Mycobacterium tuberculosis DNA [Presence] in Blood by NAA with probe detection OMOP:3033364 - Cholesterol [Mass/volume] in Pleural fluid OMOP:3015104 - Viomycin [Susceptibility] by Minimum lethal concentration (MLC) OMOP:3015142 - Tuna IgE Ab [Units/volume] in Serum OMOP:3015179 - Aspergillus sp Ab [Titer] in Serum by Immunoassay OMOP:3015249 - Methaqualone [Presence] in Serum or Plasma OMOP:3015325 - HLA-A34(10) [Presence] OMOP:3015382 - Enteroscopy Study observation OMOP:3015466 - Amobarbital [Presence] in Gastric fluid OMOP:3015531 - Creatine kinase.macromolecular [Enzymatic activity/volume] in Serum or Plasma OMOP:3015661 - Right contact lens Correction text OMOP:3015717 - Testosterone.weakly bound [Mass/volume] in Serum or Plasma OMOP:3015806 - Francisella tularensis DNA [Presence] in Tissue by NAA with probe detection OMOP:3015831 - Trivittatus virus Ab [Titer] in Specimen OMOP:3015861 - Arginine/Creatinine [Molar ratio] in Urine OMOP:3015863 - Peak inspiratory flow Respiratory system airway opening --at 1.0 liter per second on ventilator OMOP:3015910 - sulfADIAZINE [Susceptibility] OMOP:3015921 - Right eye Argon laser trabeculoplasty treatment [Time] OMOP:3015947 - Phencyclidine [Mass/volume] in Specimen OMOP:3015964 - IgM [Mass/volume] in Urine by Immunoassay OMOP:3015998 - Medical social services treatment plan, Date range (from/through) described by plan Set OMOP:3016056 - 18-Hydroxycorticosterone [Mass/time] in 24 hour Urine OMOP:3016122 - Echovirus NOS Ab [Titer] in Serum by Complement fixation OMOP:3016150 - Imipramine [Mass] of Dose OMOP:3016324 - Minocycline [Susceptibility] OMOP:3016552 - Kanamycin [Susceptibility] by Gradient strip OMOP:3016709 - Chlamydophila psittaci Ab [Units/volume] in Serum OMOP:3016789 - Amphotericin B [Mass] of Dose OMOP:3016963 - Epstein Barr virus nuclear Ab [Presence] in Cerebral spinal fluid OMOP:3016971 - J point depression in lead I OMOP:3017007 - O group [Presence] on Red Blood Cells OMOP:3017104 - Babesia bovis Ab [Presence] in Serum OMOP:3017152 - Fluid output peritoneal drain OMOP:3017228 - Iodine [Moles/volume] in 24 hour Urine OMOP:3017375 - Insulin [Units/volume] in Serum or Plasma --1.3 hours post XXX challenge OMOP:3017468 - Campylobacter jejuni rRNA [Presence] in Specimen by Probe OMOP:3017596 - Platelet aggregation arachidonate induced in Platelet rich plasma OMOP:3017601 - Chlamydophila psittaci IgM Ab [Units/volume] in Cerebral spinal fluid OMOP:3017655 - Dimetamphetamine [Presence] in Urine by Screen method OMOP:3017816 - Listeria sp Ab [Presence] in Serum OMOP:3017845 - Histoplasma capsulatum yeast phase Ab [Titer] in Serum OMOP:3018005 - Echovirus 7 Ab [Presence] in Serum OMOP:3018028 - Rickettsia (Proteus OXK) Ab [Presence] in Serum by Latex agglutination OMOP:3018147 - Cognition Knowledge [OMAHA] OMOP:3018212 - Centromere IgG Ab [Titer] in Serum by Immunofluorescence OMOP:3018252 - Creatinine renal clearance in 4 hour Urine and Serum or Plasma OMOP:3018426 - HIV 1 p23 Ab [Presence] in Serum by Immunoblot OMOP:3018659 - Methionine [Moles/time] in 24 hour Urine OMOP:3018661 - Western Water Hemp IgG Ab [Units/volume] in Serum OMOP:3018781 - Amoxapine [Presence] in Serum or Plasma OMOP:3018890 - Oxychlordane [Mass/volume] in Urine OMOP:3018977 - Spermatozoa Progressive/100 spermatozoa in Semen OMOP:3019244 - Fluid output gastric tube 24 hour OMOP:3019294 - dilTIAZem [Mass/volume] in Serum or Plasma OMOP:3019407 - Mycoplasma pneumoniae IgA Ab [Units/volume] in Serum OMOP:3019532 - History of Sexual behavior Narrative OMOP:3019653 - Sisomicin [Susceptibility] OMOP:3019772 - Hydroxyalprazolam cutoff [Mass/volume] in Urine for Confirmatory method OMOP:3019850 - Tetrahydroaldosterone [Mass/time] in 24 hour Urine OMOP:3019857 - Fetal Left ventricular posterior wall Thickness diastolic US.M-mode+Measured OMOP:3019962 - Diastolic blood pressure--standing OMOP:3020040 - Chlamydia trachomatis C Ab [Titer] in Serum by Immunofluorescence OMOP:3020065 - Endoscopy procedure Study observation OMOP:3020265 - IgG.equine [Mass/volume] in Colostrum by Immune diffusion (ID) OMOP:3020288 - Chlamydophila psittaci Ab [Presence] in Serum by Agglutination OMOP:3020557 - Gastrostomy tube site OMOP:3020598 - Medication risk [CCC] OMOP:3020631 - Transfuse cryoprecipitate poor plasma [Volume] OMOP:3020662 - History of Ear disorders OMOP:3020729 - cycloSPORINE [Mass/volume] in Blood --12 hours post dose OMOP:3020770 - Neomycin [Mass/volume] in Serum or Plasma OMOP:3020771 - Prolactin [Mass/volume] in Serum or Plasma --9th specimen post XXX challenge OMOP:3020856 - Legionella pneumophila 6 IgM Ab [Titer] in Serum OMOP:3020923 - Manganese [Mass/volume] in Blood OMOP:3021281 - Want to die at home [Living with HIV] OMOP:3021350 - Disorientation [HIV-SSC] OMOP:3021498 - ePHEDrine+Pseudoephedrine [Presence] in Specimen OMOP:3021519 - Perimeter format Humphrey OMOP:3021677 - Adipate/Creatinine [Mass Ratio] in Urine OMOP:3021825 - 1,4-Dioxane [Mass/volume] in Serum or Plasma OMOP:3021888 - Direct antiglobulin test.IgG specific reagent [Interpretation] on Red Blood Cells OMOP:3022024 - Gamma globulin [Presence] in 24 hour Urine OMOP:3022407 - Monocytes/100 leukocytes in Blood by Manual count OMOP:3022425 - Cortisol [Mass/volume] in Serum or Plasma --24 hours post 40 ug corticotropin IM BID 3 day OMOP:3022437 - Tube or drain Institution inventory number OMOP:3022449 - Lipoprotein.alpha [Mass/volume] in Body fluid OMOP:3022479 - Clavulanate [Mass] of Dose OMOP:3022588 - Calf - left Maximum circumference OMOP:3022648 - Aquacobalamin [Mass/volume] in Serum or Plasma OMOP:3022768 - Borate [Mass/volume] in Serum or Plasma OMOP:3022889 - Bacteria # 6 identified in Peritoneal fluid by Culture OMOP:3022924 - C little e Ab [Presence] in Serum or Plasma OMOP:3023180 - R wave amplitude in lead AVL OMOP:3023202 - Hepatitis B virus e Ab [Units/volume] in Serum by Immunoassay OMOP:3023330 - Medication current Set OMOP:30234 - Neck sprain OMOP:3023554 - Nairobi sheep disease virus Ag [Presence] in Specimen by Immunoassay OMOP:3023728 - Catalase [Enzymatic activity/volume] in Red Blood Cells OMOP:3023734 - Propafenone [Mass/volume] in Serum or Plasma OMOP:3023755 - Aldrin [Mass/volume] in Blood OMOP:3023761 - Cowdria ruminantium DNA [Presence] in Specimen by NAA with probe detection OMOP:3023786 - Choriogonadotropin.alpha subunit [Moles/volume] in Serum or Plasma OMOP:3023929 - Glycine [Moles/volume] in Cerebral spinal fluid OMOP:3023997 - Hepatitis A virus Ab [Units/volume] in Serum by Radioimmunoassay (RIA) OMOP:3024173 - Equine arteritis virus Ab [Presence] in Serum by Immunofluorescence OMOP:3024226 - Microscopic observation [Identifier] in Specimen by Other stain OMOP:3024239 - Lumpy skin disease virus neutralizing antibody [Presence] in Serum by Neutralization test OMOP:3024315 - Atenolol [Mass/volume] in Urine OMOP:3024427 - Cannabinoids [Presence] in Unknown substance by Screen method OMOP:3024514 - Metaldehyde [Mass/volume] in Specimen OMOP:3024516 - IgM.monoclonal [Mass/volume] in Serum OMOP:3024541 - Coxsackievirus B3 Ab [Titer] in Body fluid OMOP:3024630 - Xanthine [Mass/volume] in Urine OMOP:3024631 - Physical findings of Auditory canal OMOP:3024730 - CD66c cells/100 cells in Blood OMOP:3024836 - Epstein Barr virus capsid IgG and IgM panel - Serum OMOP:3024844 - Ethylamphetamine [Mass/volume] in Urine by Confirmatory method OMOP:3024901 - Mycobacterium sp identified in Bronchial specimen by Organism specific culture OMOP:3025233 - Bacteria identified in Sputum by Aerobe culture OMOP:3025259 - Enteral tube site OMOP:3025284 - Ambulance transport, Distance transported Length OMOP:3025370 - Medication prescribed OMOP:3025428 - Microscopic observation [Identifier] in Cerebral spinal fluid OMOP:3025466 - Phosphatidylserine IgG Ab [Units/volume] in Serum by Immunoassay OMOP:3025471 - Chlamydia sp IgM Ab [Titer] in Serum OMOP:3025544 - Left eye Exopthalmia comment [Interpretation] Exopthalmometer.Hertel OMOP:3025560 - Functional residual capacity OMOP:3025568 - Speech And Language Behavior [OMAHA] OMOP:3025631 - Biotinidase [Enzymatic activity/volume] in Serum or Plasma OMOP:3025801 - Terfenadine [Mass/volume] in Serum or Plasma OMOP:3025816 - Piroxicam [Mass/volume] in Serum or Plasma OMOP:3025858 - Dialysis records OMOP:3025886 - Oxalate [Mass/time] in 24 hour Urine OMOP:3025905 - Safflower IgG Ab [Units/volume] in Serum OMOP:3026033 - Streptococcus pneumoniae Danish serotype 7F Ab [Units/volume] in Serum --1st specimen OMOP:3026363 - LORazepam [Mass/volume] in Urine OMOP:3026640 - FEV 25%-75% post bronchodilation measured/predicted OMOP:3026813 - Cannabinoids [Mass/volume] in Unknown substance OMOP:3026916 - Bronchoscopy study OMOP:3027083 - Doxepin [Presence] in Gastric fluid OMOP:3027086 - Cortisol [Mass/volume] in Serum or Plasma --8 hours post 500 ug dexamethasone PO 2.5 day low dose q6h OMOP:3027097 - Benzodiazepines [Presence] in Meconium by Screen method OMOP:3027232 - Diffusion capacity/Alveolar volume OMOP:3027238 - Thyroperoxidase Ab [Units/volume] in Serum or Plasma OMOP:3027281 - N-desalkylflurazepam [Presence] in Urine by Confirmatory method OMOP:3027470 - Coxiella burnetii phase 1 IgA Ab [Units/volume] in Serum OMOP:3027490 - Lormetazepam [Mass/volume] in Urine OMOP:3027536 - Estrone sulfate [Mass/volume] in Serum or Plasma OMOP:3027549 - Eosinophils/100 leukocytes in Stool by Manual count OMOP:3027558 - diphenhydrAMINE [Mass] of Dose OMOP:3027632 - Fetal Face Study observation US OMOP:3027751 - Green Ash IgE Ab [Units/volume] in Serum OMOP:3027767 - Walleye Pike IgE Ab [Units/volume] in Serum OMOP:3027792 - Transducer site Narrative OMOP:3027834 - Insulin [Units/volume] in Serum or Plasma --4 hours post XXX challenge OMOP:3027839 - Chromosome 8 trisomy [Presence] in Blood or Tissue by Cytogenetics OMOP:3027857 - Right ventricular Stroke volume by US.doppler OMOP:3028139 - Guanosine monophosphate.cyclic [Mass/volume] in Serum or Plasma OMOP:3028173 - Coagulation factor IX Ag [Units/volume] in Platelet poor plasma by Immunoassay OMOP:3028310 - Haemophilus influenzae Ab [Units/volume] in Serum by Immunoassay OMOP:3028375 - DBG Ab [Presence] in Serum or Plasma from Donor OMOP:3028411 - Cryoglobulin [Presence] in Serum by 3 day cold incubation OMOP:3028481 - Leucine/Creatinine [Ratio] in Urine OMOP:3028545 - Fluconazole [Susceptibility] by Gradient strip OMOP:3028722 - HLA-B44(12) [Presence] OMOP:3028773 - Eyes Binocular status code OMOP:3028918 - Neisseria gonorrhoeae rRNA [Presence] in Conjunctival specimen by Probe OMOP:3028995 - CD14 Ag [Presence] in Tissue by Immune stain OMOP:3029032 - BK virus DNA [#/volume] (viral load) in Bone marrow by NAA with probe detection OMOP:3029064 - Salmonella paratyphi C H Ab [Titer] in Serum OMOP:3029159 - Venous + Lymphatic small vessel invasion in Specimen by CAP cancer protocols OMOP:3029260 - 3-Hydroxyisovalerylcarnitine (C5-OH) [Moles/volume] in Cerebral spinal fluid OMOP:3029354 - CD11a blasts/100 blasts in Specimen OMOP:3029431 - Calcium.ionized [Moles/volume] in Body fluid OMOP:3029558 - Tetradecanedioate/Creatinine [Mass Ratio] in Urine OMOP:3029654 - 11-Deoxycortisol [Mass/volume] in Serum or Plasma --6th specimen post XXX challenge OMOP:3029680 - Hepatitis E virus Ab [Units/volume] in Serum OMOP:3029834 - Hemicystine/Amino acids.total in DBS OMOP:3029991 - Specific gravity of Urine by Refractometry automated OMOP:3030002 - CD3+CD56+ cells/100 cells in Tissue OMOP:3030027 - Platelet aggregation ristocetin induced in Platelet rich plasma --900 ug/mL OMOP:3030065 - Gestational age estimated from Crown rump length on US by Tokyo 1986 method OMOP:3030091 - pH of Blood adjusted to patient's actual temperature OMOP:3030097 - Arbovirus neutralizing antibody [Identifier] in Specimen by Neutralization test OMOP:3030117 - Leukemia markers [Interpretation] in Pleural fluid Narrative OMOP:3030140 - KCNQ2 gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3030157 - CD56+CD57+ cells/100 cells in Blood OMOP:3030192 - CD123 blasts [Units/volume] in Blood OMOP:3030261 - Antimony [Moles/volume] in Urine OMOP:3030540 - Arsenic organic [Moles/volume] in Urine OMOP:3030629 - Fungi.filamentous [Presence] in Urine by Computer assisted method OMOP:3030644 - Segmented neutrophils/100 leukocytes in Pericardial fluid OMOP:3030697 - Date of entry OMOP:3030785 - Treponema pallidum Ab [Units/volume] in Cerebral spinal fluid OMOP:3030860 - Tumor necrosis factor.alpha [Moles/volume] in Serum or Plasma OMOP:3031117 - Discharge functional status (narrative) OMOP:3031137 - DMPK gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3031159 - Ultrasound date OMOP:3031386 - Hemoglobin.gastrointestinal [Presence] in Gastric fluid --3rd specimen OMOP:3031420 - Contributing Factor environment MERSTH OMOP:3031570 - Lead screen test status and/or results Set CPHS OMOP:3031593 - Food Allergen Mix 30 (Peanut+White bean+Soybean+Lentil+ Peas) IgE Ab [Units/volume] in Serum by Multidisk OMOP:3031604 - Parathyrin.intact [Mass/volume] in Serum or Plasma --3rd specimen OMOP:3031694 - Follow-up (referred to) provider /specialist, catchment location indicator CPHS OMOP:3031698 - Neuronal nuclear type 1 Ab [Presence] in Serum by Immunoblot OMOP:3031701 - CCND1 gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3031740 - Threoamino alcohol [Mass/volume] in Serum or Plasma OMOP:3031748 - Cortisol Free [Mass/volume] in 24 hour Urine by HPLC OMOP:3031978 - Hospital sequence number and diagnostic confirmation override flag Cancer case OMOP:3032017 - Streptococcus pneumoniae Danish serotype 19B IgG Ab [Mass/volume] in Serum OMOP:3032140 - Silica [Mass/volume] in Water OMOP:3032184 - Alloisoleucine [Moles/volume] in Amniotic fluid OMOP:3032222 - Lymphocyte proliferation stimulated by 100 umol beryllium [Ratio] in Blood --7 day post incubation OMOP:3032244 - Sulbactam [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:3032267 - Blood pressure device Vendor software version OMOP:3032300 - Heart rate 8 hour mean OMOP:3032310 - Hip - right External rotation Active Range of Motion Quantitative OMOP:3032312 - Derived SEER summary stage 1977 Cancer OMOP:3032352 - Blasts [#/volume] in Cerebral spinal fluid OMOP:3032475 - Influenza virus A RNA [Presence] in Isolate by NAA with probe detection OMOP:3032484 - Alloisoleucine [Moles/volume] in Body fluid OMOP:3032494 - Renin [Enzymatic activity/volume] in Plasma --3 hours post XXX challenge OMOP:3032496 - First and Second trimester integrated maternal screen [Interpretation] OMOP:3032604 - Fetal lung maturity in Amniotic fluid OMOP:3032650 - Collection time of Gastric fluid OMOP:3032882 - Unidentified cells/100 leukocytes in Peritoneal fluid OMOP:3032914 - Acyclovir [Mass/volume] in Serum or Plasma --peak OMOP:3033112 - Echovirus 9 Ab [Titer] in Body fluid OMOP:3033316 - MethylePHEDrine [Mass/volume] in Urine by Confirmatory method OMOP:3033401 - Cannabinoids [Mass/volume] in Urine OMOP:3033413 - Collection date of Stool OMOP:3033432 - Collection date of Body fluid OMOP:3033475 - Ganglioside GD1b IgG Ab [Units/volume] in Serum OMOP:3033675 - HLA-Cw8 [Presence] OMOP:3033825 - Phosphatidylethanolamine IgA Ab [Presence] in Serum OMOP:3033923 - Metanephrine [Moles/time] in 24 hour Urine OMOP:3033993 - CD4+CD28+ cells [#/volume] in Blood OMOP:3034065 - Myeloid cells/100 cells in Blood OMOP:3034146 - Nordiazepam [Mass/volume] in Stool OMOP:3034391 - Rosoxacin [Susceptibility] by Serum bactericidal titer OMOP:3034432 - CD3-CD16+CD56+ (Natural killer) cells/100 cells in Specimen OMOP:3034450 - Urea nitrogen [Mass/volume] in Cerebral spinal fluid OMOP:3034529 - Somatotropin Ab [Units/volume] in Serum or Plasma by Radioimmunoassay (RIA) OMOP:3034548 - Prostate specific Ag [Mass/volume] in Serum or Plasma by Detection limit <= 0.01 ng/mL OMOP:3034596 - Sugar Cane IgG Ab [Mass/volume] in Serum OMOP:3034854 - Basophils/100 leukocytes in Amniotic fluid by Manual count OMOP:3034958 - Type of Insulin delivery device OMOP:3034990 - Succinylacetone [Molar amount] in DBS OMOP:3035085 - Serotonin [Moles/volume] in Plasma OMOP:3035104 - HLA-Dw12 [Presence] in Donor OMOP:3035111 - Referred to support services Cancer OMOP:3035188 - Hydrazine/Creatinine [Mass Ratio] in Urine OMOP:3035216 - Antidepressants [Identifier] in Gastric fluid OMOP:3035421 - Pentazocine [Presence] in Serum or Plasma OMOP:3035426 - Pain Knowledge Family [OMAHA] OMOP:3035495 - CATCH22 syndrome gene mutations tested for in Blood or Tissue by Molecular genetics method Nominal OMOP:3035527 - CD5 cells/100 cells in Bone marrow OMOP:30356 - Benign neoplasm of pharynx OMOP:3035830 - Cefditoren [Susceptibility] OMOP:3035911 - Left ventricular Stroke volume by US.cubed.calculated OMOP:3036022 - Legionella pneumophila Ab [Titer] in Serum --2nd specimen OMOP:3036129 - Chlamydia sp rRNA [Presence] in Throat by Probe OMOP:3036223 - Unstable Hemoglobin [Presence] in Red Blood Cells OMOP:3036244 - Gonadotropin releasing hormone [Mass] of Dose OMOP:3036283 - Glucose [Mass/volume] in Serum or Plasma --10th specimen post XXX challenge OMOP:3036364 - Cricket IgE Ab [Units/volume] in Serum OMOP:3036460 - Dorsal pedal artery - left Mean blood pressure OMOP:3036507 - Stay at home and receive treatment [Living with HIV] OMOP:3036539 - Specific gravity of Synovial fluid OMOP:3036620 - Echovirus+Coxsackievirus IgA Ab [Presence] in Serum by Immunoassay OMOP:3036759 - Glasses Physician [Identifier] OMOP:3036820 - Lymecycline [Susceptibility] OMOP:3036905 - Food Allergen Mix 14 (Cabbage+Paprika+Tomato+Spinach) IgE Ab [Presence] in Serum by Multidisk OMOP:3036921 - Cortisol Free/Creatinine [Molar ratio] in 24 hour Urine OMOP:3037036 - Eastern equine encephalitis virus IgG and IgM panel - Specimen OMOP:3037070 - Cryocrit of Serum by Spun Westergren OMOP:3037125 - Brucella melitensis Ab [Units/volume] in Serum OMOP:3037179 - Right corrective lens Sphere far by Lensmeter OMOP:3037264 - Fetal Tricuspid valve Narrative Study observation US OMOP:3037341 - Varicella zoster virus DNA [Presence] in Eye by NAA with probe detection OMOP:3037347 - Friction and shear Braden scale OMOP:3037414 - Neisseria meningitidis serogroups A+C+w135+Y Ag [Presence] in Cerebral spinal fluid by Latex agglutination OMOP:3037478 - Sodium/Potassium [Molar ratio] in Urine OMOP:3037502 - Monophosphoglyceromutase [Enzymatic activity/volume] in Red Blood Cells OMOP:3037532 - History source OMOP:3037597 - Macroamylase [Enzymatic activity/volume] in Serum or Plasma OMOP:3037613 - Number of tumors at diagnosis Cancer OMOP:3037721 - HLA-A25(10) [Presence] OMOP:3037732 - Ehrlichia chaffeensis IgM Ab [Presence] in Serum OMOP:3037733 - Heterophile Ab after absorption [Titer] in Serum by Latex agglutination OMOP:3037737 - Pain Behavior [OMAHA] OMOP:3037756 - Immunofixation for Serum or Plasma OMOP:3037774 - Prostate specific Ag [Units/volume] in Semen OMOP:3037784 - Mycoplasma capricolum ss capripneumonia Ab [Titer] in Serum OMOP:3037840 - Insulin [Moles/volume] in Serum or Plasma --2nd specimen post XXX challenge OMOP:3037865 - Lactobacillus sp IgG Ab [Units/volume] in Serum OMOP:3037877 - Splenic artery Systolic blood pressure OMOP:3038082 - Protoporphyrin.zinc [Presence] in Blood OMOP:3038093 - Ovine progressive pneumonia virus Ag [Presence] in Specimen by Immunofluorescence OMOP:3038270 - Patient drug or alcohol use CPHS OMOP:3038440 - Methotrimeprazine [Presence] in Serum or Plasma OMOP:3038458 - Plasmodium sp [Presence] in Blood by Light microscopy OMOP:3038474 - 17-Hydroxyprogesterone [Mass/volume] in Serum or Plasma --7th specimen post XXX challenge OMOP:3038540 - Histiocytes/100 cells in Pericardial fluid by Manual count OMOP:3038646 - Erythrocytes [#/volume] in Dialysis fluid by Manual count OMOP:3038674 - Thyroid transcription factor 1 Ag [Presence] in Tissue by Immune stain OMOP:3038784 - Granulocytes [#/volume] in Blood by Manual count OMOP:3039063 - Kynurenate [Moles/volume] in Urine OMOP:3039114 - Acanthocytes/1000 erythrocytes in Blood by Light microscopy OMOP:3039268 - Whitefaced Hornet IgG4 Ab [Presence] in Serum OMOP:3039326 - INR in Platelet poor plasma by Coagulation assay --post heparin neutralization OMOP:3039379 - Sucrose [Presence] in Urine OMOP:3039439 - Glucose [Moles/volume] in Serum or Plasma --pre dose betaxolol OMOP:3039839 - Creatinine [Moles/volume] in Serum or Plasma --45 minutes post XXX challenge OMOP:3039998 - Platelet aggregation arachidonate induced [Units/volume] in Blood OMOP:3040119 - Osmotic fragility of Red Blood Cells--Incubated OMOP:3040159 - Home health prior authorization OMOP:3040164 - Occupational therapy treatment plan, Responsible attending physicican information Set OMOP:3040276 - Fibroblast growth factor 23.intact [Mass/volume] in Plasma by Immunoassay --5th specimen post XXX challenge OMOP:3040286 - Dodeicosanoylcarnitine (C22) [Moles/volume] in Serum or Plasma OMOP:3040300 - Ehrlichia chaffeensis Ag [Presence] in Tissue by Immune stain OMOP:3040332 - Fetal Nasal bone diaphysis [Length] US OMOP:3040478 - Histiocytes [Presence] in Urine sediment by Light microscopy OMOP:3040535 - Dicarboxytetradecenoylcarnitine (C14:1-DC) [Moles/volume] in DBS OMOP:3040569 - Creatinine [Moles/volume] in Serum or Plasma --8 hours post XXX challenge OMOP:3040632 - Protoporphyrin [Moles/volume] in Red Blood Cells OMOP:3040783 - Silver [Moles/volume] in Red Blood Cells OMOP:3040819 - Total population of age 15-19 years Population OMOP:3040878 - Heptacarboxylate [Moles/time] in 24 hour Urine OMOP:3040956 - State catchment area Population [Estimated] OMOP:3040996 - Alternaria sp IgG Ab [Presence] in Serum OMOP:3041068 - Arsenic.inorganic/Creatinine [Molar ratio] in Urine OMOP:3041094 - Leptospira sp DNA [Presence] in Blood by NAA with probe detection OMOP:3041144 - Somatotropin [Mass/volume] in Serum or Plasma --pre or post dose glucose OMOP:3041150 - Cardiac screen results indicator CPHS OMOP:3041230 - Basic metabolic panel - Blood OMOP:3041252 - 17-Hydroxypregnenolone [Mass/volume] in Serum or Plasma --6th specimen post XXX challenge OMOP:3041326 - CD3+CD4+ (T4 helper) cells/CD3+CD8+ (T8 suppressor cells) cells [# Ratio] in Tissue OMOP:3041367 - Phenylacetylcarnitine (PheC2) [Moles/volume] in DBS OMOP:3041730 - Aromatic solvents [Identifier] in Serum or Plasma OMOP:3041781 - Chlamydia trachomatis L2 IgA Ab [Titer] in Serum OMOP:3041783 - West Nile virus Ab [Titer] in Cerebral spinal fluid OMOP:3041933 - Crystals unspecified [#/area] in Urine by Computer assisted method OMOP:3042106 - Support surface attachment OMOP:3042218 - World catchment area Population [Estimated] OMOP:3042242 - Collection method - Specimen OMOP:3042280 - Decanoylcarnitine (C10)/Creatinine [Molar ratio] in Urine OMOP:3042299 - inFLIXimab [Mass/volume] in Serum or Plasma OMOP:3042334 - Histoplasma capsulatum Ab [Presence] in Body fluid OMOP:3042496 - 11-Oxo-Etiocholanolone [Mass/time] in 24 hour Urine OMOP:3042533 - RPS6KA3 gene mutations tier 1 found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3042619 - Brucella sp Ab [Presence] in Serum by Complement fixation OMOP:3042717 - Mercaptopurine [Presence] in Blood OMOP:3042793 - Prostate specific Ag.protein bound [Mass/volume] in Serum or Plasma OMOP:3042849 - Neuronal nuclear IgG Ab [Units/volume] in Cerebral spinal fluid OMOP:3042860 - Previous dental surgery OMOP:3042896 - Prostatic acid phosphatase [Presence] in Serum OMOP:3042956 - Biliary anastomosis procedure OMOP:3042957 - CD19+CD27+IgD+ cells/100 cells in Blood or Tissue OMOP:3043023 - Basophils [Presence] in Cerebral spinal fluid by Light microscopy OMOP:3043051 - ADL-rehabilitation trigger B [Minimum Data Set] OMOP:3043103 - Legionella pneumophila atypical Ab [Titer] in Serum OMOP:3043155 - Lymphatic.small vessel.invasion [Identifier] in Specimen by CAP cancer protocols OMOP:3043226 - Cyanide [Mass/volume] in Blood by Confirmatory method OMOP:3043228 - Chlamydia sp Ag [Presence] in Body fluid by Immunofluorescence OMOP:3043314 - HTLV I+II p19 Ab [Presence] in Serum OMOP:3043334 - Participation in assessment [Minimum Data Set] OMOP:3043414 - Insulin-like growth factor binding protein 3 [Moles/volume] in Serum or Plasma OMOP:3043468 - Neutrophil oxidative burst/unstimulated in Blood OMOP:3043584 - Herpes simplex virus 2 Ab [Presence] in Body fluid OMOP:3043610 - Avian adenovirus 127 Ab [Titer] in Serum by Hemagglutination inhibition OMOP:3043667 - Burr cells [#/volume] in Cerebral spinal fluid by Manual count OMOP:3043692 - Chromate [Mass/volume] in Urine OMOP:3043700 - Fetal Abdomen Diameter product estimated from gestational age by method of Shinozuka 1996 (US) OMOP:3043827 - Bed rails used for bed mobility or transfer [Minimum Data Set] OMOP:3044088 - Pentacarboxylate [Moles/mass] in Stool OMOP:3044104 - Making self understood [Minimum Data Set] OMOP:3044282 - Cell count and Differential panel - Pleural fluid OMOP:3044299 - Beta glucuronidase [Enzymatic activity/volume] in Specimen OMOP:3044312 - Chloride/Creatinine [Molar ratio] in Urine OMOP:3044328 - Cladosporium sp IgG Ab [Presence] in Serum by Immune diffusion (ID) OMOP:3044494 - Resident assessment protocol 14--Dehydration/Fluid maint - triggered [Minimum Data Set] OMOP:3044521 - Protection of Skin OMOP:3044561 - Influenza virus A N1 neutralizing antibody [Presence] in Serum by Neutralization test OMOP:3044666 - Number hospital admissions in last 90 days [Minimum Data Set] OMOP:3044711 - U2 small nuclear ribonucleoprotein IgG Ab [Presence] in Serum OMOP:3044760 - Emphysema or COPD [Minimum Data Set] OMOP:3044789 - Psychotropic drug use trigger [Minimum Data Set] OMOP:3044803 - Bolasterone [Presence] in Specimen OMOP:3044976 - Primary reason for assessment [Minimum Data Set (MDS) basic] OMOP:3044985 - Bacteria producing oxidase [Presence] in Isolate OMOP:3045052 - Personal hygiene - support provided during assessment period [CMS Assessment] OMOP:3045084 - Bowel elimination pattern (quarterly) Set OMOP:3045121 - Protein [Mass/volume] in Pericardial fluid OMOP:3045247 - Date dropped from HIV treatment OMOP:3045250 - Depression [Minimum Data Set] OMOP:3045366 - Other cardiovascular disease [Minimum Data Set] OMOP:3045434 - Bordetella pertussis.pertussis toxin IgG Ab [Mass/volume] in Serum OMOP:3045595 - Perceived difficulty in last 2 weeks [Reported.PHQ] OMOP:3045619 - Alterability of verbally abusive behavioral symptoms [Minimum Data Set] OMOP:3045644 - Number of days physician orders changed in last 14 days [Minimum Data Set] OMOP:3045950 - Second or third degree burns [Minimum Data Set] OMOP:3046089 - Finds strength in faith [Minimum Data Set] OMOP:3046106 - Arteriosclerotic heart disease [Minimum Data Set] OMOP:3046217 - Chlamydia trachomatis Ab [Units/volume] in Serum by Immunoassay OMOP:3046239 - Conditions/diseases make resident's cognitive, ADL, mood or behavior patterns unstable [Minimum Data Set] OMOP:3046379 - None of the listed cycle of daily events [Minimum Data Set] OMOP:3046426 - Aquaporin 4 water channel IgG Ab [Presence] in Serum or Plasma OMOP:3046433 - Herpes simplex virus 1 [Presence] in Cervix by Organism specific culture OMOP:3046587 - Herpes simplex virus 2 IgG Ab [Ratio] in Serum by Immunoassay --1st specimen/2nd specimen OMOP:3046634 - Past roles - none of above [Minimum Data Set] OMOP:3046638 - New medications [Minimum Data Set] OMOP:3046639 - Isoleucine+Leucine [Moles/volume] in DBS OMOP:3046731 - Epithelial cells.squamous [#/area] in Urine sediment by Microscopy low power field OMOP:3046736 - Lymphocyte proliferation stimulated by 0.50 ug pokeweed mitogen in Blood OMOP:3046948 - Albumin/Globulin [Mass Ratio] in Serum or Plasma by Electrophoresis OMOP:3046968 - Mental health history [Minimum Data Set] OMOP:3047036 - Modes of expression - none of above [Minimum Data Set] OMOP:3047067 - PHOX2B gene targeted mutation analysis in Blood or Tissue by Molecular genetics method OMOP:3047096 - Proportion of total calories received through parenteral or tube feeding in last 7 days [Minimum Data Set] OMOP:3047229 - 5,10-Methylenetetrahydrofolate reductase [Presence] in Serum OMOP:3047262 - Basophilic stippling fine [Presence] in Blood by Light microscopy OMOP:3047315 - Pathological bone fracture [Minimum Data Set] OMOP:3047463 - Triethylamine [Mass/volume] in Air OMOP:3048397 - Sexuality Status Community [OMAHA] OMOP:3048424 - When urinary incontinence occurs [OASIS] OMOP:3048447 - Inpatient stay within last 14 days - ICD code # 2 [OASIS] OMOP:3048451 - Adenosine monophosphate.cyclic/Creatinine [Ratio] in Urine --6th specimen post XXX challenge OMOP:3048493 - Zinc [Molar amount] in unspecified time Semen OMOP:3048494 - 2-Methylglutarate/Creatinine [Molar ratio] in Urine OMOP:3048630 - Crystals [type] in Amniotic fluid by Light microscopy OMOP:3048779 - Legionella pneumophila 11 IgM Ab [Titer] in Serum OMOP:3048882 - Streptococcus agalactiae DNA [Presence] in Specimen by NAA with probe detection OMOP:3048913 - Bartonella quintana IgM Ab [Titer] in Body fluid OMOP:3049098 - Performs activities within a schedule, maintains regular attendance, is punctual within customary tolerances [RFC] OMOP:3049130 - Are you in good spirits most of the time [GDS] OMOP:3049156 - Do you prefer to stay at home, rather than going out and doing new things [GDS] OMOP:3049159 - Leishmania tropica IgG Ab [Titer] in Serum by Immunofluorescence OMOP:3049266 - Spermatozoa Progressive Grade 1/100 spermatozoa in Semen OMOP:3049288 - Acetylene [Mass/volume] in Air OMOP:3049748 - THRB gene mutations found [Identifier] in Blood or Tissue by Molecular genetics method Nominal OMOP:3049808 - Urea [Moles/volume] in Stool OMOP:3050035 - Medication Regimen Knowledge Community [OMAHA] OMOP:3050040 - Carries out very short and simple instructions [RFC] OMOP:3050454 - Eastern equine encephalitis virus IgG and IgM [Interpretation] in Cerebral spinal fluid OMOP:3050705 - Propoxyphene + Norpropoxyphene [Mass/volume] in Serum or Plasma by Confirmatory method OMOP:3050725 - Nuclear Ab pattern [Interpretation] in Serum Narrative OMOP:3050737 - Orientia tsutsugamushi Gilliam IgM Ab [Titer] in Body fluid OMOP:3050921 - Beta globulin.abnormal band/Protein.total in Serum or Plasma by Electrophoresis OMOP:3051005 - Cognitive functioning during assessment period [CMS Assessment] OMOP:3051052 - Adenosine deaminase [Entitic Catalytic Activity] in Leukocytes OMOP:3051085 - Somatotropin [Units/volume] in Serum or Plasma --2 hours post dose insulin IV OMOP:3051297 - Communicable/infectious condition function.status Community [OMAHA] OMOP:3051326 - Unobserved pressure injury [OASIS] OMOP:3051591 - Sleep And Rest Pattern Knowledge Community [OMAHA] OMOP:3051656 - Personal Care Behavior Community [OMAHA] OMOP:3051670 - Understands and remembers very short and simple instructions [RFC] OMOP:3051681 - Anaplastic lymphoma kinase Ag [Presence] in Tissue by Immune stain OMOP:3051731 - Lysine/Amino acids.total in Hair OMOP:3051921 - Influenza virus A H5 Ab [Titer] in Serum OMOP:3051933 - Reproductive Function Status Community [OMAHA] OMOP:3052012 - Threonine/Amino acids.total in Hair OMOP:3052040 - Somatotropin [Units/volume] in Serum or Plasma --pre dose glucagon OMOP:3052061 - Genechip ID [Identifier] in Blood or Tissue by Molecular genetics method OMOP:3052247 - Postpartum Function Knowledge Community [OMAHA] OMOP:3052371 - DNA sequence variation display name [Text] Narrative OMOP:3052377 - Pork triggered leukotriene release [Mass/volume] by Leukocytes OMOP:3052553 - Neuro-musculo-skeletal Function Knowledge Community [OMAHA] OMOP:3052675 - Patent blue V triggered leukotriene release [Mass/volume] by Leukocytes OMOP:3052848 - Adenosine monophosphate.cyclic [Moles/volume] in Urine --2nd specimen post XXX challenge OMOP:3052852 - Budesonide [Mass/volume] in Urine OMOP:3052936 - Often feel depressed OMOP:3052959 - Is it easy for you to make decisions [GDS] OMOP:3052963 - Orientia tsutsugamushi Kato IgM Ab [Titer] in Body fluid OMOP:3053225 - Giardia lamblia+Cryptosporidium sp Ag [Presence] in Stool by Immunofluorescence OMOP:312723 - Congenital heart disease OMOP:31339 - Dental restoration esthetically inadequate or displeasing OMOP:31602 - Disorder of the larynx OMOP:316139 - Heart failure OMOP:316427 - Aneurysm of coronary vessels OMOP:316866 - Hypertensive disorder OMOP:316998 - Left bundle branch block OMOP:317296 - Rheumatic disease of pulmonary valve OMOP:317895 - Renovascular hypertension OMOP:318169 - Varicose veins of lower extremity OMOP:318437 - Malignant secondary hypertension OMOP:31967 - Nausea OMOP:319967 - Injury of deep plantar blood vessel OMOP:320025 - Syphilitic pericarditis OMOP:320206 - Congenital atresia of pulmonary valve OMOP:35607956 - Hypotrichosis, osteolysis, periodontitis, palmoplantar keratoderma syndrome OMOP:35608063 - Mosaic trisomy 2 syndrome OMOP:35608068 - Mosaic trisomy 4 syndrome OMOP:35608091 - Autosomal recessive spastic paraplegia type 43 OMOP:35608119 - Autosomal recessive spastic paraplegia type 62 OMOP:35608126 - Sexual arousal by exposure of genitals to non-consenting prepubertal and postpubertal person OMOP:35609088 - Emergency hospital admission to paediatric transplantation surgery service OMOP:35609111 - Emergency hospital admission to psychiatric intensive care service OMOP:35609192 - Place of occurrence of injury is police premises OMOP:35609194 - Place of occurrence of injury is cinema OMOP:35609211 - Difficulty communicating request for help OMOP:35609417 - Swindon Foot and Ankle Questionnaire OMOP:35609509 - Treatment Escalation Plan decision - appropriate for intravenous fluids OMOP:35609531 - Learning disability annual health check invitation SMS (short message service) text message OMOP:35609835 - Event-based HIV-PrEP (human immunodeficiency virus pre-exposure prophylaxis) commenced OMOP:35609877 - Disposition target time interval OMOP:35609950 - Level of reduction in systolic blood pressure on standing OMOP:35610093 - Acute transmural myocardial infarction OMOP:35610125 - Moderate intellectual development disorder with impairment of behaviour OMOP:35610239 - Malignant neoplasm of bronchus or lung OMOP:35610368 - Care Programme Approach care worker OMOP:35610555 - Child developmental skill observable OMOP:35610573 - Recurrent incisional hernia of anterior abdominal wall with fascial defect 4-10 cm with gangrene OMOP:35610607 - Recurrent femoral hernia with intestinal obstruction OMOP:35610790 - 19p13.13 microdeletion syndrome OMOP:35611569 - Bilateral acute thrombosis of superficial vein of upper limbs OMOP:35614921 - Congenital absence of right hemidiaphragm OMOP:35615026 - Aneurysm of artery of right upper limb OMOP:35615047 - Congenital deformity of right clavicle OMOP:35615107 - Occlusion of left popliteal artery OMOP:35615110 - Bilateral chronic rupture of anterior cruciate ligament of knees OMOP:35621813 - Autosomal dominant spastic paraplegia type 41 OMOP:35621877 - Gordonia iterans OMOP:35621887 - Chryseobacterium arachidis OMOP:35621976 - Distal trisomy 8q OMOP:35622004 - Adrenomyodystrophy OMOP:35622033 - Charcot-Marie-Tooth disease type 4B3 OMOP:35622053 - Familial progressive hyper and hypopigmentation OMOP:35622061 - Autosomal recessive spastic paraplegia type 28 OMOP:35622073 - Streptococcus pneumoniae Danish serotype 6F OMOP:35622173 - Familial nasal acilia OMOP:35622250 - Wiedemann Steiner syndrome OMOP:35622344 - KLHL9-related early-onset distal myopathy OMOP:35622368 - Orgasm induced epilepsy OMOP:35622395 - Radiation myelitis OMOP:35622410 - Myosclerosis OMOP:35622507 - Compression of cauda equina due to lumbar vertebral stenosis OMOP:35622508 - Stenosis of lumbar vertebral foramen OMOP:35622629 - Yttrium (90-Y) labeled microspheres OMOP:35622710 - Operative procedure canceled after time of induction of anesthesia OMOP:35622748 - Normal lower limb movement and sensation and circulation OMOP:35622767 - Bourbon virus OMOP:35622801 - Myopathy with hexagonally cross-linked tubular arrays OMOP:35622928 - Telephone scatologia OMOP:35622973 - Disorder in full remission in response to treatment OMOP:35623011 - Male infertility with oligozoospermia due to single gene mutation OMOP:35623148 - Vomiting co-occurrent and due to infectious disease OMOP:35623149 - Bone xanthoma OMOP:35623151 - Ring chromosome 19 syndrome OMOP:35623631 - Acute myeloid leukemia and myelodysplastic syndrome related to topoisomerase type 2 inhibitor OMOP:35623639 - Adverse reaction to adrenochrome OMOP:35624122 - Isolated focal cortical dysplasia OMOP:35624125 - Monosomy 13q34 syndrome OMOP:35624152 - Neurolymphomatosis OMOP:35624167 - Autosomal recessive spastic paraplegia type 67 OMOP:35624198 - Trichodysplasia xeroderma syndrome OMOP:35624200 - Autosomal recessive cerebellar ataxia with saccadic intrusion syndrome OMOP:35624269 - Generalized basaloid follicular hamartoma syndrome OMOP:35624272 - Hypothalamic hamartoma with gelastic seizure OMOP:35624305 - Human rhinovirus Ag OMOP:35624320 - Acute adrenal insufficiency OMOP:35624392 - Progesterone receptor antagonist OMOP:35624431 - Abduction deformity OMOP:35624460 - Displacement of indwelling urinary catheter balloon into urethra due to and following insertion of urethral catheter OMOP:35624482 - Protrusive upper lip OMOP:35624653 - Autosomal recessive congenital methemoglobinemia type I OMOP:35624660 - Aspergillus iizukae OMOP:35624877 - Obstructed right inguinal hernia with gangrene OMOP:35625105 - Left femoral hernia with gangrene OMOP:35625723 - Iritis of left eye due to diabetes mellitus OMOP:35625724 - Bilateral iritis due to diabetes mellitus OMOP:35625730 - Accidental awareness under general anesthesia OMOP:35625925 - Non-cavitated caries of tooth root OMOP:35626036 - Preproliferative retinopathy of right eye due to diabetes mellitus OMOP:35626061 - No cough strength OMOP:3571992 - Abrasion of skin of left thumb OMOP:3572044 - Autism screening declined OMOP:35810090 - Spirometry method OMOP:35810181 - Usual walking pace OMOP:35810222 - Hot drink temperature OMOP:35810259 - Tense / 'highly strung' OMOP:35810268 - Frequency of tiredness / lethargy in last 2 weeks OMOP:35810272 - Answered sexual history questions OMOP:35810281 - Plays computer games OMOP:35810312 - Had menopause OMOP:35810510 - PM: final answer OMOP:35810698 - Length of longest manic/irritable episode OMOP:35810730 - Completion status of test OMOP:35810736 - Target heart rate achieved OMOP:35810807 - Word associated with "tiny" OMOP:35810862 - Other dietary supplements (pilot) OMOP:35810868 - Variation in diet (pilot) OMOP:35811020 - Probable recurrent major depression (moderate) OMOP:35811049 - Ever smoked OMOP:35811108 - Frequency of needing morning drink of alcohol after heavy drinking session in last year OMOP:35811144 - Maximum frequency of taking cannabis OMOP:35811210 - Able to pay rent/mortgage as an adult OMOP:35811245 - Liking for asparagus OMOP:35811249 - Liking for baked/steamed fish OMOP:35811336 - Liking for oranges OMOP:35811389 - Liking for wholemeal bread OMOP:35811561 - Recent medication for asthma OMOP:35811575 - Recent medication for mesothelioma of the lung OMOP:35811638 - Workplace had a lot of cigarette smoke from other people smoking OMOP:35814260 - Eosinophill count acquisition route OMOP:35814280 - Monocyte percentage acquisition route OMOP:35814376 - Alkaline phosphatase missing reason OMOP:35814384 - Alanine aminotransferase reportability OMOP:35814425 - Calcium missing reason OMOP:35814502 - Lipoprotein A reportability OMOP:35814870 - Dessert consumers OMOP:35814919 - Low fat hard cheese intake OMOP:35814927 - Mozzarella intake OMOP:35814948 - Skin removed from poultry OMOP:35814989 - Garlic intake OMOP:35815006 - Prune intake OMOP:35815033 - Invitation to assessment centre, acceptance OMOP:35815049 - Intended delivery place OMOP:35815155 - [2,5,3,0,7,1,6,4] OMOP:35815159 - 27 OMOP:35815194 - 31,000 to 51,999 OMOP:35815220 - 40cm OMOP:35815256 - 50 OMOP:35815259 - 51 OMOP:35815329 - 8 days with pain OMOP:35815331 - 9 OMOP:35815378 - About once a week OMOP:35816555 - Bristol (imaging) OMOP:35816642 - buy OMOP:35816858 - Category 1, cycle rising to 50% level OMOP:35816860 - Category 3, cycle at constant level OMOP:35816870 - Cease OMOP:35817438 - Completed OMOP:35817441 - Completed with pause OMOP:35817586 - CSEs or equivalent OMOP:35817714 - Dark olive OMOP:35817717 - Date correction only OMOP:35817878 - diadem OMOP:35818035 - Direct entry OMOP:35818284 - do not wish to answer OMOP:35818286 - don't know type of milk OMOP:35818485 - embellish OMOP:35819090 - For short-sightedness, i.e. only or mainly for distance viewing such as driving, cinema etc (called 'myopia') OMOP:35819524 - Heart disease OMOP:35819525 - Heart rate reached safety level OMOP:35819554 - Hip OMOP:35819583 - Horse-shoe "U" OMOP:35819587 - house OMOP:35819589 - house OMOP:35819815 - I needed less sleep than usual OMOP:35820265 - Left eye OMOP:35820288 - Less than 15 minutes OMOP:35820295 - Less than 5 minutes OMOP:35820444 - Loose teeth OMOP:35820920 - Minor Metal Artefact in ASAT OMOP:35821064 - Most of the time OMOP:35821349 - Never/rarely OMOP:35821357 - never tried OMOP:35821455 - No OMOP:35821461 - No OMOP:35821488 - No aliquot information OMOP:35821562 - No, probably not OMOP:35821580 - Norgeston OMOP:35821644 - Not performed OMOP:35821662 - Not sure OMOP:35821739 - odometer OMOP:35821833 - Ongoing when data entered OMOP:35821839 - open OMOP:35821858 - opulent OMOP:35822058 - palace OMOP:35822179 - party OMOP:35823129 - refractometry result error: " E9" OMOP:35823171 - Reportable at assay but not reportable after any corrections (too low) OMOP:35823208 - Retired OMOP:35823239 - rice/oat/vegetable milk OMOP:35823262 - Right eye only OMOP:35823458 - scholar OMOP:35823533 - September OMOP:35823913 - Subject tilted in scanner - part of the thigh outside the FOV or severe outer FOV inhomogeneities affect thigh muscle(s) OMOP:35823998 - Sunflower oil OMOP:35824286 - This type of shift pattern was not worked during job OMOP:35824405 - Tomato ketchup OMOP:35824500 - triangle OMOP:35824582 - truncate OMOP:35824846 - Very happy OMOP:35824859 - Very often true OMOP:35824984 - Vitamin C OMOP:35825082 - windmill OMOP:35825167 - Yes, more than 100 times OMOP:35825675 - Caribbean OMOP:35825819 - Croatia OMOP:35825967 - Equipment failure OMOP:35826006 - False Nails/varnish OMOP:35826018 - Feeling unwell/pain OMOP:35826202 - Hong Kong OMOP:35826311 - Lack of time OMOP:35826402 - Malfunction OMOP:35827137 - Sri Lanka OMOP:35827230 - Togo OMOP:35827283 - Unable to remove shoes/socks OMOP:35827392 - West Indies OMOP:35944940 - GPR137 (G protein-coupled receptor 137) gene variant measurement OMOP:35944954 - CERS4 (ceramide synthase 4) gene variant measurement OMOP:35944964 - LZTS1 (leucine zipper tumor suppressor 1) gene variant measurement OMOP:35945006 - COX7A2 (cytochrome c oxidase subunit 7A2) gene variant measurement OMOP:35945146 - AJM1 (apical junction component 1 homolog) gene variant measurement OMOP:35945175 - SOX17 (SRY-box transcription factor 17) gene variant measurement OMOP:35945254 - GBE1 (1,4-alpha-glucan branching enzyme 1) gene variant measurement OMOP:35945342 - RNF222 (ring finger protein 222) gene variant measurement OMOP:35945476 - NGB (neuroglobin) gene variant measurement OMOP:35945487 - ESCO1 (establishment of sister chromatid cohesion N-acetyltransferase 1) gene variant measurement OMOP:35945754 - CCDC136 (coiled-coil domain containing 136) gene variant measurement OMOP:35945869 - DERA (deoxyribose-phosphate aldolase) gene variant measurement OMOP:35945897 - RDH14 (retinol dehydrogenase 14) gene variant measurement OMOP:35945946 - RESP18 (regulated endocrine specific protein 18) gene variant measurement OMOP:35945948 - SRFBP1 (serum response factor binding protein 1) gene variant measurement OMOP:35946085 - UPK3BL1 (uroplakin 3B like 1) gene variant measurement OMOP:35946168 - CCDC120 (coiled-coil domain containing 120) gene variant measurement OMOP:35946240 - PPP6R2 (protein phosphatase 6 regulatory subunit 2) gene variant measurement OMOP:35946357 - MTHFD2 (methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase) gene variant measurement OMOP:35946381 - TIMM44 (translocase of inner mitochondrial membrane 44) gene variant measurement OMOP:35946465 - SPTLC3 (serine palmitoyltransferase long chain base subunit 3) gene variant measurement OMOP:35946514 - TRIM25 (tripartite motif containing 25) gene variant measurement OMOP:35946550 - ACHE (acetylcholinesterase (Cartwright blood group)) gene variant measurement OMOP:35946662 - CCDC38 (coiled-coil domain containing 38) gene variant measurement OMOP:35946737 - PTH (parathyroid hormone) gene variant measurement OMOP:35946822 - FAM167B (family with sequence similarity 167 member B) gene variant measurement OMOP:35946888 - TERB1 (telomere repeat binding bouquet formation protein 1) gene variant measurement OMOP:35946930 - MAATS1 (MYCBP associated and testis expressed 1) gene variant measurement OMOP:35946984 - COL4A6 (collagen type IV alpha 6 chain) gene variant measurement OMOP:35947048 - INPP5B (inositol polyphosphate-5-phosphatase B) gene variant measurement OMOP:35947060 - ZBTB7A (zinc finger and BTB domain containing 7A) gene variant measurement OMOP:35947257 - LIAS (lipoic acid synthetase) gene variant measurement OMOP:35947319 - MYH3 (myosin heavy chain 3) gene variant measurement OMOP:35947354 - CPSF7 (cleavage and polyadenylation specific factor 7) gene variant measurement OMOP:35947495 - CRAT (carnitine O-acetyltransferase) gene variant measurement OMOP:35947516 - RASSF9 (Ras association domain family member 9) gene variant measurement OMOP:35947540 - EPS15L1 (epidermal growth factor receptor pathway substrate 15 like 1) gene variant measurement OMOP:35947592 - FANCI (FA complementation group I) gene variant measurement OMOP:35947593 - NXNL1 (nucleoredoxin like 1) gene variant measurement OMOP:35947794 - ITPR1 (inositol 1,4,5-trisphosphate receptor type 1) gene variant measurement OMOP:35947866 - PTPN20 (protein tyrosine phosphatase non-receptor type 20) gene variant measurement OMOP:35947876 - FAM172A (family with sequence similarity 172 member A) gene variant measurement OMOP:35947993 - NOC2L (NOC2 like nucleolar associated transcriptional repressor) gene variant measurement OMOP:35948015 - CBWD5 (COBW domain containing 5) gene variant measurement OMOP:35948166 - PLA2G4C (phospholipase A2 group IVC) gene variant measurement OMOP:35948245 - CCDC34 (coiled-coil domain containing 34) gene variant measurement OMOP:35948352 - FAM53A (family with sequence similarity 53 member A) gene variant measurement OMOP:35948369 - FAM160B1 (family with sequence similarity 160 member B1) gene variant measurement OMOP:35948421 - CETN2 (centrin 2) gene variant measurement OMOP:35948524 - PRAMEF12 (PRAME family member 12) gene variant measurement OMOP:35948546 - ITGAE (integrin subunit alpha E) gene variant measurement OMOP:35948575 - CYP11B1 (cytochrome P450 family 11 subfamily B member 1) gene variant measurement OMOP:35948636 - MANBAL (mannosidase beta like) gene variant measurement OMOP:35948856 - ERGIC3 (ERGIC and golgi 3) gene variant measurement OMOP:35948886 - C8G (complement C8 gamma chain) gene variant measurement OMOP:35948906 - CDX2 (caudal type homeobox 2) gene variant measurement OMOP:35949042 - LKAAEAR1 (LKAAEAR motif containing 1) gene variant measurement OMOP:35949222 - BACH2 (BTB domain and CNC homolog 2) gene variant measurement OMOP:35949243 - TMEM163 (transmembrane protein 163) gene variant measurement OMOP:35949249 - UFD1 (ubiquitin recognition factor in ER associated degradation 1) gene variant measurement OMOP:35949434 - CMTM5 (CKLF like MARVEL transmembrane domain containing 5) gene variant measurement OMOP:35949501 - C8B (complement C8 beta chain) gene variant measurement OMOP:35949504 - MID1 (midline 1) gene variant measurement OMOP:35949623 - DLG2 (discs large MAGUK scaffold protein 2) gene variant measurement OMOP:35949857 - MAFA (MAF bZIP transcription factor A) gene variant measurement OMOP:35949881 - ATP7A (ATPase copper transporting alpha) gene variant measurement OMOP:35949891 - ANGPTL2 (angiopoietin like 2) gene variant measurement OMOP:35949913 - AMOTL1 (angiomotin like 1) gene variant measurement OMOP:35949917 - ABCC4 (ATP binding cassette subfamily C member 4) gene variant measurement OMOP:35949998 - PPOX (protoporphyrinogen oxidase) gene variant measurement OMOP:35950258 - TMEM68 (transmembrane protein 68) gene variant measurement OMOP:35950386 - PBK (PDZ binding kinase) gene variant measurement OMOP:35950424 - SERPINH1 (serpin family H member 1) gene variant measurement OMOP:35950437 - SKA2 (spindle and kinetochore associated complex subunit 2) gene variant measurement OMOP:35950449 - ST8SIA3 (ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3) gene variant measurement OMOP:35950452 - DDIT4 (DNA damage inducible transcript 4) gene variant measurement OMOP:35950712 - DHX8 (DEAH-box helicase 8) gene variant measurement OMOP:35950929 - LSG1 (large 60S subunit nuclear export GTPase 1) gene variant measurement OMOP:35951029 - OR4C15 (olfactory receptor family 4 subfamily C member 15) gene variant measurement OMOP:35951220 - IDI2 (isopentenyl-diphosphate delta isomerase 2) gene variant measurement OMOP:35951222 - GATAD1 (GATA zinc finger domain containing 1) gene variant measurement OMOP:35951271 - ORC1 (origin recognition complex subunit 1) gene variant measurement OMOP:35951344 - FGFRL1 (fibroblast growth factor receptor like 1) gene variant measurement OMOP:35951402 - SPANXN4 (SPANX family member N4) gene variant measurement OMOP:35951472 - KRTAP20-2 (keratin associated protein 20-2) gene variant measurement OMOP:35951495 - FAM166A (family with sequence similarity 166 member A) gene variant measurement OMOP:35951605 - GINS2 (GINS complex subunit 2) gene variant measurement OMOP:35951638 - PGD (phosphogluconate dehydrogenase) gene variant measurement OMOP:35951681 - USP17L20 (ubiquitin specific peptidase 17 like family member 20) gene variant measurement OMOP:35951870 - ANKRD6 (ankyrin repeat domain 6) gene variant measurement OMOP:35951917 - DYDC2 (DPY30 domain containing 2) gene variant measurement OMOP:35952010 - RPL8 (ribosomal protein L8) gene variant measurement OMOP:35952110 - TWNK (twinkle mtDNA helicase) gene variant measurement OMOP:35952129 - MPEG1 (macrophage expressed 1) gene variant measurement OMOP:35952179 - ELOA3 (elongin A3) gene variant measurement OMOP:35952199 - PPP2R3A (protein phosphatase 2 regulatory subunit B''alpha) gene variant measurement OMOP:35952213 - PNCK (pregnancy up-regulated nonubiquitous CaM kinase) gene variant measurement OMOP:35952271 - ST8SIA1 (ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1) gene variant measurement OMOP:35952293 - DSCAM (DS cell adhesion molecule) gene variant measurement OMOP:35952305 - CTAGE15 (CTAGE family member 15) gene variant measurement OMOP:35952310 - C9 (complement C9) gene variant measurement OMOP:35952449 - TP53I11 (tumor protein p53 inducible protein 11) gene variant measurement OMOP:35952575 - TMEM191B (transmembrane protein 191B) gene variant measurement OMOP:35952588 - CCDC173 (coiled-coil domain containing 173) gene variant measurement OMOP:35952711 - SLC15A5 (solute carrier family 15 member 5) gene variant measurement OMOP:35952772 - NFKB1 (nuclear factor kappa B subunit 1) gene variant measurement OMOP:35952889 - MYC (MYC proto-oncogene, bHLH transcription factor) gene variant measurement OMOP:35952909 - PLAU (plasminogen activator, urokinase) gene variant measurement OMOP:35952952 - ARL13A (ADP ribosylation factor like GTPase 13A) gene variant measurement OMOP:35952957 - KRTAP9-3 (keratin associated protein 9-3) gene variant measurement OMOP:35953045 - GALNT17 (polypeptide N-acetylgalactosaminyltransferase 17) gene variant measurement OMOP:35953093 - PLEKHH1 (pleckstrin homology, MyTH4 and FERM domain containing H1) gene variant measurement OMOP:35953126 - MAGED4B (MAGE family member D4B) gene variant measurement OMOP:35953168 - TUBB4A (tubulin beta 4A class IVa) gene variant measurement OMOP:35953253 - INPP5K (inositol polyphosphate-5-phosphatase K) gene variant measurement OMOP:35953279 - PGBD1 (piggyBac transposable element derived 1) gene variant measurement OMOP:35953306 - POLR2E (RNA polymerase II subunit E) gene variant measurement OMOP:35953402 - MS4A18 (membrane spanning 4-domains A18) gene variant measurement OMOP:35953437 - ERCC8 (ERCC excision repair 8, CSA ubiquitin ligase complex subunit) gene variant measurement OMOP:35953445 - NCOA7 (nuclear receptor coactivator 7) gene variant measurement OMOP:35953549 - TMEM64 (transmembrane protein 64) gene variant measurement OMOP:35953571 - SSTR1 (somatostatin receptor 1) gene variant measurement OMOP:35953614 - ZCCHC14 (zinc finger CCHC-type containing 14) gene variant measurement OMOP:35953660 - SLCO2B1 (solute carrier organic anion transporter family member 2B1) gene variant measurement OMOP:35953792 - P2RX3 (purinergic receptor P2X 3) gene variant measurement OMOP:35953840 - GALC (galactosylceramidase) gene variant measurement OMOP:35954024 - SPOCK3 (SPARC (osteonectin), cwcv and kazal like domains proteoglycan 3) gene variant measurement OMOP:35954066 - EIF4G2 (eukaryotic translation initiation factor 4 gamma 2) gene variant measurement OMOP:35954223 - FARS2 (phenylalanyl-tRNA synthetase 2, mitochondrial) gene variant measurement OMOP:35954240 - TMEM120B (transmembrane protein 120B) gene variant measurement OMOP:35954310 - IFT52 (intraflagellar transport 52) gene variant measurement OMOP:35954334 - ZNF263 (zinc finger protein 263) gene variant measurement OMOP:35954385 - ZNF668 (zinc finger protein 668) gene variant measurement OMOP:35954397 - MT1F (metallothionein 1F) gene variant measurement OMOP:35954452 - RNF149 (ring finger protein 149) gene variant measurement OMOP:35954474 - KANSL1 (KAT8 regulatory NSL complex subunit 1) gene variant measurement OMOP:35954480 - TMEM25 (transmembrane protein 25) gene variant measurement OMOP:35954531 - TM7SF2 (transmembrane 7 superfamily member 2) gene variant measurement OMOP:35954567 - ZNF596 (zinc finger protein 596) gene variant measurement OMOP:35954578 - N4BP1 (NEDD4 binding protein 1) gene variant measurement OMOP:35954595 - NMBR (neuromedin B receptor) gene variant measurement OMOP:35954692 - POTEA (POTE ankyrin domain family member A) gene variant measurement OMOP:35954706 - ZBTB9 (zinc finger and BTB domain containing 9) gene variant measurement OMOP:35954801 - MYO3B (myosin IIIB) gene variant measurement OMOP:35955041 - MEX3B (mex-3 RNA binding family member B) gene variant measurement OMOP:35955243 - RNF207 (ring finger protein 207) gene variant measurement OMOP:35955248 - SLC27A3 (solute carrier family 27 member 3) gene variant measurement OMOP:35955332 - UBE2D4 (ubiquitin conjugating enzyme E2 D4 (putative)) gene variant measurement OMOP:35955527 - IKZF2 (IKAROS family zinc finger 2) gene variant measurement OMOP:35955568 - RGS22 (regulator of G protein signaling 22) gene variant measurement OMOP:35955861 - LRRC49 (leucine rich repeat containing 49) gene variant measurement OMOP:35955898 - ITGAV (integrin subunit alpha V) gene variant measurement OMOP:35955900 - FBXL7 (F-box and leucine rich repeat protein 7) gene variant measurement OMOP:35955942 - TAF1D (TATA-box binding protein associated factor, RNA polymerase I subunit D) gene variant measurement OMOP:35956066 - TLCD3B (TLC domain containing 3B) gene variant measurement OMOP:35956121 - MMP23B (matrix metallopeptidase 23B) gene variant measurement OMOP:35956181 - HIGD2A (HIG1 hypoxia inducible domain family member 2A) gene variant measurement OMOP:35956213 - DCAKD (dephospho-CoA kinase domain containing) gene variant measurement OMOP:35956249 - TBC1D10B (TBC1 domain family member 10B) gene variant measurement OMOP:35956272 - XIAP (X-linked inhibitor of apoptosis) gene variant measurement OMOP:35956340 - BBS12 (Bardet-Biedl syndrome 12) gene variant measurement OMOP:35956418 - TUBD1 (tubulin delta 1) gene variant measurement OMOP:35956511 - MAP2K6 (mitogen-activated protein kinase kinase 6) gene variant measurement OMOP:35956571 - SELENBP1 (selenium binding protein 1) gene variant measurement OMOP:35956573 - TEF (TEF transcription factor, PAR bZIP family member) gene variant measurement OMOP:35956588 - SLC49A3 (solute carrier family 49 member 3) gene variant measurement OMOP:35956592 - KRT17 (keratin 17) gene variant measurement OMOP:35956641 - TPP2 (tripeptidyl peptidase 2) gene variant measurement OMOP:35956839 - KCTD5 (potassium channel tetramerization domain containing 5) gene variant measurement OMOP:35956842 - ITGB6 (integrin subunit beta 6) gene variant measurement OMOP:35957079 - GGA2 (golgi associated, gamma adaptin ear containing, ARF binding protein 2) gene variant measurement OMOP:35957271 - H3C12 (H3 clustered histone 12) gene variant measurement OMOP:35957296 - ARMH3 (armadillo like helical domain containing 3) gene variant measurement OMOP:35957404 - DNAH6 (dynein axonemal heavy chain 6) gene variant measurement OMOP:35957411 - RNF17 (ring finger protein 17) gene variant measurement OMOP:35957441 - GSTT4 (glutathione S-transferase theta 4) gene variant measurement OMOP:35957555 - HMOX1 (heme oxygenase 1) gene variant measurement OMOP:35957578 - NUAK2 (NUAK family kinase 2) gene variant measurement OMOP:35957613 - PDCD2 (programmed cell death 2) gene variant measurement OMOP:35957685 - KLHDC9 (kelch domain containing 9) gene variant measurement OMOP:35957756 - PNLIPRP3 (pancreatic lipase related protein 3) gene variant measurement OMOP:35957814 - DRD1 (dopamine receptor D1) gene variant measurement OMOP:35957839 - B3GAT3 (beta-1,3-glucuronyltransferase 3) gene variant measurement OMOP:35958119 - MAGOHB (mago homolog B, exon junction complex subunit) gene variant measurement OMOP:35958140 - CCDC88C (coiled-coil domain containing 88C) gene variant measurement OMOP:35958149 - KRT38 (keratin 38) gene variant measurement OMOP:35958203 - ESD (esterase D) gene variant measurement OMOP:35958350 - GTF2H5 (general transcription factor IIH subunit 5) gene variant measurement OMOP:35958445 - ISM2 (isthmin 2) gene variant measurement OMOP:35958515 - AMHR2 (anti-Mullerian hormone receptor type 2) gene variant measurement OMOP:35958517 - C19orf73 (chromosome 19 open reading frame 73) gene variant measurement OMOP:35958527 - RBMY1E (RNA binding motif protein Y-linked family 1 member E) gene variant measurement OMOP:35958645 - KRT33B (keratin 33B) gene variant measurement OMOP:35958794 - SLC35A5 (solute carrier family 35 member A5) gene variant measurement OMOP:35958837 - CYP4F11 (cytochrome P450 family 4 subfamily F member 11) gene variant measurement OMOP:35958876 - COMMD9 (COMM domain containing 9) gene variant measurement OMOP:35959068 - SLC5A8 (solute carrier family 5 member 8) gene variant measurement OMOP:35959273 - FOXP1 (forkhead box P1) gene variant measurement OMOP:35959305 - WSCD2 (WSC domain containing 2) gene variant measurement OMOP:35959408 - TNRC18 (trinucleotide repeat containing 18) gene variant measurement OMOP:35959650 - ZBTB8B (zinc finger and BTB domain containing 8B) gene variant measurement OMOP:35959654 - ARCN1 (archain 1) gene variant measurement OMOP:35959752 - SMC3 (structural maintenance of chromosomes 3) gene variant measurement OMOP:35959819 - RASGRP4 (RAS guanyl releasing protein 4) gene variant measurement OMOP:35959972 - TUBA3E (tubulin alpha 3e) gene variant measurement OMOP:35960007 - POT1 (protection of telomeres 1) gene variant measurement OMOP:35960033 - CDRT15L2 (CMT1A duplicated region transcript 15 like 2) gene variant measurement OMOP:35960110 - CFAP77 (cilia and flagella associated protein 77) gene variant measurement OMOP:35960145 - DPP6 (dipeptidyl peptidase like 6) gene variant measurement OMOP:35960157 - PEX5L (peroxisomal biogenesis factor 5 like) gene variant measurement OMOP:35960224 - SLC17A9 (solute carrier family 17 member 9) gene variant measurement OMOP:35960436 - USP2 (ubiquitin specific peptidase 2) gene variant measurement OMOP:35960555 - C4BPA (complement component 4 binding protein alpha) gene variant measurement OMOP:35960582 - HAUS6 (HAUS augmin like complex subunit 6) gene variant measurement OMOP:35960604 - ABCC5 (ATP binding cassette subfamily C member 5) gene variant measurement OMOP:35960672 - VNN1 (vanin 1) gene variant measurement OMOP:35960793 - FAM83D (family with sequence similarity 83 member D) gene variant measurement OMOP:35960944 - HAX1 (HCLS1 associated protein X-1) gene variant measurement OMOP:35960996 - CASQ1 (calsequestrin 1) gene variant measurement OMOP:35961073 - COMTD1 (catechol-O-methyltransferase domain containing 1) gene variant measurement OMOP:35961189 - SUGT1 (SGT1 homolog, MIS12 kinetochore complex assembly cochaperone) gene variant measurement OMOP:35961226 - ZRANB1 (zinc finger RANBP2-type containing 1) gene variant measurement OMOP:35961254 - HSD17B4 (hydroxysteroid 17-beta dehydrogenase 4) gene variant measurement OMOP:35961353 - TBPL1 (TATA-box binding protein like 1) gene variant measurement OMOP:35961417 - EXTL3 (exostosin like glycosyltransferase 3) gene variant measurement OMOP:35961521 - TMEM184C (transmembrane protein 184C) gene variant measurement OMOP:35961733 - NAALAD2 (N-acetylated alpha-linked acidic dipeptidase 2) gene variant measurement OMOP:35961764 - CTDSPL (CTD small phosphatase like) gene variant measurement OMOP:35961828 - IL25 (interleukin 25) gene variant measurement OMOP:35961829 - DPP9 (dipeptidyl peptidase 9) gene variant measurement OMOP:35961895 - LRRC75B (leucine rich repeat containing 75B) gene variant measurement OMOP:35962014 - STRIP1 (striatin interacting protein 1) gene variant measurement OMOP:35962027 - KIF27 (kinesin family member 27) gene variant measurement OMOP:35962040 - RLF (RLF zinc finger) gene variant measurement OMOP:35962059 - HCN2 (hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2) gene variant measurement OMOP:35962404 - TSPAN19 (tetraspanin 19) gene variant measurement OMOP:35962446 - MUC4 (mucin 4, cell surface associated) gene variant measurement OMOP:35962480 - UTP23 (UTP23 small subunit processome component) gene variant measurement OMOP:35962755 - CFAP97D2 (CFAP97 domain containing 2) gene variant measurement OMOP:35963054 - IFT20 (intraflagellar transport 20) gene variant measurement OMOP:35963062 - ITIH6 (inter-alpha-trypsin inhibitor heavy chain family member 6) gene variant measurement OMOP:35963143 - MCRIP2 (MAPK regulated corepressor interacting protein 2) gene variant measurement OMOP:35963164 - LIPM (lipase family member M) gene variant measurement OMOP:35963180 - ARFGAP2 (ADP ribosylation factor GTPase activating protein 2) gene variant measurement OMOP:35963210 - FABP1 (fatty acid binding protein 1) gene variant measurement OMOP:35963245 - TEX101 (testis expressed 101) gene variant measurement OMOP:35963261 - PKP4 (plakophilin 4) gene variant measurement OMOP:35963309 - YY1 (YY1 transcription factor) gene variant measurement OMOP:35963460 - NELFCD (negative elongation factor complex member C/D) gene variant measurement OMOP:35963518 - NANOGP8 (Nanog homeobox retrogene P8) gene variant measurement OMOP:35963735 - TLCD1 (TLC domain containing 1) gene variant measurement OMOP:35963753 - QRSL1 (glutaminyl-tRNA amidotransferase subunit QRSL1) gene variant measurement OMOP:35963758 - PMP2 (peripheral myelin protein 2) gene variant measurement OMOP:35963813 - PPP1R12A (protein phosphatase 1 regulatory subunit 12A) gene variant measurement OMOP:35963877 - WSB1 (WD repeat and SOCS box containing 1) gene variant measurement OMOP:35963914 - KRTAP7-1 (keratin associated protein 7-1 (gene/pseudogene)) gene variant measurement OMOP:35963928 - EIF5A (eukaryotic translation initiation factor 5A) gene variant measurement OMOP:35964011 - CROCC (ciliary rootlet coiled-coil, rootletin) gene variant measurement OMOP:35964066 - UBR2 (ubiquitin protein ligase E3 component n-recognin 2) gene variant measurement OMOP:35964143 - PUS10 (pseudouridine synthase 10) gene variant measurement OMOP:35964153 - FDFT1 (farnesyl-diphosphate farnesyltransferase 1) gene variant measurement OMOP:35964164 - WIPI1 (WD repeat domain, phosphoinositide interacting 1) gene variant measurement OMOP:35964182 - SLC7A4 (solute carrier family 7 member 4) gene variant measurement OMOP:35964376 - ABCB6 (ATP binding cassette subfamily B member 6 (Langereis blood group)) gene variant measurement OMOP:35964411 - NLRP2 (NLR family pyrin domain containing 2) gene variant measurement OMOP:35964452 - ZBTB3 (zinc finger and BTB domain containing 3) gene variant measurement OMOP:35977060 - MLH1 nuclear protein expression measurement OMOP:35977284 - PTEN on GRCh38 chr10: Substitution in position 87933037 of A replaced by G measurement OMOP:35977313 - PTEN on GRCh38 chr10: Substitution in position 87933148 of G replaced by A measurement OMOP:35977764 - AICDA on GRCh38 chr12: Substitution in position 8604898 of A replaced by G measurement OMOP:35977783 - FLT3 on GRCh38 chr13: Substitution in position 28018504 of T replaced by A measurement OMOP:35977894 - BRCA2 on GRCh38 chr13: Substitution in position 32357875 of G replaced by A measurement OMOP:35977918 - BRCA2 on GRCh38 chr13: Substitution in position 32363229 of T replaced by C measurement OMOP:35978032 - RB1 on GRCh38 chr13: Substitution in position 48459750 of G replaced by T measurement OMOP:35978085 - NFKBIA on GRCh38 chr14: Substitution in position 35404613 of C replaced by T measurement OMOP:35978098 - FANCM on GRCh38 chr14: Substitution in position 45175613 of A replaced by C measurement OMOP:35978105 - FANCM on GRCh38 chr14: Substitution in position 45196410 of G replaced by A measurement OMOP:35978113 - CCNK on GRCh38 chr14: Substitution in position 99495549 of A replaced by G measurement OMOP:35978553 - NF1 on GRCh38 chr17: Substitution in position 31233115 of C replaced by G measurement OMOP:35978598 - ERBB2 on GRCh38 chr17: Substitution in position 39724736 of T replaced by C measurement OMOP:35978607 - ERBB2 on GRCh38 chr17: Substitution in position 39725187 of C replaced by T measurement OMOP:35978659 - STAT3 on GRCh38 chr17: Substitution in position 42334015 of G replaced by A measurement OMOP:35978724 - BRIP1 on GRCh38 chr17: Substitution in position 61776442 of T replaced by C measurement OMOP:35978726 - BRIP1 on GRCh38 chr17: Substitution in position 61776463 of G replaced by A measurement OMOP:35979018 - MTOR on GRCh38 chr1: Substitution in position 11157174 of A replaced by G measurement OMOP:35979079 - NOTCH2 on GRCh38 chr1: Substitution in position 119915524 of G replaced by A measurement OMOP:35979174 - H3-3A on GRCh38 chr1: Substitution in position 226064434 of A replaced by T measurement OMOP:35979225 - CSF3R on GRCh38 chr1: Substitution in position 36472277 of C replaced by T measurement OMOP:35979259 - DPYD on GRCh38 chr1: Substitution in position 97450058 of C replaced by T measurement OMOP:35979281 - DNMT3B on GRCh38 chr20: Substitution in position 32802416 of T replaced by G measurement OMOP:35979315 - RUNX1 on GRCh38 chr21: Substitution in position 34886866 of T replaced by C measurement OMOP:35979377 - SMARCB1 on GRCh38 chr22: Substitution in position 23816836 of C replaced by T measurement OMOP:35979440 - CHEK2 on GRCh38 chr22: Substitution in position 28696983 of A replaced by C measurement OMOP:35979611 - BARD1 on GRCh38 chr2: Substitution in position 214728819 of G replaced by A measurement OMOP:35979666 - BARD1 on GRCh38 chr2: Substitution in position 214781165 of G replaced by C measurement OMOP:35979703 - ALK on GRCh38 chr2: Substitution in position 29213994 of A replaced by T measurement OMOP:35979735 - ALK on GRCh38 chr2: Substitution in position 29383812 of C replaced by T measurement OMOP:35979781 - SOS1 on GRCh38 chr2: Substitution in position 39022773 of C replaced by T measurement OMOP:35979836 - MSH2 on GRCh38 chr2: Substitution in position 47416399 of C replaced by G measurement OMOP:35979913 - MSH6 on GRCh38 chr2: Substitution in position 47799083 of A replaced by G measurement OMOP:35979958 - MSH6 on GRCh38 chr2: Substitution in position 47800717 of T replaced by A measurement OMOP:35979988 - MSH6 on GRCh38 chr2: Substitution in position 47806213 of C replaced by T measurement OMOP:35980023 - TMEM127 on GRCh38 chr2: Substitution in position 96265351 of C replaced by A measurement OMOP:35980091 - FANCD2 on GRCh38 chr3: Substitution in position 10046659 of A replaced by G measurement OMOP:35980101 - VHL on GRCh38 chr3: Substitution in position 10141963 of G replaced by A measurement OMOP:35980114 - VHL on GRCh38 chr3: Substitution in position 10142082 of C replaced by G measurement OMOP:35980134 - VHL on GRCh38 chr3: Substitution in position 10142180 of C replaced by G measurement OMOP:35980136 - VHL on GRCh38 chr3: Substitution in position 10142181 of T replaced by C measurement OMOP:35980382 - VHL on GRCh38 chr3: Substitution in position 10149846 of T replaced by A measurement OMOP:35980445 - GATA2 on GRCh38 chr3: Substitution in position 128485910 of G replaced by A measurement OMOP:35980458 - FOXL2 on GRCh38 chr3: Substitution in position 138946073 of G replaced by A measurement OMOP:35980533 - PIK3CA on GRCh38 chr3: Substitution in position 179203761 of T replaced by G measurement OMOP:35980562 - PIK3CA on GRCh38 chr3: Substitution in position 179218304 of A replaced by G measurement OMOP:35980736 - CTNNB1 on GRCh38 chr3: Substitution in position 41224613 of G replaced by T measurement OMOP:35980766 - RHOA on GRCh38 chr3: Substitution in position 49375465 of T replaced by C measurement OMOP:35980813 - FAT4 on GRCh38 chr4: Substitution in position 125318831 of C replaced by T measurement OMOP:35980850 - PDGFRA on GRCh38 chr4: Substitution in position 54285926 of A replaced by T measurement OMOP:35981187 - ESR1 on GRCh38 chr6: Deletion in position 152098785 to 152098786 and Insertion of AG measurement OMOP:35981221 - ESR1 on GRCh38 chr6: Substitution in position 152098788 of A replaced by G measurement OMOP:35981251 - BRAF on GRCh38 chr7: Deletion in position 140778059 to 140778060 and Insertion of CA measurement OMOP:35981258 - PIK3CG on GRCh38 chr7: Substitution in position 106869488 of A replaced by G measurement OMOP:35981335 - SMO on GRCh38 chr7: Substitution in position 129212026 of C replaced by T measurement OMOP:35981359 - BRAF on GRCh38 chr7: Substitution in position 140781611 of C replaced by A measurement OMOP:35981365 - BRAF on GRCh38 chr7: Substitution in position 140753328 of G replaced by A measurement OMOP:35981575 - PMS2 on GRCh38 chr7: Substitution in position 6005996 of C replaced by T measurement OMOP:35981661 - ABL1 on GRCh38 chr9: Substitution in position 130885205 of C replaced by T measurement OMOP:35981787 - ABL1 on GRCh38 chr9: Substitution in position 130875034 of A replaced by G measurement OMOP:35981865 - NOTCH1 on GRCh38 chr9: Substitution in position 136504937 of A replaced by C measurement OMOP:35982025 - RPGR on GRCh38 chrX: Substitution in position 38310749 of C replaced by A measurement OMOP:35982092 - ABCB1 transcript: Substitution in position 2677 of T replaced by A measurement OMOP:35982265 - ABL1 transcript: Substitution in position 757 of T replaced by C measurement OMOP:35982824 - ALK transcript: Substitution in position 2123 of C replaced by T measurement OMOP:35982928 - ALK transcript: Substitution in position 3359+142 of C replaced by T measurement OMOP:35982951 - ALK transcript: Substitution in position 3455 of T replaced by G measurement OMOP:35982968 - ALK transcript: Substitution in position 3520 of T replaced by G measurement OMOP:35982989 - ALK transcript: Substitution in position 3664 of G replaced by A measurement OMOP:35983435 - ARID1A transcript: Substitution in position 5164 of C replaced by T measurement OMOP:35983592 - ASXL1 transcript: Substitution in position 1762 of C replaced by T measurement OMOP:35983700 - ATM transcript: Substitution in position 5041 of A replaced by G measurement OMOP:35983711 - ATM transcript: Substitution in position 5521 of G replaced by A measurement OMOP:35983712 - ATM transcript: Substitution in position 5558 of A replaced by T measurement OMOP:35983743 - ATM transcript: Substitution in position 6857 of G replaced by T measurement OMOP:35983761 - ATM transcript: Substitution in position 743 of G replaced by A measurement OMOP:35983805 - ATM transcript: Substitution in position 8787-55 of C replaced by T measurement OMOP:35983865 - ATP7B transcript: Substitution in position 3190 of G replaced by A measurement OMOP:35984039 - AXIN2 transcript: Substitution in position 1387 of C replaced by T measurement OMOP:35984088 - BAP1 transcript: Substitution in position 277 of A replaced by G measurement OMOP:35984192 - BARD1 transcript: Substitution in position 1028 of C replaced by T measurement OMOP:35984217 - BARD1 transcript: Substitution in position 1793 of C replaced by T measurement OMOP:35984394 - BRAF transcript: Substitution in position 138+12 of C replaced by T measurement OMOP:35984396 - BRAF transcript: Substitution in position 1385 of G replaced by T measurement OMOP:35984585 - BRCA1 transcript: Substitution in position 390 of C replaced by A measurement OMOP:35984599 - BRCA1 transcript: Substitution in position 4358-46 of C replaced by T measurement OMOP:35984973 - BRCA2 transcript: Substitution in position 2960 of A replaced by T measurement OMOP:35985062 - BRCA2 transcript: Substitution in position 7188 of G replaced by T measurement OMOP:35985095 - BRCA2 transcript: Substitution in position 7826 of G replaced by A measurement OMOP:35985100 - BRCA2 transcript: Substitution in position 7930 of A replaced by G measurement OMOP:35985601 - CDH1 transcript: Substitution in position 2471 of C replaced by T measurement OMOP:35985604 - CDH1 transcript: Substitution in position 2521 of G replaced by A measurement OMOP:35985824 - CDKN2A transcript: Substitution in position 149 of A replaced by G measurement OMOP:35985839 - CDKN2A transcript: Substitution in position 199 of G replaced by C measurement OMOP:35985889 - CDKN2A transcript: Substitution in position 457+1105 of C replaced by A measurement OMOP:35985975 - CHEK2 transcript: Substitution in position 1448 of A replaced by G measurement OMOP:35986201 - CTNNB1 transcript: Substitution in position 109 of T replaced by G measurement OMOP:35986237 - CYLD transcript: Substitution in position 1112 of C replaced by A measurement OMOP:35986268 - DDR2 transcript: Substitution in position 757 of G replaced by T measurement OMOP:35986397 - DYRK1B transcript: Substitution in position 83 of T replaced by C measurement OMOP:35986401 - EED transcript: Substitution in position 772 of C replaced by T measurement OMOP:35986890 - EGFR transcript: Substitution in position 629-15 of T replaced by C measurement OMOP:35986893 - EGFR transcript: Substitution in position 664 of C replaced by T measurement OMOP:35986965 - EPHB4 transcript: Substitution in position 1546 of G replaced by A measurement OMOP:35987210 - ERBB2 transcript: Substitution in position 1022-41 of G replaced by A measurement OMOP:35987220 - ERBB2 transcript: Substitution in position 1149-28 of C replaced by T measurement OMOP:35987233 - ERBB2 transcript: Substitution in position 1345 of G replaced by A measurement OMOP:35987292 - ERBB2 transcript: Substitution in position 201 of C replaced by A measurement OMOP:35987360 - ERBB2 transcript: Substitution in position 2650-8 of C replaced by A measurement OMOP:35987540 - ERBB3 transcript: Substitution in position 1493 of A replaced by T measurement OMOP:35987590 - ERBB3 transcript: Substitution in position 785 of C replaced by A measurement OMOP:35987800 - ETV6 transcript: Substitution in position 641 of C replaced by T measurement OMOP:35987917 - FANCA transcript: Substitution in position 4064 of A replaced by T measurement OMOP:35988014 - FANCG transcript: Substitution in position 988 of C replaced by T measurement OMOP:35988063 - FANCM transcript: Substitution in position 3758 of A replaced by G measurement OMOP:35988297 - FGFR3 transcript: Substitution in position 1138 of G replaced by A measurement OMOP:35988375 - FGFR3 transcript: Substitution in position 43 of G replaced by A measurement OMOP:35988844 - HRAS transcript: Substitution in position -18 of G replaced by A measurement OMOP:35988933 - IDH1 transcript: Substitution in position 699-28 of T replaced by C measurement OMOP:35989133 - IL7R transcript: Substitution in position 197 of T replaced by C measurement OMOP:36031408 - Age when stopped substance abuse OMOP:35989869 - MED12 transcript: Substitution in position 3670 of C replaced by G measurement OMOP:35990365 - MSH2 transcript: Substitution in position 2063 of T replaced by G measurement OMOP:35990376 - MSH2 transcript: Substitution in position 2168 of C replaced by T measurement OMOP:35990618 - MSH6 transcript: Substitution in position 2836 of G replaced by T measurement OMOP:35990791 - MTOR transcript: Substitution in position 1657 of C replaced by T measurement OMOP:35990838 - MTOR transcript: Substitution in position 4447 of T replaced by C measurement OMOP:35991535 - NOTCH1 transcript: Substitution in position 2079 of C replaced by A measurement OMOP:35991825 - NOTCH2 transcript: Substitution in position 4999 of G replaced by A measurement OMOP:35991853 - NOTCH3 transcript: Substitution in position 1487 of C replaced by T measurement OMOP:35991862 - NOTCH3 transcript: Substitution in position 3399 of C replaced by A measurement OMOP:35991943 - NRAS transcript: Substitution in position 38 of G replaced by C measurement OMOP:35992950 - PDGFRB transcript: Substitution in position 1912+5 of G replaced by T measurement OMOP:35992964 - PDGFRB transcript: Substitution in position 2011 of T replaced by A measurement OMOP:35993023 - PDGFRB transcript: Substitution in position 2929 of T replaced by A measurement OMOP:35993062 - PDGFRB transcript: Substitution in position 347 of T replaced by C measurement OMOP:35993282 - PIK3CA transcript: Substitution in position 2728 of A replaced by G measurement OMOP:35993462 - POLE transcript: Substitution in position 1366 of G replaced by C measurement OMOP:35993967 - RB1 transcript: Substitution in position 2023 of G replaced by T measurement OMOP:35994274 - RET transcript: Substitution in position 1099 of A replaced by G measurement OMOP:35994333 - RET transcript: Substitution in position 1264-490 of A replaced by G measurement OMOP:35994352 - RET transcript: Substitution in position 1336 of G replaced by C measurement OMOP:35994404 - RET transcript: Substitution in position 1649-207 of G replaced by A measurement OMOP:35994504 - RET transcript: Substitution in position 1902 of C replaced by G measurement OMOP:35994565 - RET transcript: Substitution in position 2136+899 of C replaced by T measurement OMOP:35994608 - RET transcript: Substitution in position 2293 of T replaced by C measurement OMOP:35994655 - RET transcript: Substitution in position 2611 of G replaced by A measurement OMOP:35994657 - RET transcript: Substitution in position 2641 of C replaced by G measurement OMOP:35994773 - RIT1 transcript: Substitution in position 270 of G replaced by C measurement OMOP:35994776 - RIT1 transcript: Substitution in position 365 of G replaced by T measurement OMOP:35995207 - SF3B1 transcript: Substitution in position 2225 of G replaced by A measurement OMOP:35995321 - SMO transcript: Substitution in position 808 of G replaced by A measurement OMOP:35995549 - SUZ12 transcript: Substitution in position 1829 of A replaced by T measurement OMOP:35995644 - TERT transcript: Substitution in position 2131-21 of T replaced by C measurement OMOP:35995666 - TERT transcript: Substitution in position 2582+2 of T replaced by C measurement OMOP:35995690 - TERT transcript: Substitution in position 3207 of C replaced by T measurement OMOP:35995693 - TERT transcript: Substitution in position 3251 of G replaced by A measurement OMOP:35995919 - TMPRSS2 transcript: Substitution in position 239-2307 of G replaced by C measurement OMOP:35996360 - TP53 transcript: Substitution in position 395 of A replaced by C measurement OMOP:35996524 - TSC1 transcript: Substitution in position 658 of G replaced by T measurement OMOP:35997101 - VHL transcript: Substitution in position 256 of C replaced by G measurement OMOP:35997144 - VHL transcript: Substitution in position 319 of C replaced by G measurement OMOP:35997263 - VHL transcript: Substitution in position 491 of A replaced by G measurement OMOP:36017909 - NPM1 protein expression measurement OMOP:36017938 - VHL protein expression measurement OMOP:36018079 - LRP5 on GRCh38 chr11: Substitution in position 68357801 of G replaced by A measurement OMOP:36018103 - MAP2K1 on GRCh38 chr15: Substitution in position 66436825 of C replaced by G measurement OMOP:36018106 - BLM on GRCh38 chr15: Substitution in position 90794311 of G replaced by C measurement OMOP:36018192 - TSC2 on GRCh38 chr16: Substitution in position 2088498 of C replaced by T measurement OMOP:36018810 - MLH1 on GRCh38 chr3: Substitution in position 37040199 of G replaced by T measurement OMOP:36018824 - PDGFRA on GRCh38 chr4: Substitution in position 54287476 of A replaced by G measurement OMOP:36018864 - EGFR on GRCh38 chr7: Substitution in position 55157738 of G replaced by A measurement OMOP:36018901 - AR on GRCh38 chrX: Substitution in position 67546285 of C replaced by G measurement OMOP:36022558 - HBB transcript: Substitution in position 280 of T replaced by C measurement OMOP:36022927 - LRP5 transcript: Substitution in position 593 of A replaced by G measurement OMOP:36025090 - PTEN transcript: Deletion in position 226 measurement OMOP:36025830 - TP53 transcript: Substitution in position 1010 of G replaced by A measurement OMOP:36031164 - Level of independence OMOP:36031226 - Mayaro virus neutralizing antibody [Titer] in Specimen by Neutralization test OMOP:36031228 - Azalea spp IgE Ab [Units/volume] in Serum OMOP:36031249 - Injection drug use Lifetime OMOP:36031250 - Straw dust IgE Ab [Units/volume] in Serum OMOP:36031296 - Total event-associated deaths among healthcare personnel [#] OMOP:36031425 - Beta cortolone [Z-score] in 24 hour Urine OMOP:36031430 - Total event-associated death rate per 100,000 population OMOP:36031449 - Date of most recent lab test for condition of interest OMOP:36031472 - IRF-PAI v3.0 - Staff assessment for mental status during assessment period [CMS Assessment] OMOP:36031548 - Chikungunya virus IgM Ab [Presence] in Specimen by Immunoassay OMOP:36031569 - O-nortramadol [Presence] in Urine by Screen method OMOP:36031570 - U.S. Child Food Security Survey [U.S. FSS - Child] OMOP:36031578 - Heartland banyangvirus IgM Ab [Presence] in Specimen by Immunoassay OMOP:36031599 - Neuronal intermediate filament IgG Ab [Presence] in Serum by Immunofluorescence OMOP:36031621 - Left retina Phase shift--light-adapted [Time] by PERG OMOP:36031678 - Bourbon virus IgG Ab [Presence] in Specimen by Immunoassay OMOP:36031688 - During the past 3 months, how often has your use of hallucinogens led to health, social, legal or financial problems [NIDA] OMOP:36031764 - Microscopic observation [Identifier] in Body fluid by Light microscopy OMOP:36031772 - Help reading hospital materials OMOP:36031993 - During the past 3 months, how often have you failed to do what was normally expected of you because of your use of hallucinogens [NIDA] OMOP:36032114 - Adenovirus DNA [Presence] in Respiratory system specimen by NAA with probe detection OMOP:36032257 - Rho GTPase-activating protein 26 IgG Ab [Presence] in Cerebral spinal fluid by Immunofluorescence OMOP:36032292 - Right macula P1 amplitude--light-adapted by mfERG OMOP:36032391 - Adrenal malignancy other than ACC probability [Likelihood] based on clinical and lab data OMOP:36203224 - LCDS v4.00 - Administrative information - expired during assessment period [CMS Assessment] OMOP:36203265 - Program interruption date during assessment period [CMS Assessment] OMOP:36203313 - Home environment safety and stability - visual analog rating [ePCAM] OMOP:36203337 - IRF-PAI - Speech-language pathology services - week 1 [CMS Assessment] OMOP:36203381 - PRRSV Ingelvac ATP strain ORF5 gene [Cycle Threshold #] in Specimen by NAA with probe detection OMOP:36203382 - PRRSV IgG Ab/Positive control in Saliva (oral fluid) by Immunoassay OMOP:36203462 - Indicate the patient's primary medical condition category during 3 day assessment period [CMS Assessment] OMOP:36203486 - Occupation industry CDC Census code OMOP:36203512 - Previous rubella virus test result OMOP:36203578 - Enterococcus sp DNA [Presence] by NAA with non-probe detection in Positive blood culture OMOP:36203640 - Lawsonia intracellularis RNA [#/volume] in Specimen by NAA with probe detection OMOP:36203753 - Varicella zoster virus clade [Type] in Specimen by Molecular genetics method OMOP:36203923 - Streptococcus pneumoniae Danish serotype 14 IgG Ab [Mass/volume] in Serum by Immunoassay OMOP:36203991 - Streptococcus pneumoniae Danish serotype 17F IgG Ab [Mass/volume] in Serum by Immunoassay OMOP:36204016 - Streptococcus pneumoniae Danish serotype 2 IgG Ab [Mass/volume] in Serum OMOP:36204263 - JC virus DNA [Presence] in Blood by NAA with probe detection OMOP:36204353 - Streptococcus pneumoniae Danish serotype 8 IgG Ab [Units/volume] in Serum OMOP:36204399 - Chlamydia trachomatis+Neisseria gonorrhoeae tests - FPAR 2.0 set OMOP:36204477 - Degree of difficulty experienced due to your hip while rising from sitting in the last week [HOOS] OMOP:36204502 - 1 step (curb) - functional ability during 3 day assessment period [CMS Assessment] OMOP:36204541 - Wheel 150 feet - functional ability during 3 day assessment period [CMS Assessment] OMOP:36303239 - Bone ash/Bone.total in Bone OMOP:36303312 - Compared to 10 years ago, has there been any change in finding the way back to a meeting spot in the mall or other location [ECog.Partner] OMOP:36303366 - OASIS E - Self-care - discharge performance during assessment period [CMS Assessment] OMOP:36303398 - Protein S Ag and protein S Ag.free panel - Platelet poor plasma by Immunoassay OMOP:36303480 - Dimensions of unhealed stage 3 or 4 pressure injuries or eschar during assessment period [CMS Assessment] OMOP:36303570 - I am confident that I can tell a doctor concerns I have abou my child's health even when he or she does not ask Parent [PAM] OMOP:36303577 - Income status [CUBS] OMOP:36303595 - Lower body dressing - functional goal during assessment period [CMS Assessment] OMOP:36303749 - Senecavirus A [Presence] in Specimen by Organism specific culture OMOP:36303796 - Date physician documented GDR as clinically contraindicated during assessment period [CMS Assessment] OMOP:36303879 - Compared to 10 years ago, has there been any change in remembering things that happened recently (such as recent outings, events in the news) [ECog] OMOP:36303886 - Do you feel grinding, hear clicking or any other type of noise from your hip during the last week [HOOS] OMOP:36303960 - Have you modified your life style to avoid activities potentially damaging to your hip [HOOS] OMOP:36303986 - Date vaccination indication expires OMOP:36304042 - Birth certifier [Extended Identifier] OMOP:36304053 - Skin and ulcer/injury treatments during assessment period [CMS Assessment] OMOP:36304057 - OASIS C2 - Mobility during assessment period [CMS Assessment] OMOP:36304127 - Ribosomal P Ab [Presence] in Cerebral spinal fluid by Line blot OMOP:36304194 - MDS v3.0 - RAI v1.14.1, v1.15.1, v1.16.1 - Special treatments, procedures, and programs - NS, SS during assessment period [CMS Assessment] OMOP:36304205 - Compared to 10 years ago, has there been any change in understanding spoken directions or instructions [ECog.Partner] OMOP:36304231 - Body height Measured --at birth OMOP:36304233 - Swollen joint # OMOP:36304249 - Compared to 10 years ago, has there been any change in describing a program he or she has watched on TV [ECog.Partner] OMOP:36304258 - Type of blood thinning medication used OMOP:36304262 - Toxoplasma gondii DNA [Presence] in Bone marrow by NAA with probe detection OMOP:36304270 - Adenovirus [Presence] in Stool by Organism specific culture OMOP:36304352 - During the last 7 days, on how many days did you do vigorous physical activities like heavy lifting, chopping wood, shoveling snow, or digging in the garden or yard for at least 10 minutes at a time [IPAQ] OMOP:36304401 - Use of supplemental oxygen OMOP:36304429 - Pseudomonas aeruginosa sodA gene [Presence] by Probe in Positive blood culture OMOP:36304460 - Acinetobacter sp rpsA gene [Presence] by Probe in Positive blood culture OMOP:36304641 - MDS v3.0 - RAI v1.16.1 - Health conditions - NP, NQ, SP during assessment period [CMS Assessment] OMOP:36304657 - OASIS D - Patient history and diagnoses - follow-up during assessment period [CMS Assessment] OMOP:36304674 - Patient history and diagnoses - transfer or discharge from agency during assessment period [CMS Assessment] OMOP:36304675 - MDS v3.0 - RAI v1.16.1 - Health conditions during assessment period [CMS Assessment] OMOP:36304681 - Escherichia coli enteroaggregative astA gene [Presence] in Isolate by NAA with probe detection OMOP:36304684 - WBC casts [#/area] in Urine sediment OMOP:36304830 - During the last 7 days, on how many days did you do moderate activities like carrying light loads, washing windows, scrubbing floors and sweeping inside your home for at least 10 minutes at a time [IPAQ] OMOP:36304854 - Chlamydia trachomatis [Presence] in Tissue by Organism specific culture OMOP:36304871 - Degree of difficulty experienced due to your hip while doing heavy domestic duties (moving heavy boxes, scrubbing floors, etc) in the last week [HOOS] OMOP:36304952 - When all is said and done, I am the person who is responsible for taking care of my child's health Parent [PAM] OMOP:36304972 - Quality of life panel [HOOS] OMOP:36304986 - Memory panel [ECog.Partner] OMOP:36304997 - Mycobacterium tuberculosis stimulated gamma interferon release by CD4+ and CD8+ T-cells [Units/volume] in Blood OMOP:36305068 - Klebsiella pneumoniae yggE gene [Presence] by Probe in Positive blood culture OMOP:36305072 - Taenia solium larva Ag [Presence] in Serum by Immunoassay OMOP:36305100 - Babesia microti 18S rRNA gene [Presence] in Blood by NAA with non-probe detection OMOP:36305156 - MDS v3.0 - RAI v1.14.1, v1.15.1, v1.16.1 - Special treatments, procedures, and programs - NP, NQ during assessment period [CMS Assessment] OMOP:36305219 - Number of days of passive range of motion in last 7 calendar days [CMS Assessment] OMOP:36305237 - Oxygen saturation in Arterial blood by Pulse oximetry --W exercise OMOP:36305296 - Toxoplasma gondii [Presence] in Cerebral spinal fluid by Organism specific culture OMOP:36305362 - OASIS D - Sensory status - discharge from agency during assessment period [CMS Assessment] OMOP:36305609 - Tetradecenoylcarnitine (C14:1)/Carnitine.free (C0) [Molar ratio] in Serum or Plasma OMOP:36305631 - Compared to 10 years ago, has there been any change in remembering the meaning of common words [ECog.Partner] OMOP:36305670 - Symptoms present for at least 24 hours - Reported OMOP:36305711 - Walk 10 feet - functional ability during assessment period [CMS Assessment] OMOP:36305791 - Center for Epidemiologic Studies Depression Scale-Revised [CESD-R] OMOP:36305798 - Can you bend your knee fully during the last week [KOOS] OMOP:36305799 - Microscopic observation [Identifier] in Contact lens by Gram stain OMOP:36305865 - OASIS D - Mobility - follow-up performance during assessment period [CMS Assessment] OMOP:36305888 - Airspeed--unladen OMOP:36306207 - ADAPTABLE patient reported item set [ADAPTABLE] OMOP:36306218 - Name not yet chosen OMOP:3654230 - Mosaic trisomy 1 syndrome OMOP:3654321 - Normal deep sensation OMOP:3654336 - Wound healing well OMOP:3654346 - Collapse due to asphyxia OMOP:3654420 - Only able to perceive light via pinhole with right eye OMOP:3654502 - Suspected high-grade urothelial carcinoma found on urine cytology OMOP:3654597 - Stenosis of cerebral artery OMOP:3654607 - Adenoma of bronchial mucous gland OMOP:3654647 - B lymphoblastic leukemia lymphoma with t(5;14)(q31;q32); IL3-IGH OMOP:3654650 - B lymphoblastic leukemia lymphoma with t(1;19)(Q23;P13.3); E2A-PBX1 (TCF3/PBX1) OMOP:3654662 - Acute myeloid leukemia with CBFB::MYH11 fusion OMOP:3654701 - Able to see hand movement via pinhole with right eye OMOP:3654725 - Severe mitral valve stenosis OMOP:3654782 - Accidental poisoning caused by methylenedioxymethamphetamine OMOP:3654861 - Shiga toxin-producing Escherichia coli serogroup O60 OMOP:3654898 - Encephalitis caused by Leptospira OMOP:3654920 - Dementia due to carbon monoxide poisoning OMOP:3654964 - Complex mixed and stromal malignant neoplasm of endometrium of corpus uteri OMOP:3654971 - Burn of digit of hand OMOP:3654978 - Assessment using University of Pennsylvania Smell Identification Test OMOP:3655031 - Decreased emotional excitability OMOP:3655063 - Clear lens of eye OMOP:3655074 - Multidrug-resistant Salmonella enterica subspecies enterica serovar Typhi OMOP:3655117 - Bronchitis caused by vapors OMOP:3655119 - Respiratory condition caused by vapors OMOP:3655185 - Gangrene of mesentery of jejunum OMOP:3655188 - Injury of lumbar nerve root OMOP:3655207 - Blood clot embolism due to and following molar pregnancy OMOP:3655274 - Epilepsy due to infectious encephalitis OMOP:3655276 - Epilepsy due to infectious meningitis OMOP:3655294 - Gastrointestinal stromal neoplasm of overlapping sites of small intestine OMOP:3655355 - Erectile dysfunction OMOP:3655361 - Erectile dysfunction due to endocrine disease OMOP:3655398 - At moderate risk of ulcer of right foot due to diabetes mellitus OMOP:3655425 - Uterine perforation post procedural OMOP:3655507 - Mood Disorder Questionnaire OMOP:3655532 - Cellulosilyticum OMOP:3655592 - Myelitis caused by Dengue virus OMOP:3655623 - Mansonelliasis caused by Mansonella streptocerca OMOP:3655654 - Myelitis caused by Plasmodium OMOP:3655661 - Infestation of eyelid caused by Loa loa OMOP:3655670 - Infection of peripheral nerve caused by fungus OMOP:3655728 - Patella alta OMOP:3655760 - Occlusion of posterior lateral branch of right coronary artery OMOP:3655772 - Relative energy rate OMOP:3655824 - Pelizaeus Merzbacher like disease due to AIMP1 mutation OMOP:3655875 - Neuropathic ulceration of skin caused by Mycobacterium leprae OMOP:3655880 - Neonatal nutritional zinc deficiency OMOP:3655957 - Closed fracture of base of skull with cerebral laceration OMOP:3655979 - Walking OMOP:3656017 - Fetal heart baseline rate range 120 to 160 OMOP:3656029 - No psychosis present OMOP:3656062 - Complication due to and following superior cavopulmonary anastomosis OMOP:3656079 - Double outlet right ventricle with subaortic ventricular septal defect and pulmonary stenosis Fallot type OMOP:3656195 - Non centrally involved macular edema due to diabetes mellitus OMOP:3656242 - Able to demonstrate health literacy OMOP:3656364 - Haemophilus influenzae type b capsular polysaccharide polyribosylribitol phosphate antigen conjugated to Corynebacterium diphtheriae CRM197 protein OMOP:3656859 - Total ophthalmoplegia of right eye OMOP:3656959 - Postinflammatory chorioretinal scar of left eye OMOP:3656968 - Partial occlusion of left retinal artery OMOP:3656996 - Expulsive hemorrhage of choroid of left eye OMOP:3657036 - Bilateral sector visual field defect of eyes OMOP:3657046 - Peripheral opacity of bilateral corneas OMOP:3657048 - Bilateral cycloplegia of eyes OMOP:3657060 - Bilateral disseminated chorioretinitis of eyes OMOP:3657110 - Bilateral synechia of irises OMOP:3657131 - Bilateral Terrien's marginal degeneration of peripheral corneas OMOP:3657137 - Anterior subluxation of lens of right eye OMOP:3657159 - Carbapenemase-producing Acinetobacter radioresistens OMOP:3657402 - PedsQL (Pediatric Quality of Life) Inventory 4.0 Generic Core Scale Parent Report for Children (ages 8-12) Mean score OMOP:3657523 - Recently performed insertion of nasogastric tube OMOP:3657524 - Recently performed removal of nasal foreign body OMOP:3657579 - Cardiac physiology service OMOP:3657589 - Paediatric oral and maxillofacial surgery service OMOP:3657601 - Perinatal POEM (Patient rated Outcome and Experience Measure) score - When I first came into contact with the service, I was OMOP:3657610 - Perinatal POEM (Patient rated Outcome and Experience Measure) score - Staff helped me to understand my illness/difficulties OMOP:3657643 - Commotio retinae of left retina OMOP:3657644 - Stab wound of left upper arm OMOP:3657663 - Abrasion of skin of right wrist region OMOP:3657781 - Vortex keratopathy of right eye OMOP:3657798 - Capillary hemangioma of left orbit region OMOP:3657805 - Disorder of skin of right eyelid OMOP:3657828 - Congenital anomaly of left sclera OMOP:3657835 - Retinal deposits of left eye OMOP:3657866 - Bilateral cicatricial ectropion OMOP:3657868 - Bilateral cicatricial entropion of upper eyelids OMOP:3657891 - Blepharitis of left upper and lower eyelids OMOP:3657919 - Gunshot wound of left buttock OMOP:3657930 - Stab wound of right thigh OMOP:3657939 - Infected abrasion of skin of lesser toe of right foot OMOP:3657965 - Infected abrasion of oral mucosa OMOP:3657974 - Scar epilepsy OMOP:3661414 - Cholesterol calculus of gallbladder OMOP:3661426 - Closed volar dislocation OMOP:3661462 - Thickening of bone at joint OMOP:3661463 - Mucopurulent discharge OMOP:3661469 - Allergic rhinosinusitis caused by Aspergillus OMOP:3661517 - Adverse reaction to platelet aggregation inhibitor OMOP:3661522 - Phosphate staghorn calculus OMOP:3661547 - Acute ST segment elevation myocardial infarction due to occlusion of diagonal branch of anterior descending branch of left coronary artery OMOP:3661592 - Necrotic eschar OMOP:3661644 - Acute ST segment elevation myocardial infarction due to occlusion of marginal branch of right coronary artery OMOP:3661657 - Milch type I fracture OMOP:3661676 - Myeloablative conditioning regimen OMOP:3661707 - Vasopressor adverse reaction OMOP:3661726 - Closed avulsion OMOP:3661783 - Able to manage residence-related activities OMOP:3661809 - Adverse reaction to dihydroergocornine and/or dihydroergocristine and/or dihydroergocryptine OMOP:3661854 - Cough peak expiratory flow measurement OMOP:3661884 - Bereavement in remission OMOP:3661889 - QOF (Quality and Outcomes Framework) non-diabetic hyperglycaemia quality indicator-related care invitation using preferred method of communication OMOP:3661912 - Requires chaperone OMOP:3662134 - Trichorionic triamniotic triplet pregnancy OMOP:3662135 - Dichorionic triamniotic triplet pregnancy OMOP:3662175 - Abrasion of skin of lip OMOP:3663224 - Myelitis caused by human poliovirus OMOP:36659621 - Need for and availability of a manual wheelchair during assessment period [CMS Assessment] OMOP:36659629 - PPOX gene full mutation analysis in Blood or Tissue by Sequencing OMOP:36659922 - UGT2B15 gene c.253G>T [Genotype] in Blood or Tissue by Molecular genetics method Nominal OMOP:36659996 - Revised Pretransplant Assessment of Mortality (PAM) Score panel OMOP:36660103 - Alloisoleucine [Moles/volume] in Serum or Plasma --post therapeutic diet OMOP:36660142 - Avian infectious laryngotracheitis virus RNA [#/volume] (viral load) in Specimen by NAA with probe detection OMOP:36660275 - Dermatan sulfate and heparan sulfate and keratan sulfate panel - DBS OMOP:36660322 - Lensmeter panel OMOP:36660330 - U.S. Household Food Security Survey Score [U.S. FSS] OMOP:36660364 - Human coronavirus OC43 RNA [Presence] in Lower respiratory specimen by NAA with non-probe detection OMOP:36660409 - Lower body dressing - usual functional ability during assessment period [CMS Assessment] OMOP:36660417 - DOPamine [Mass/volume] in Plasma --standing OMOP:36660456 - Wheels for 15 minutes - usual functional ability during assessment period [CMS Assessment] OMOP:36660613 - Food security status [U.S. FSS] OMOP:36661371 - SARS-CoV-2 (COVID-19) N gene [Log #/volume] (viral load) in Respiratory system specimen by NAA with probe detection OMOP:3667000 - Allergic contact dermatitis caused by usnic acid OMOP:3667045 - Allergy to cellulose and/or cellulose derivative OMOP:3667061 - Allergy to ampicillin and/or cloxacillin OMOP:36674191 - Intellectual disability, seizures, hypotonia, ophthalmologic, skeletal anomalies syndrome OMOP:36674228 - Familial omphalocele syndrome with facial dysmorphism OMOP:36674380 - Proliferative hyperkeratosis OMOP:36674381 - Onychocytic matricoma OMOP:36674389 - Autosomal dominant rhegmatogenous retinal detachment OMOP:36674406 - Mollusk venom OMOP:36674550 - Genus Actinotalea OMOP:36674571 - Pestalotiopsis monochaeta OMOP:36674647 - Sphingobacterium hotanense OMOP:36674786 - Genus Meripilus OMOP:36674787 - Combined immunodeficiency with faciooculoskeletal anomalies syndrome OMOP:36674895 - Deep partial thickness burn of skin of upper and lower lip OMOP:36674907 - 11p15.4 microduplication syndrome OMOP:36674969 - Monosomy 9p OMOP:36675015 - Deep full thickness burn involving muscle OMOP:36675025 - Pseudoleprechaunism syndrome Patterson type OMOP:36675057 - Immune dysregulation, inflammatory bowel disease, arthritis, recurrent infection syndrome OMOP:36675094 - Stability of metacarpophalangeal joint OMOP:36675096 - Stability of lumbar spine joint OMOP:36675097 - Stability of intercarpal joint OMOP:36675104 - Stability of midtarsal joint OMOP:36675111 - Hypoactive postoperative delirium OMOP:36675166 - Open fractures involving multiple regions of right upper limb OMOP:36675174 - Hypertrophic cardiomyopathy and renal tubular disease due to mitochondrial DNA mutation OMOP:36675211 - Measurement of periodontal pocket depth-four areas per tooth exam OMOP:36675242 - Calcitonin gene-related peptide receptor antagonist OMOP:36675670 - Rhabdoid tumor predisposition syndrome OMOP:36675673 - Recreational drug misuse withdrawal OMOP:36675700 - Suspected meningococcemia OMOP:36676447 - 20p13 microdeletion syndrome OMOP:36676511 - Autosomal recessive intermediate Charcot-Marie-Tooth disease type C OMOP:36676516 - Severe intellectual disability, short stature, behavioral abnormalities, facial dysmorphism syndrome OMOP:36676636 - Sting by insect OMOP:36676676 - Frontonasal dysplasia, severe microphthalmia, severe facial clefting syndrome OMOP:36676686 - Recurrent umbilical hernia OMOP:36676707 - Hepatitis A virus genotype IIA OMOP:36676741 - Antiinflammatory therapeutic role OMOP:36676748 - Antirheumatic therapeutic role OMOP:36676825 - Antithyroid therapeutic role OMOP:36676841 - Pain of right shoulder blade OMOP:36676899 - Growth and developmental delay, hypotonia, vision impairment, lactic acidosis syndrome OMOP:36676905 - Severe dermatitis, multiple allergies, metabolic wasting syndrome OMOP:36680577 - Hypomyelination with brain stem and spinal cord involvement and leg spasticity OMOP:36680578 - 3q26q27 microdeletion syndrome OMOP:36680580 - SCN2A encephalopathy OMOP:36680588 - Skin fragility, wooly hair, palmoplantar keratoderma syndrome OMOP:36683251 - Desmoplastic infantile astrocytoma and ganglioglioma OMOP:36683380 - Postoperative wound cellulitis OMOP:36683393 - NSR-neutral, sidebent, and rotated vertebral position OMOP:36683512 - Purine antagonist OMOP:36683650 - Salinicoccus roseus OMOP:36684080 - Enostosis of left pelvis OMOP:36684107 - Intolerance to substance OMOP:36684135 - Shiga toxin-producing Escherichia coli serogroup O5 OMOP:36684144 - Shiga toxin-producing Escherichia coli serogroup O152 OMOP:36684145 - Shiga toxin-producing Escherichia coli serogroup O153 OMOP:36684149 - Shiga toxin-producing Escherichia coli serogroup O165 OMOP:36684174 - Shiga toxin-producing Escherichia coli serogroup O141 OMOP:36684203 - Immune-mediated neuropathy OMOP:36684222 - Family Erwiniaceae OMOP:36684295 - Brevibacillus gelatini OMOP:36684328 - Acute severe exacerbation of allergic asthma OMOP:36684422 - Neoplasm of uncertain behavior of ear OMOP:36684460 - Myofascial pain syndrome of lumbar spine OMOP:36684497 - Contracture of muscle of right upper arm OMOP:36684511 - Ganglion cyst of left knee OMOP:36684564 - Bone spur of left shoulder OMOP:36684608 - Right wrist drop OMOP:36684667 - Chronic conjunctivitis of right eye OMOP:36684681 - Serous detachment of left retinal pigment epithelium OMOP:36684683 - Schisis of left retina OMOP:36684712 - Low tension glaucoma of left eye OMOP:36684723 - Ectropion of left eyelid OMOP:36684741 - Cyst of right eyelid OMOP:36684745 - Hemorrhage of bilateral vitreous bodies OMOP:36684773 - Bilateral drusen of maculae OMOP:36684777 - Bilateral keratoconjunctivitis of eyes OMOP:36684791 - Bilateral congenital cataract of eyes OMOP:36684934 - Body height measurement declined OMOP:36685004 - Ataxia due to and following ischemic cerebrovascular accident OMOP:36685021 - Rheumatoid arthritis of right ankle OMOP:36685066 - Bilateral acquired deformity of pinnas OMOP:36685098 - Labyrinthitis of bilateral inner ears OMOP:36685112 - Hematoma of bilateral pinnas OMOP:36685128 - Acquired stenosis of left external auditory canal OMOP:36685133 - Recurrent acute suppurative otitis media of left ear with spontaneous rupture of tympanic membrane OMOP:36685138 - Central perforation of left tympanic membrane OMOP:36685156 - Disorder of left Eustachian tube OMOP:36685192 - Recurrent ulcer of vulva caused by human herpes simplex virus OMOP:36685194 - Recurrent inflammation of vulva caused by human herpes simplex virus OMOP:36685222 - Dermatitis of right external ear canal OMOP:36685230 - Lesion of right external ear canal OMOP:36685237 - Labyrinthitis of right inner ear OMOP:36685286 - Touch sensation of left dermatome of third thoracic nerve reduced OMOP:36685287 - Touch sensation of right dermatome of third thoracic nerve absent OMOP:36685347 - Touch sensation of left dermatome of eleventh thoracic nerve absent OMOP:36685544 - Referral to alcohol misuse service OMOP:36685629 - Military clerk OMOP:36685699 - Royal Signals personnel OMOP:36685726 - Certifying organisation OMOP:36685770 - Eating minced and moist food (IDDSI (International Dysphagia Diet Standardisation Initiative) level 5) with acknowledged risk of aspiration OMOP:36685774 - Able to swallow soft and bite-sized food - IDDSI (International Dysphagia Diet Standardisation Initiative) level 6 OMOP:36685845 - Upper limb neurodynamic test 3 ulnar nerve heightened mechanosensitivity detected OMOP:36685874 - Reviewed by advanced primary nurse OMOP:36685895 - Child 3 year examination not offered OMOP:36685903 - Triple test offered OMOP:36685914 - Screening not offered OMOP:36685940 - Abscess of thumb of left hand OMOP:36685942 - Abscess of left thigh OMOP:36685950 - Abscess of right upper limb OMOP:36685955 - Cellulitis of right ankle OMOP:36685957 - Cellulitis of right knee OMOP:36685975 - Bilateral localized swelling of feet OMOP:36685983 - Bilateral localized swelling of hands OMOP:36686031 - Mass of skin of left forearm OMOP:36686108 - Open wound of right breast due to bite OMOP:36686139 - Open wound of left eyelid due to dog bite OMOP:36686173 - Open wound of face due to dog bite OMOP:36686175 - Open wound of jaw due to dog bite OMOP:36686182 - Open wound of jaw due to bite OMOP:36686186 - Laceration of right upper arm OMOP:36686205 - Open wound of left hand due to animal bite OMOP:36686215 - Open wound of neck due to dog bite OMOP:36686332 - Injury of digital nerve of finger of right hand OMOP:36686356 - Contusion of right little finger OMOP:36686385 - Crush injury of right middle finger OMOP:36686410 - Laceration of splenic artery OMOP:36686415 - Injury of right renal vein OMOP:36686456 - Injury of tendon of right hand OMOP:36686468 - Laceration of muscle of left foot OMOP:36687006 - Rheumatoid arthritis of bilateral wrists OMOP:36687027 - Bilateral boutonniere deformity of finger of hands OMOP:36687043 - Bilateral contracture of joints of ankles OMOP:36687045 - Bilateral contracture of joints of wrists OMOP:36687068 - Bilateral sinus tarsi syndrome of ankles OMOP:36687084 - Hypertrophy of left masseter muscle OMOP:36687120 - Lesion of right lower eyelid OMOP:36687128 - Flexion deformity of finger of bilateral hands OMOP:36687134 - Right parotid gland swelling OMOP:36687136 - Left subclavian steal syndrome OMOP:36687150 - Bilateral displacement of temporomandibular joint meniscuses OMOP:36687151 - Displacement of meniscus of left temporomandibular joint OMOP:36687169 - Accessory auricle of left ear OMOP:36687176 - Uveitis of left eye caused by Toxoplasma gondii OMOP:36687181 - Bilateral instability of both feet OMOP:36712677 - Bleeding requiring transfusion OMOP:36712701 - Blepharitis of bilateral upper eyelids OMOP:36712724 - Infiltrating lobular carcinoma of left female breast OMOP:36712762 - Recurrent malignant neoplasm of prostate OMOP:36712781 - Xanthoma of bilateral eyelids OMOP:36712797 - Entropion of bilateral eyelids OMOP:36712818 - Postprocedural intraabdominal abscess OMOP:36712858 - Injury due to activity involving bicycle riding OMOP:36712879 - Pseudarcicella OMOP:36712905 - Paenibacillus residui OMOP:36712952 - Aneurysm of right internal carotid artery OMOP:36712963 - Gangrene of left lower limb due to atherosclerosis OMOP:36712964 - Congenital bilateral internal tibial torsion OMOP:36713113 - Saddle embolus of pulmonary artery OMOP:36713119 - Acute anterior uveitis of right eye OMOP:36713153 - Bilateral absolute glaucoma OMOP:36713247 - Beechnut OMOP:36713290 - Psychotropic overdose OMOP:36713335 - Partial thickness macular hole of left eye OMOP:36713425 - Congenital hemorrhagic renal cyst OMOP:36713440 - Alport syndrome autosomal dominant OMOP:36713446 - COG7 congenital disorder of glycosylation OMOP:36713491 - Disorder of esophageal peristalsis OMOP:36713504 - Vascular disorder of the stomach OMOP:36713570 - BRESEK syndrome OMOP:36713574 - Acquired absence of uterus OMOP:36713584 - Chloride non-responsive metabolic alkalosis OMOP:36713608 - Entrapment of superficial branch of radial nerve OMOP:36713650 - Bethlem myopathy OMOP:36713766 - Lissencephaly type 3 familial fetal akinesia sequence syndrome OMOP:36713781 - RCADS (Revised Children's Anxiety and Depression Scale) panic subscale OMOP:36713793 - Episodic ataxia type 4 OMOP:36713961 - Tumor protein p53 detected OMOP:36714118 - Cryptogenic organizing pneumonia OMOP:36714119 - Anaerobic Gram-positive bacillus, not Clostridium perfringens OMOP:36714120 - Abnormal prominence of clavicle OMOP:36714182 - Spondylometaphyseal dysplasia Schmidt type OMOP:36714289 - Congenital bile acid synthesis defect type 3 OMOP:36714333 - Autosomal dominant Charcot-Marie-Tooth disease type 2N OMOP:36714519 - Carbapenem resistant Proteus mirabilis OMOP:36714729 - Leishmania donovani IgG OMOP:36714793 - Borrelia garinii IgG OMOP:36714832 - Echovirus IgM OMOP:36714860 - Parainfluenza virus 4 IgG OMOP:36714922 - Orientia tsutsugamushi Kato IgM OMOP:36714974 - Acrorenoocular syndrome OMOP:36715002 - Acropectorovertebral dysplasia OMOP:36715032 - Anophthalmia plus syndrome OMOP:36715053 - Autosomal dominant macrothrombocytopenia OMOP:36715094 - Brain calcification Rajab type OMOP:36715190 - Clostridium botulinum Group II OMOP:36715219 - Corneal cerebellar syndrome OMOP:36715269 - Craniosynostosis with Dandy-Walker malformation and hydrocephalus syndrome OMOP:36715272 - Craniosynostosis and intracranial calcification syndrome OMOP:36715318 - Yersinia enterocolitica serogroup O:4,33 OMOP:36715352 - Amaurosis hypertrichosis syndrome OMOP:36715372 - Hydrocephalus with endocardial fibroelastosis and cataract syndrome OMOP:36715404 - Short stature, pituitary and cerebellar defect and small sella turcica syndrome OMOP:36715430 - Sepsis due to urinary tract infection OMOP:36715462 - Hidrotic ectodermal dysplasia Halal type OMOP:36715486 - Intramucosal venous dilatation of esophagus OMOP:36715490 - Long gap esophageal atresia OMOP:36715496 - Myopathy due to magnesium deficiency OMOP:36715501 - Polyneuropathy due to classical cystic fibrosis OMOP:36715510 - Acquired parafimbrial cyst of fallopian tube OMOP:36715517 - Familial developmental dysphasia OMOP:36715526 - Hydrolethalus syndrome OMOP:36715530 - Hyperinsulinism due to short chain 3-hydroxyacyl-coenzyme A dehydrogenase deficiency OMOP:36715559 - Pyogenic abscess of skin caused by bacterium OMOP:36715590 - Systemic Epstein-Barr virus positive T-cell lymphoproliferative disease of childhood OMOP:36715603 - Fracture of angle of mandible OMOP:36715639 - Complete lesion of cervical spinal cord at C7 level OMOP:36715658 - Posterior cord syndrome of cervical spinal cord at C4 level OMOP:36715673 - Injury of brachial plexus trunk OMOP:36715722 - Anterior cord syndrome of thoracic spinal cord at T12 level OMOP:36715727 - Posterior cord syndrome of thoracic spinal cord at T4 level OMOP:36715740 - Brown-Séquard syndrome at T6 level OMOP:36715777 - Central neurocytoma of brain OMOP:36715806 - Sepsis caused by Pseudomonas aeruginosa OMOP:36715810 - Primary liposarcoma of male genital organ OMOP:36715811 - Primary synovial sarcoma of soft tissue of limb OMOP:36715833 - Primary choriocarcinoma of testis OMOP:36715857 - Primary malignant neuroendocrine neoplasm of stomach OMOP:36715879 - Radiation induced enteritis of small intestine OMOP:36715899 - Colitis caused by Salmonella OMOP:36715903 - Inflammatory polyps co-occurrent and due to inflammatory bowel disease OMOP:36715929 - Adenoma of ampulla of Vater OMOP:36715934 - Non-retentive fecal incontinence OMOP:36715948 - Otitis media caused by Streptococcus pneumoniae OMOP:36715973 - Meningitis caused by Human cytomegalovirus 5 OMOP:36715976 - Infection caused by Erythroparvovirus OMOP:36715981 - Infection caused by Guanarito virus OMOP:36716023 - Infection caused by Brugia OMOP:36716036 - Dematiaceous mold OMOP:36716042 - Mendelian susceptibility to mycobacterial disease due to complete interferon gamma receptor 2 deficiency OMOP:36716114 - Lymphedema and cerebral arteriovenous anomaly syndrome OMOP:36716136 - Juvenile temporal arteritis OMOP:36716138 - Kallman syndrome with heart disease OMOP:36716158 - Oculotrichodysplasia OMOP:36716172 - Obstructive nephropathy due to prostate cancer OMOP:36716203 - Overhydrated hereditary stomatocytosis OMOP:36716213 - Physiotherapy OMOP:36716254 - Pai syndrome OMOP:36716394 - Celiac disease with epilepsy and cerebral calcification syndrome OMOP:36716443 - Gomez Lopez Hernandez syndrome OMOP:36716495 - Non-ulcerative sexually transmitted infection caused by Chlamydia trachomatis OMOP:36716504 - Fetal intrauterine intestinal perforation due to in utero intraluminal obstruction OMOP:36716507 - Toxic enteritis of small intestine OMOP:36716513 - Pancreatitis due to pancreatic duct obstruction OMOP:36716518 - Infection caused by Toxoplasma OMOP:36716558 - Non-amnestic Alzheimer disease OMOP:36716587 - Puncture wound of neck without foreign body OMOP:36716614 - Primary mucinous adenocarcinoma of endometrium OMOP:36716617 - Primary neuroendocrine carcinoma of cervix uteri OMOP:36716631 - Occupational cancer of skin OMOP:36716646 - CDC group IIb OMOP:36716726 - Acute Chagas disease without heart involvement OMOP:36716729 - Polymicrobial necrotizing fasciitis OMOP:36716772 - Familial Ménière disease OMOP:36716788 - Tremor due to substance abuse OMOP:36716821 - Acquired symblepharon OMOP:36716846 - Tetanus vaccination declined by patient OMOP:36716848 - Parastomal hernia with gangrene OMOP:36716876 - Gastric ulcer caused by virus OMOP:36716896 - Primary progressive apraxia of speech OMOP:36716913 - Autonomic disorder co-occurrent and due to Chagas disease OMOP:36716923 - Diplegia of lower limbs OMOP:36716937 - Carcinosarcoma of uterine adnexa OMOP:36716958 - Sedimentation technique OMOP:36717009 - Minor amount of residual staining, small fragments of stool, and/or opaque liquid, but mucosa of colon segment is seen well, 2 OMOP:36717013 - Chondromalacia of right patella OMOP:36717038 - Bilateral secondary renal dysplasia OMOP:36717061 - Bartonella callosciuri OMOP:36717104 - Amblyopia of right eye OMOP:36717227 - Primary serous adenocarcinoma of endometrium OMOP:36717229 - Benign chondrogenic neoplasm OMOP:36717235 - Functional belching disorder OMOP:36717287 - Pain in bilateral lower legs OMOP:36717308 - Allergic contact dermatitis of left lower eyelid OMOP:36717359 - Systolic heart failure stage B due to ischemic cardiomyopathy OMOP:36717360 - Tenosynovitis of right radial styloid OMOP:36717399 - Multi-agency case management review meeting OMOP:36717439 - Short fifth metacarpal insulin resistance syndrome OMOP:36717457 - Infection causing inflammation of optic nerve OMOP:36717506 - Infection caused by Pseudallescheria OMOP:36717519 - Psychosomatic medicine OMOP:36717521 - Shigella flexneri serovar 6 biotype Manchester OMOP:36717562 - Matthew Wood syndrome OMOP:36717608 - Spinal cord compression due to degenerative disorder of spinal column OMOP:36717654 - Ablepharon macrostomia syndrome OMOP:36717734 - 1p21.3 microdeletion syndrome OMOP:36717782 - Human bocavirus Ag OMOP:36717914 - Post-membrane lung drainage; pre-membrane lung return OMOP:36728308 - BRAF transcript: Substitution in position 1785 of T replaced by A measurement OMOP:36728420 - BRCA2 transcript: Substitution in position 7506 of C replaced by G measurement OMOP:36731332 - RET on GRCh38 chr10: Substitution in position 43120152 of C replaced by T measurement OMOP:36732092 - ATM on GRCh38 chr11: Substitution in position 108316015 of C replaced by T measurement OMOP:36732998 - HBB on GRCh38 chr11: Substitution in position 5227002 of T replaced by A measurement OMOP:36733482 - MDM2 on GRCh38 chr12: Substitution in position 68808800 of T replaced by G measurement OMOP:36734129 - BRCA2 on GRCh38 chr13: Substitution in position 32340680 of G replaced by A measurement OMOP:36734361 - RB1 on GRCh38 chr13: Deletion in position 48360013 measurement OMOP:36734430 - BRCA2 on GRCh38 chr13: Substitution in position 32379513 of C replaced by A measurement OMOP:36736718 - CDH1 on GRCh38 chr16: Substitution in position 68737441 of C replaced by A measurement OMOP:36737268 - FANCA on GRCh38 chr16: Substitution in position 89811012 of C replaced by T measurement OMOP:36738717 - STK11 on GRCh38 chr19: Substitution in position 1220438 of T replaced by A measurement OMOP:36738760 - STK11 on GRCh38 chr19: Substitution in position 1223169 of C replaced by T measurement OMOP:36739101 - MTOR on GRCh38 chr1: Substitution in position 11241657 of A replaced by G measurement OMOP:36739140 - CIC on GRCh38 chr19: Substitution in position 42293039 of G replaced by A measurement OMOP:36741227 - CHEK2 on GRCh38 chr22: Deletion in position 28734445 measurement OMOP:36741577 - MSH6 on GRCh38 chr2: Deletion in position 47803663 measurement OMOP:36744177 - VHL on GRCh38 chr3: Substitution in position 10146580 of T replaced by G measurement OMOP:36744198 - VHL on GRCh38 chr3: Substitution in position 10149793 of C replaced by T measurement OMOP:36744283 - ATR on GRCh38 chr3: Substitution in position 142453222 of G replaced by C measurement OMOP:36744409 - MLH1 on GRCh38 chr3: Substitution in position 37025967 of G replaced by A measurement OMOP:36746019 - APC on GRCh38 chr5: Deletion in position 112839933 measurement OMOP:36746458 - APC on GRCh38 chr5: Duplication of position 112839533 to 112839534 measurement OMOP:36746538 - APC on GRCh38 chr5: Substitution in position 112775613 of A replaced by T measurement OMOP:36746637 - APC on GRCh38 chr5: Substitution in position 112838250 of C replaced by T measurement OMOP:36746863 - APC on GRCh38 chr5: Substitution in position 112840171 of C replaced by T measurement OMOP:36747257 - CTNNA1 on GRCh38 chr5: Substitution in position 138930653 of C replaced by T measurement OMOP:36747278 - PDGFRB on GRCh38 chr5: Substitution in position 150115797 of G replaced by A measurement OMOP:36747820 - PIK3R1 on GRCh38 chr5: Substitution in position 68292320 of G replaced by A measurement OMOP:36748142 - EGFR on GRCh38 chr7: Deletion in position 55174776 to 55174785 and Insertion of C measurement OMOP:36749267 - EGFR on GRCh38 chr7: Substitution in position 55174730 of G replaced by A measurement OMOP:36749971 - NOTCH1 on GRCh38 chr9: Substitution in position 136506938 of G replaced by A measurement OMOP:36754800 - ERBB2 transcript: Substitution in position 2740 of G replaced by A measurement OMOP:36759432 - MSH2 transcript: Substitution in position 1645 of G replaced by T measurement OMOP:36759823 - MSH6 transcript: Substitution in position 1537 of A replaced by G measurement OMOP:36760065 - MSH6 transcript: Substitution in position 2827 of G replaced by T measurement OMOP:36761998 - PTEN transcript: Substitution in position 628 of A replaced by G measurement OMOP:36763160 - RAD51D transcript: Substitution in position 268 of G replaced by A measurement OMOP:36767198 - TSC2 transcript: Substitution in position 4198 of G replaced by A measurement OMOP:37016098 - Myelopathy due to spinal stenosis of lumbar region OMOP:37016104 - Squamous cell carcinoma of vagina OMOP:37016111 - Long-term current use of cyclophosphamide OMOP:37016115 - Skin ulcer due to varicose veins OMOP:37016148 - Ganglioneuroma OMOP:37016285 - Avibacterium endocarditidis OMOP:37016321 - Candida blattae OMOP:37016326 - Candida castellii OMOP:37016353 - Dyslipidemia due to type 1 diabetes mellitus OMOP:37016355 - Hyperosmolar coma due to secondary diabetes mellitus OMOP:37016356 - Mild nonproliferative retinopathy due to secondary diabetes mellitus OMOP:37016448 - Hyphopichia OMOP:37016495 - Exclusion from performance measure for system reason OMOP:37016502 - Micromonospora inyonensis OMOP:37016532 - Anhinga OMOP:37016562 - Propionibacterium acidifaciens OMOP:37016598 - Streptococcus merionis OMOP:37016606 - Sphingopyxis chilensis OMOP:37016635 - Rhodococcus kroppenstedtii OMOP:37016641 - Ischemia co-occurrent and due to increased oxygen demand OMOP:37016663 - Myalgia of pelvic floor OMOP:37016700 - Glycyl-tyrosine OMOP:37016780 - Sediminibacterium OMOP:37016803 - Candida saitoana OMOP:37016860 - Chrysomya megacephala larva OMOP:37016891 - Overlapping primary malignant neoplasm of bone and articular cartilage of upper limb OMOP:37016901 - Died in learning disability unit OMOP:37016903 - Witness to adult alcohol misuse OMOP:37016928 - Primary caregiver has poor support network OMOP:37016936 - Education about urinary system function OMOP:37017019 - Inadvertent catheterization of artery OMOP:37017054 - Supervision of high risk pregnancy with history of previous abnormal baby OMOP:37017060 - Dental plaque induced gingivitis OMOP:37017062 - Procedure discontinued by patient OMOP:37017075 - Nontraumatic ruptured cerebral aneurysm OMOP:37017125 - Disorder of skin co-occurrent with human immunodeficiency virus infection OMOP:37017177 - Subacute ischemic heart disease OMOP:37017221 - Neovascular glaucoma due to diabetes mellitus OMOP:37017265 - Enlargement of liver co-occurrent with human immunodeficiency virus infection OMOP:37017355 - Advance care planning declined OMOP:37017423 - Disorder of cellular component of blood caused by antiretroviral drug OMOP:37017453 - Coccidiosis co-occurrent with human immunodeficiency virus infection OMOP:37017455 - Pyrexia of unknown origin co-occurrent with human immunodeficiency virus infection OMOP:37017608 - Lumbosacral spondylosis with root compression OMOP:37017939 - Multiple drug-resistant Proteus mirabilis OMOP:37018026 - Difficulty agreeing with care plan OMOP:37018063 - Immune reconstitution inflammatory syndrome caused by human immunodeficiency virus infection OMOP:37018353 - Persistent hematuria co-occurrent and due to diffuse mesangial proliferative glomerulonephritis OMOP:37018357 - Unable to agree with care plan OMOP:37018374 - Does clean needles OMOP:37018420 - Ability to carry object with one hand OMOP:37018442 - Difficulty swimming OMOP:37018450 - Able to ride horse OMOP:37018451 - Unable to ride horse OMOP:37018497 - Aspiration pneumonitis of fetus OMOP:37018505 - Able to transfer from car to wheelchair OMOP:37018596 - Malikia OMOP:37018601 - Sinomonas OMOP:37018717 - Education about amino acid-based infant formula OMOP:37018834 - Ability to carry object with both hands OMOP:37018858 - Priapism due to trauma OMOP:37018863 - Candida duobushaemulonii OMOP:37018878 - High risk pregnancy due to recurrent pregnancy loss OMOP:37018893 - Heliopais OMOP:37018931 - Education about second hand smoke exposure OMOP:37018950 - Exclusion from performance measure for medical reason OMOP:37018972 - Primary adenocarcinoma of fallopian tube OMOP:37019048 - Balanced translocation of chromosome OMOP:37019472 - Hy Ag inferred phenotype [Presence] in Blood or Tissue by Molecular genetics method OMOP:37019476 - PROMIS pediatric item bank - psychological stress experiences - version 1.0 OMOP:37019488 - Thinking about your child's life, my child tries to find meaning in life [PROMIS.PARENTPROXY] OMOP:37019502 - Current level of confidence I can keep my symptoms from interfering with my recreational activities [PROMIS] OMOP:37019537 - How short of breath did you get walking up 20 stairs (2 flights) without stopping over past 7 days [PROMIS] OMOP:37019539 - My child's appetite changed in past 7 days [PROMIS.PARENTPROXY] OMOP:37019595 - When I am worrying about something, a cigarette is helpful [PROMIS] OMOP:37019668 - MDS v3.0 - RAI v1.17.2 - Correction request during assessment period [CMS Assessment] OMOP:37019672 - When I was in pain I avoided using the part of my body that hurt in past 7 days [PROMIS] OMOP:37019673 - Citalopram [Presence] in Urine by Confirmatory method OMOP:37019706 - I felt concerned about what was going on in my life in past 7 days [PROMIS.PEDS] OMOP:37019851 - Thinking about my life, I try to find meaning in life [PROMIS.PEDS] OMOP:37019856 - When I go too long without a cigarette I feel impatient [PROMIS] OMOP:37019930 - I felt great in past 7 days [PROMIS.PEDS] OMOP:37019935 - Are you able to carry a suitcase up a flight of stairs [PROMIS] OMOP:37019956 - My child felt joyful in past 7 days [PROMIS.PARENTPROXY] OMOP:37019971 - Volunteer Name OMOP:37019995 - PROMIS short form - self-efficacy for managing medications and treatments 8a - version 1.0 raw score OMOP:37020022 - General Life Satisfaction Survey - unadjusted scale score [NIH Toolbox] OMOP:37020084 - Shelters [CDC Emergency Operations Centers] OMOP:37020100 - Planned intervention AndOr services visit frequency OMOP:37020123 - Thinking about my life, I have a reason for living [PROMIS.PEDS] OMOP:37020133 - Provider supplied mother's live birth report Document OMOP:37020143 - Other intervention AndOr service plan to provide [Identifier] OMOP:37020148 - Emotional/informational support score [MOS Social Support Survey] OMOP:37020186 - I rely on smoking to deal with stress [PROMIS] OMOP:37020223 - Emotional Support Survey - national percentile [NIH Toolbox] OMOP:37020228 - Gardnerella vaginalis DNA [Presence] in Vaginal fluid by Probe OMOP:37020234 - Worrying thoughts have been going through my mind a lot of the time in the last 2 weeks [STarT Back] OMOP:37020249 - Are you able to make sharp turns while running fast [PROMIS] OMOP:37020306 - PROMIS self-efficacy for managing daliy activities - version 1.0 T-score OMOP:37020345 - Problem related to diabetes Family member OMOP:37020371 - Reason for specimen rejection [Type] OMOP:37020390 - PROMIS short form - smoking - nicotine dependence for all smokers 8a - version 1.0 OMOP:37020482 - Current level of confidence I can lift and carry groceries [PROMIS] OMOP:37152522 - Clear cell renal cell carcinoma OMOP:37020498 - Current level of confidence I can engage in hobbies or recreational activities [PROMIS] OMOP:37020582 - Current level of confidence Friends and family will come to see me when I am sick [PROMIS] OMOP:37020614 - Current level of confidence I can keep my symptoms from interfering with my personal care [PROMIS] OMOP:37020701 - Are you able to jump 2 feet (60 cm) high [PROMIS] OMOP:37020751 - When my child was in pain he or she avoided standing in past 7 days [PROMIS.PARENTPROXY] OMOP:37020790 - Rules for using smoked tobacco products inside home OMOP:37020858 - Are you able to push an empty refrigerator forward 1 yard (1 m) [PROMIS] OMOP:37020931 - LW sup(b) Ag inferred phenotype [Presence] in Blood or Tissue by Molecular genetics method OMOP:37020935 - MDS v3.0 - RAI v1.17.1, 1.17.2 - Interim Payment Assessment (IPA) item set during assessment period [CMS Assessment] OMOP:37021000 - My child's neck felt tight in past 7 days [PROMIS.PARENTPROXY] OMOP:37021089 - PROMIS short form - upper extremity 7a - version 2.0 raw score OMOP:37021096 - Thinking about your child's life, my child expects to be successful in the future [PROMIS.PARENTPROXY] OMOP:37021098 - My child felt blissful in past 7 days [PROMIS.PARENTPROXY] OMOP:37021129 - Are you able to carry household items, such as heavy boxes or furniture, up a flight of stairs [PROMIS] OMOP:37021136 - Are you able to paint the walls of a room with a brush or roller for 2hours without stopping to rest [PROMIS] OMOP:37021151 - How short of breath did you get washing dishes over past 7 days [PROMIS] OMOP:37021179 - Bordetella parapertussis DNA [Presence] in Respiratory system specimen by NAA with probe detection OMOP:37021211 - My child had very strong happy feelings in past 7 days [PROMIS.PARENTPROXY] OMOP:37021233 - I could not stay still for long in past 7 days [PROMIS.PEDS] OMOP:37021275 - PROMIS short form - self-efficacy for managing symptoms 8a - version 1.0 OMOP:37021307 - Functional training plan to perform [Identifier] OMOP:37021317 - Polyclonal plasma cells/Total plasma cells in Bone marrow by Flow cytometry (FC) OMOP:37021365 - K Ag inferred phenotype [Presence] in Blood or Tissue by Molecular genetics method OMOP:37021447 - Distress subscore [STarT Back] OMOP:37021471 - Personnel Supervisor name OMOP:37021494 - Current level of confidence People understand when I need help and when I don't need help [PROMIS] OMOP:37021571 - Positive social interaction [MOS Social Support Survey] OMOP:37108584 - Arthritis of left shoulder caused by bacteria OMOP:37108609 - Arthritis of joint of finger of bilateral hands OMOP:37108634 - Suppurative tenosynovitis of flexor tendon of right hand OMOP:37108637 - Calcific tendinitis of left achilles tendon OMOP:37108650 - Patellar bursitis of right knee OMOP:37108665 - Tendinitis of left knee OMOP:37108712 - Cannabis hyperemesis syndrome co-occurrent and due to cannabis abuse OMOP:37108740 - Postpartum hemorrhage due to total placenta previa OMOP:37108911 - Dissection of right carotid artery OMOP:37108913 - Dissection of left vertebral artery OMOP:37108921 - Enthesopathy of left knee OMOP:37108940 - Chronic pain of right upper limb OMOP:37108954 - Psychotic disorder caused by methamphetamine OMOP:37108955 - Lesion of right eyelid OMOP:37108987 - Passport number OMOP:37109012 - Derangement of right shoulder joint OMOP:37109062 - Spasm of muscle of lower back OMOP:37109262 - Kyphosis of cervicothoracic spine OMOP:37109676 - Pierre Robin sequence faciodigital anomaly syndrome OMOP:37109721 - Aplasia cutis congenita with epibulbar dermoid syndrome OMOP:37109841 - Severe generalized recessive dystrophic epidermolysis bullosa OMOP:37109898 - Primary chondrosarcoma of articular cartilage of limb OMOP:37109915 - Infection causing subacute endocarditis OMOP:37109948 - Perceptual disturbances and seizures co-occurrent and due to alcohol withdrawal OMOP:37110118 - KRT14 related epidermolysis bullosa simplex OMOP:37110199 - Urinary system calculus OMOP:37110206 - Hemidystonia hemiatrophy syndrome OMOP:37110210 - Blister of cervix OMOP:37110240 - Asymptomatic stenosis of extracranial artery OMOP:37110242 - Atherosclerosis of autologous coronary artery bypass graft OMOP:37110246 - Congenital anomaly of descending thoracic aorta OMOP:37110247 - Congenital anomaly of abdominal aorta OMOP:37110288 - Vesicovaginal fistula with involvement of urinary continence mechanism following termination of pregnancy procedure OMOP:37110316 - Duodenal ulcer caused by Helicobacter pylori and non-steroidal anti-inflammatory agent OMOP:37110324 - Encephalitis caused by Venezuelan equine encephalomyelitis virus OMOP:37110330 - Neonatal cardiac failure due to pulmonary overperfusion OMOP:37110377 - Bursitis caused by mechanical pressure OMOP:37110435 - Amnestic disorder caused by hypnotic OMOP:37110471 - Perceptual disturbances and seizures co-occurrent and due to psychoactive substance withdrawal OMOP:37110487 - Amnestic disorder due to multiple etiological factors OMOP:37110528 - Incomplete cord syndrome of lumbar spinal cord OMOP:37110529 - Injury of nerve at wrist level OMOP:37110568 - Nail fragility OMOP:37110569 - Epidermal fragility OMOP:37152689 - Regional flap reconstruction - action OMOP:37110590 - Occupational phototoxic reaction to skin contact with exogenous photoactive agent OMOP:37110638 - Injury of fascia of triceps brachii OMOP:37110670 - Injury of tendon of extensor muscle at forearm level OMOP:37110723 - Suspected cystic fibrosis in fetus OMOP:37110735 - Congenital disorder of glycosylation type 1e OMOP:37110782 - Wound of abdomen OMOP:37110800 - Occlusion of corpus cavernosum OMOP:37110822 - Education about choosing appropriate clothing OMOP:37110841 - C-C motif chemokine 17 OMOP:37110872 - Autosomal dominant striatal neurodegeneration OMOP:37110886 - Familial Scheuermann disease OMOP:37110912 - Mumps genotype H OMOP:37110922 - Congenital central hypothyroidism due to thyrotropin-releasing hormone receptor deficiency OMOP:37111304 - Fibrin strand OMOP:37111318 - Autosomal dominant tubulointerstitial kidney disease OMOP:37111380 - Strain of fascia of intrinsic muscle of thumb OMOP:37111388 - Laceration of intrinsic muscle of finger OMOP:37111419 - Partial trisomy of chromosome 8 OMOP:37111426 - Partial trisomy of chromosome 18 OMOP:37111429 - Partial trisomy of chromosome 22 OMOP:37111442 - Deletion of part of chromosome 10 OMOP:37111632 - Hernia of muscle through fascia of lower leg OMOP:37111682 - Rhubarb OMOP:37111697 - Major depression with psychotic features OMOP:37115764 - Yersinia enterocolitica biotype 1A serotype O:19,8 OMOP:37116297 - Secondary autoimmune hemolytic anemia co-occurrent and due to chronic inflammatory disease OMOP:37116355 - Epilepsy telangiectasia syndrome OMOP:37116365 - Encephalopathy, intracerebral calcification, retinal degeneration syndrome OMOP:37116430 - Acute kidney failure stage 1 OMOP:37116456 - Ameboma of large intestine caused by Entamoeba histolytica OMOP:37116467 - Dementia due to herpes encephalitis OMOP:37116478 - Scarring alopecia due to traumatic injury OMOP:37116482 - Burn of skin due to exposure to man-made ultraviolet light OMOP:37116486 - Laceration of thorax with foreign body OMOP:37116487 - Open bite of thorax OMOP:37116488 - Traumatic dislocation of joint of thoracic wall OMOP:37116547 - Puncture wound of lower leg with foreign body OMOP:37116615 - Traumatic amputation of part of penis OMOP:37116625 - Puncture wound of shoulder region with foreign body OMOP:37116640 - Joubert syndrome with Jeune asphyxiating thoracic dystrophy OMOP:37116655 - Congenital nephrotic syndrome, interstitial lung disease, epidermolysis bullosa syndrome OMOP:37116688 - Diagnosis of exclusion OMOP:37116695 - Not easily wakened from sleep OMOP:37116812 - Vesicle fluid OMOP:37116866 - Non-mucinous minimally invasive adenocarcinoma OMOP:37116918 - Secondary non-active dental caries extending into outer third of dentin OMOP:37116931 - Secondary active dental caries extending into dentin OMOP:37116993 - Mucinous tubular and spindle cell carcinoma OMOP:37117017 - Lacrimal sac mucocele fluid OMOP:37117087 - Osteoarthritis of right patellofemoral joint OMOP:37117099 - Dupuytren's disease of palm of right hand OMOP:37117130 - Gender dysphoria in childhood OMOP:37117145 - Behavioral disturbance co-occurrent and due to late onset Alzheimer dementia OMOP:37117151 - Chronic rupture of anterior cruciate ligament of right knee OMOP:37117215 - Sleep disorder caused by nicotine OMOP:37117231 - Injury of extensor muscle of finger at forearm level OMOP:37117233 - Mannosyl-oligosaccharide glycosidase congenital disorder of glycosylation OMOP:37117240 - Atypical lichen myxedematosus OMOP:37117267 - Laceration of tendon of intrinsic muscle of thumb OMOP:37117279 - Fluoroquinolone resistant Campylobacter OMOP:37117650 - High astigmatism of right eye OMOP:37117764 - Exostosis, anetoderma, brachydactyly type E syndrome OMOP:37117789 - Epithelial variant hepatoblastoma OMOP:37118756 - Primary active dental caries extending into inner half of enamel OMOP:37118766 - Multicystic ameloblastoma OMOP:37119080 - Peritoneal pockets and endometriosis OMOP:37119135 - Nonerosive lichen planus of oral mucosa OMOP:37119148 - Mood disorder with mixed depressive and manic symptoms caused by anxiolytic OMOP:37119157 - Injury of tibial nerve at lower leg level OMOP:37119166 - Injury of muscle at upper arm level OMOP:37119302 - Traumatic dislocation of sternoclavicular joint OMOP:37150963 - Wildrice OMOP:37151040 - Naganishia bhutanensis OMOP:37151199 - Mycobacterium pseudokansasii OMOP:37151285 - Victim of incest OMOP:37151286 - Clothing observable OMOP:37151578 - Community nursing OMOP:37151644 - Provision of advice, assessment or treatment limited due to monkeypox outbreak OMOP:37151697 - Transfer of care from Court of Justice OMOP:37151800 - AmpC beta-lactamase producing Klebsiella oxytoca OMOP:37151828 - Bronchial surgical margin OMOP:37152181 - Endometrial stromal sarcoma OMOP:37153047 - Alkaliphilus oremlandii OMOP:37153075 - Virtual supervision by healthcare professional of specimen collection by subject OMOP:37153232 - Estimated quantity of intake of thickener additive in 24 hours OMOP:37153544 - Shewanella seohaensis OMOP:37153839 - Medical hydrology OMOP:37153894 - Family history of disability OMOP:37153905 - Moore hip approach OMOP:37153906 - Kocher-Langenbeck hip approach OMOP:37153976 - Dedifferentiated peripheral ameloblastic carcinoma OMOP:37154265 - SARS-CoV OMOP:37154513 - Black walnut pollen OMOP:37154563 - Hepatitis C immune status determined by serology OMOP:37154744 - Monkeypox confirmed by laboratory test OMOP:37154759 - Lentilactobacillus rapi OMOP:37154810 - Paenibacillus fonticola OMOP:37154842 - Edoxaban contraindicated OMOP:37154857 - Rhizobium selenitireducens OMOP:37154917 - No history of deliberate self-harm in secure estate OMOP:37155058 - Hepatitis C treatment declined OMOP:37155097 - Ureibacillus thermophilus OMOP:37155216 - Streptomyces andamanensis OMOP:37155237 - Bisgaardia hudsonensis OMOP:37155258 - Catellicoccus marimammalium OMOP:37155414 - Typhoid colitis OMOP:37155472 - Did not attend smallpox virus vaccination OMOP:37155476 - Did not attend for third dose of smallpox virus vaccine OMOP:37155563 - Nocardia jiangsuensis OMOP:37155565 - Nocardia lasii OMOP:37155713 - Caballeronia zhejiangensis OMOP:37155724 - Cladosporium ramotenellum OMOP:37155746 - Starmerella stellata OMOP:37155857 - Photorhabdus noenieputensis OMOP:37155871 - Paracoccus limosus OMOP:37155888 - Acinetobacter populi OMOP:37155889 - Acinetobacter pragensis OMOP:37155917 - Puncture wound of right thumb with foreign body OMOP:37155926 - Strain of right hamstring muscle OMOP:37155928 - Tetrahydrocortisol/creatinine mass concentration ratio in urine OMOP:37155996 - Subject of record informed DVLA (Driver and Vehicle Licensing Agency) OMOP:37156109 - Fibroblast growth factor receptor inhibitor OMOP:37156549 - Monascaceae OMOP:37156625 - Measured quantity of intake of minerals OMOP:37156637 - Salmonella group C OMOP:37156933 - Carcinoma OMOP:37157156 - Dactylis - orchardgrass OMOP:37157251 - Paraburkholderia solisilvae OMOP:37157978 - Triadica sebifera OMOP:37158106 - Presence of DNA mismatch repair protein Msh6 in primary malignant neoplasm of colon by immunohistochemistry OMOP:37158180 - Hemorrhagic lesion OMOP:37158271 - At increased risk for exposure to potentially harmful entity OMOP:37158506 - Benign metanephric tumor OMOP:37158543 - Agrilactobacillus OMOP:37158839 - Site of excised primary malignant neoplasm of rectum relative to peritoneal reflection OMOP:37158890 - Extended spectrum beta-lactamase producing Yersiniaceae OMOP:37159101 - Anatomic location directly invaded by primary malignant neoplasm of cecum and/or colon and/or rectum OMOP:37159127 - Relative location of involved inguinal lymph nodes to primary malignant neoplasm of penis OMOP:37159266 - Agrococcus jejuensis OMOP:37159302 - Leucobacter aerolatus OMOP:37159379 - Virgibacillus halophilus OMOP:37159384 - Aspergillus silvaticus OMOP:37159470 - Streptococcus constellatus subsp. viborgensis OMOP:37159486 - Superior surgical margin OMOP:37159549 - Helicobacter brantae OMOP:37159571 - Family history of congenital immunodeficiency disease OMOP:37159572 - Extended spectrum beta-lactamase producing Pseudomonas aeruginosa OMOP:37159618 - Imaging procedure declined OMOP:37159657 - Ophthalmology surgery service OMOP:37159663 - Neonatal cardiovascular surgery service OMOP:37159670 - Ramularia-like organism OMOP:37159704 - Metastatic eccrine porocarcinoma OMOP:37159733 - Exposure to methanol OMOP:37159804 - Pneumoconiosis caused by organic dust OMOP:37159805 - Furuncle of left finger OMOP:37159851 - Acute lymphangitis of finger of left hand OMOP:37159870 - Metastatic mucinous cystadenocarcinoma OMOP:37159888 - Varicose ulcer of left lower leg OMOP:37159896 - Varicose ulcer of right thigh OMOP:37159908 - Ulcer of toe of right foot OMOP:37159919 - Ulcer of left midfoot OMOP:37159933 - Pressure injury of left lower leg stage II OMOP:37159943 - Pressure injury of left lower leg stage III OMOP:37159956 - Abscess of nasal sinus OMOP:37159993 - Subcoracoid impingement of left shoulder region OMOP:37159995 - Paget disease of left scapula OMOP:37160017 - Bilateral acute chemical otitis externa OMOP:37160023 - Dislocation of ossicle of bilateral ears OMOP:37160059 - Left acute serous allergic otitis media OMOP:37160084 - Traumatic left cerebral hemorrhage OMOP:37160098 - Right ring finger nail avulsion OMOP:37160104 - Puncture wound of right hip OMOP:37160108 - Traumatic injury of digital nerve of right index finger OMOP:37160151 - Surgical margin involved by primary malignant neoplasm of small intestine in pancreaticoduodenectomy specimen OMOP:37160229 - Presence of primary malignant neoplasm of larynx at surgical margin in laryngectomy specimen OMOP:37160287 - Presence of primary malignant neoplasm of extrahepatic bile duct at radial surgical margin in segmented resection of bile duct specimen OMOP:37160381 - Scoliosis due to and following infection OMOP:37160395 - Osteonecrosis of foot due to hemoglobinopathy OMOP:37160444 - Mullerian hormone antibody arbitrary concentration in serum OMOP:37160526 - Lesion of sclera OMOP:37160566 - Goal discontinued OMOP:37160592 - Accidental lithium and/or lithium compound overdose OMOP:37160606 - XK aprosencephaly syndrome OMOP:37160615 - Bilateral congenital instability of hip joints OMOP:37160679 - Dacryoadenitis caused by Borrelia burgdorferi OMOP:37160685 - Achalasia due to Chagas disease OMOP:37160711 - Candida colitis OMOP:37160722 - Salmonella paratyphi A colitis OMOP:37160765 - Positive emotion about food and/or nutrition OMOP:37160819 - Histoplasma dacryoadenitis OMOP:37160824 - Propionibacterium infection OMOP:37160832 - Enterococcal gastritis OMOP:37160857 - Koutango virus encephalitis OMOP:37160894 - Aquagenic palmoplantar keratoderma OMOP:37160947 - Dental plaque on teeth OMOP:37160963 - Split-foot malformation, mesoaxial polydactyly syndrome OMOP:37160966 - Neonatal Staphylococcus epidermidis mastitis OMOP:37161004 - Gingival disease caused by Mycobacterium leprae OMOP:37161016 - Closed traumatic medial dislocation of right knee joint OMOP:37161030 - Cytosolic phospholipase-A2 alpha deficiency associated bleeding disorder OMOP:37161071 - Foreign body in anterior abdominal wall OMOP:37161078 - Left gastrocnemius strain OMOP:37161085 - Traumatic tear of tendon of left forearm OMOP:37161088 - Tuberculous posterior uveitis OMOP:37161104 - Bacteremic skin rash OMOP:37161145 - Infection caused by larvae of Trichinella nelsoni OMOP:37161188 - Left elbow joint ligament sprain OMOP:37161218 - Right elbow joint closed traumatic posterior dislocation OMOP:37161236 - Foreign body in skin of left thumb with infection OMOP:37161261 - Left radial head subluxation OMOP:37161263 - Traumatic left rotator cuff tear OMOP:37161280 - Traumatic rupture of labrum of left acetabulum OMOP:37161292 - Left hip closed traumatic posterior dislocation OMOP:37161324 - Right ring finger blister with infection OMOP:37161445 - Myxedema coma due to subclinical hypothyroidism OMOP:37161474 - CHD3-related developmental delay, speech delay, intellectual disability, abnormalities of vision, facial dysmorphism syndrome OMOP:37161506 - Closed traumatic dislocation of metacarpophalangeal joint of left little finger OMOP:37161543 - Femoral cortical expansion OMOP:37161574 - Closed traumatic dislocation of metacarpophalangeal joint of right index finger OMOP:37161716 - Closed traumatic anterior dislocation of left glenohumeral joint OMOP:37161717 - Right distal radioulnar joint subluxation OMOP:37161756 - Left sternoclavicular joint closed traumatic posterior dislocation OMOP:37161777 - Right shoulder blister with infection OMOP:37161812 - Right quadriceps muscle laceration OMOP:37161840 - Sprain of metatarsophalangeal joint of right great toe OMOP:37161852 - Closed traumatic dislocation of metacarpophalangeal joint of left thumb OMOP:37161861 - Closed traumatic dislocation of joint of left thumb OMOP:37161884 - Open traumatic dislocation of joint of left foot OMOP:37161888 - Closed traumatic dislocation of intertarsal joint of left foot OMOP:37161904 - Foreign body in skin of right lower leg with infection OMOP:37161944 - Dirty environment OMOP:37161973 - Traumatic partial amputation of left great toe OMOP:37161991 - Traumatic subluxation of left peroneal tendon OMOP:37162004 - Sprain of lateral collateral ligament of right knee joint OMOP:37162024 - Injury of anterior crural muscle of right lower leg OMOP:37162031 - Traumatic tear of cruciate ligament of right knee OMOP:37162058 - Primary fibrolamellar hepatocellular carcinoma OMOP:37162088 - Combined immunodeficiency due to CARMIL2 deficiency OMOP:37162162 - Radiation-induced male infertility OMOP:37162176 - Myelopathy due to excess nutrient OMOP:37162214 - Periodontitis due to Ehlers-Danlos syndrome type 4 OMOP:37162218 - Infectious mononucleosis caused by human herpesvirus 6 OMOP:37162230 - STAG1-related intellectual disability, facial dysmorphism, gastroesophageal reflux syndrome OMOP:37162333 - Autosomal dominant spastic paraplegia type 73 OMOP:37162344 - Immunoglobulin G4 related kidney disease OMOP:37162363 - PEX12 deficiency OMOP:37162380 - Cyst of craniobuccal pouch OMOP:37162400 - Serving in military service OMOP:37162412 - Livedoid vasculopathy of lower limb due to varicose veins of lower limb OMOP:37162436 - Perinatal disorder of fetus and/or neonate due to abnormality of amnion OMOP:37162487 - Enteropathogenic Escherichia coli enteritis of small intestine OMOP:37162522 - Entamoeba histolytica enteritis of intestine OMOP:37162526 - Ancylostoma caninum eosinophilic enteritis of intestine OMOP:37162542 - Benign neoplasm of lacrimal apparatus OMOP:37162547 - Benign mesenchymoma of small intestine OMOP:37162598 - Primary acinar cell carcinoma of parotid gland OMOP:37162617 - Benign hemangioma of stomach OMOP:37162624 - Primary adenocarcinoma of iris neuroepithelium OMOP:37162625 - Gastrointestinal stromal tumor of appendix OMOP:37162649 - Pyostomatitis vegetans of gingival mucosa OMOP:37162653 - Disseminated pyogenic granuloma of gingiva OMOP:37162721 - Multiple keratoacanthoma of skin OMOP:37162725 - Verruca vulgaris of eyelid OMOP:37162852 - Drug induced anal ulceration OMOP:37162857 - Bleeding esophageal varices due to alcoholic liver disease OMOP:37162860 - Type 1 autoimmune pancreatitis with extrapancreatic involvement OMOP:37162893 - Chronic hepatic failure due to portosystemic shunt OMOP:37162901 - AKT2-related familial partial lipodystrophy OMOP:37162903 - CIDEC-related familial partial lipodystrophy OMOP:37162908 - Acute bilirubin encephalopathy OMOP:37162925 - Hematoma due to and following left hip arthroplasty OMOP:37162971 - Autosomal dominant congenital fiber-type disproportion myopathy due to SELENON mutation OMOP:37163014 - Atherosclerosis of brachial artery OMOP:37163029 - Acute inguinal lymphadenitis OMOP:37163030 - Asymptomatic stenosis of anterior cerebral artery OMOP:37163031 - Acute cervical lymphadenitis OMOP:37163053 - Acute thromboembolic crural artery occlusion OMOP:37163084 - Acute non-ST segment elevation myocardial infarction of right ventricle OMOP:37163119 - Silver nanoparticle OMOP:37163153 - Congenital hydrocephalus, low insertion of umbilicus syndrome OMOP:37163213 - Congenital autosomal recessive small-platelet thrombocytopenia OMOP:37163252 - Pacemaker mediated tachycardia OMOP:37163262 - Arterial obstruction due to thrombotic embolism from aneurysm of ventricle OMOP:37163269 - Provoked Brugada electrocardiograph pattern OMOP:37163270 - Thromboembolism from prosthetic heart valve OMOP:37163279 - Long QT syndrome type 4 OMOP:37163307 - Fracture of atrial lead of implantable cardioverter and defibrillator OMOP:37163331 - Polymicrogyria due to TUBB2B mutation OMOP:37163348 - Generalized onset myoclonic epileptic seizure OMOP:37163350 - Generalized onset epileptic spasms OMOP:37163355 - Myoclonic epileptic seizure OMOP:37163439 - Impaired carbohydrate tolerance OMOP:37163456 - Sclerosis of adrenal gland OMOP:37163554 - Primary lymphedema with visceral involvement OMOP:37163612 - Asymptomatic bradycardia OMOP:37163672 - Diffuse contracture of eye socket with volume and surface loss OMOP:37163683 - Isolated congenital horizontal gaze paresis OMOP:37163702 - Chronic trochlear nerve palsy OMOP:37163708 - Chronic chlamydial follicular conjunctivitis OMOP:37163738 - Dislocation of left knee joint prosthesis OMOP:37163785 - Keppen Lubinsky syndrome OMOP:37163838 - Fracture of bone adjacent to right knee joint prosthesis OMOP:37163927 - Anterior maxillary protrusion, strabismus, intellectual disability syndrome OMOP:37164052 - Difficulty kicking with leg OMOP:37164240 - Atrophy of globe of eye OMOP:37164392 - Nasolacrimal duct cyst OMOP:37164404 - B-cell immunodeficiency, limb anomaly, urogenital malformation syndrome OMOP:37164435 - Auditory brainstem electric response audiometry with tone stimulation OMOP:37164457 - Anxiolytic dependence in remission OMOP:37164461 - Anxiolytic dependence, continuous OMOP:37164466 - Congenital fistula of commissure of lips OMOP:37164487 - Optic neuritis due to demyelinating disease OMOP:37164494 - Mechanical strabismus due to orbital pulley disorder OMOP:37164516 - Iatrogenic corneal ectasia OMOP:37164532 - Traumatic entrapment of eyeball OMOP:37164546 - Benign familial neonatal-infantile seizures OMOP:37164655 - Obstruction of lumen of respiratory tract caused by foreign body following ingestion OMOP:37164662 - Spastic miosis OMOP:37164668 - Sustained upward gaze deviation OMOP:37164671 - Sustained horizontal conjugate gaze deviation OMOP:37164712 - Vascular extraocular myopathy OMOP:37164725 - Retinopathy due to sickle cell trait OMOP:37164789 - Mood disorder caused by ethanol OMOP:37164861 - Mass fills upper half of abdomen OMOP:37164862 - Mass fills lower half of abdomen OMOP:37164884 - Martorell ulcer of lower leg OMOP:37164972 - Fetal disorder due to placental edema OMOP:37164996 - Fetal disorder due to maternofetal transfusion OMOP:37165053 - Pressure collapse of lung due to anesthesia during labor and delivery OMOP:37165079 - Cerebellar-facial-dental syndrome OMOP:37165137 - Early neonatal disorder due to placentitis OMOP:4050800 - FH: Gout OMOP:37165141 - Early neonatal disorder due to placental dysfunction OMOP:37165192 - Acute pustular skin eruption OMOP:37165202 - Disorder of skin caused by epidermal growth factor receptor inhibitor OMOP:37165247 - 16p12.1p12.3 triplication syndrome OMOP:37165322 - Weeverfish venom OMOP:37165335 - Nodule of skin of toe of right foot OMOP:37165377 - Puss caterpillar venom OMOP:37165423 - Clear cell squamous cell carcinoma of trachea OMOP:37165432 - Ruxolitinib dependence OMOP:37165446 - Photo-allergic contact dermatitis due to non-steroidal anti-inflammatory drug OMOP:37165505 - Irritant contact dermatitis of neck OMOP:37165517 - Pruritus caused by opioid OMOP:37165545 - Combined opioid with non-opioid substance dependence, continuous OMOP:37165546 - Combined opioid with non-opioid substance dependence in remission OMOP:37165590 - Traumatic tear of cruciate ligament of knee OMOP:37165612 - Open fracture of multiple tarsal bones OMOP:37165639 - X-linked myotubular myopathy, abnormal genitalia syndrome OMOP:37165642 - Fracture of multiple metatarsal bones OMOP:37165651 - Autosomal dominant intellectual disability, craniofacial anomalies, cardiac defects syndrome OMOP:37165673 - Undifferentiated carcinoma of lung OMOP:37165770 - Giant cell carcinoma of hypopharynx OMOP:37165824 - Hodgkin granuloma of lymph nodes of upper limb OMOP:37165828 - Hodgkin disease of lymph nodes of head OMOP:37165875 - Toxic effect of soap OMOP:37165893 - Synovitis and tenosynovitis of joint of wrist OMOP:37165927 - Victim of forced marriage OMOP:37165928 - Superficial vegetating pyoderma gangrenosum OMOP:37165939 - Trichotemnomania OMOP:37165981 - Surgical margin closest to primary malignant neoplasm in excised specimen of esophagus OMOP:37165986 - Intracranial hemorrhage following administration of thrombolytic agent OMOP:37166010 - NK-lymphoblastic leukemia/lymphoma OMOP:37166023 - Baraitser Winter cerebrofrontofacial syndrome OMOP:37166025 - Sequestrum of permanent tooth bud due to and following dental trauma OMOP:37166049 - Infantile Alexander disease OMOP:37166064 - Autonomic disorder due to leprosy OMOP:37166133 - Partial arrest of growth of root of tooth due to and following dental trauma OMOP:37166142 - Impaired awareness epileptic seizure OMOP:37166165 - Recurrent phimosis OMOP:37166167 - Dental plaque retention factor on tooth OMOP:37166205 - Primary carcinoma of soft palate OMOP:37166227 - Primary carcinoma of duodenum OMOP:37166270 - Primary carcinoma of transverse colon OMOP:37166319 - Primary adenosarcoma of uterus OMOP:37166356 - Primary carcinoma ex pleomorphic adenoma of parotid gland OMOP:37166358 - Primary carcinoma of uterine cervix, invasive OMOP:37166365 - Primary mucoepidermoid carcinoma of submandibular gland OMOP:37166380 - Dementia due to systemic lupus erythematosus OMOP:37166387 - Dementia due to trypanosomiasis OMOP:37166405 - Primary basal cell carcinoma - adenoid OMOP:37166421 - Primary balloon cell malignant melanoma OMOP:37166477 - Primary adenocarcinoma of carotid body OMOP:37166480 - Primary adenocarcinoma of parathyroid gland OMOP:37166487 - Cranial arachnoiditis OMOP:37166494 - Primary osteosarcoma of bone of clavicle OMOP:37166505 - Primary infiltrating ductal carcinoma of lower outer quadrant of left female breast OMOP:37166525 - Primary endometrioid carcinoma of prostate OMOP:37166559 - Primary micropapillary urothelial carcinoma OMOP:37166563 - Primary lipid-rich urothelial carcinoma of urinary system OMOP:37166601 - Primary squamous non-small cell lung cancer OMOP:37166625 - Primary malignant eccrine spiradenoma OMOP:37166649 - Primary gastrointestinal stromal neoplasm of overlapping sites of small intestine OMOP:37166655 - Primary nephroblastoma of left kidney OMOP:37166668 - Primary anaplastic lymphoma kinase fusion oncogene negative non-small cell lung cancer OMOP:37166697 - Fetal disorder due to external version before labor OMOP:37166712 - Radiotherapy course change due to change to treatment intent OMOP:37166738 - Carcinoma of ethmoidal sinus OMOP:37166787 - Undifferentiated carcinoma of hypopharynx OMOP:37166797 - Menke Hennekam syndrome OMOP:37166817 - Syndromic sensorineural deafness due to combined oxidative phosphorylation defect OMOP:37166916 - Epilepsy due to Rasmussen syndrome OMOP:37166920 - Epilepsy due to congenital infectious disease OMOP:37166934 - Hemichorea due to brain abscess OMOP:37166947 - Terra firma-forme dermatosis OMOP:37166988 - Malignant neoplasm of soft tissue of foot OMOP:37167000 - Myelopathy due to liver disease OMOP:37167022 - Meningitis due to and following intrathecal injection OMOP:37167053 - Increased cerebrospinal fluid production due to benign papilloma of choroid plexus OMOP:37167086 - Fetal disorder due to transverse lie before labor OMOP:37167091 - Fetal disorder due to malposition during delivery OMOP:37167110 - Fetal disorder due to maternal hemorrhage during pregnancy OMOP:4069765 - Graphium OMOP:37167115 - Fetal disorder due to maternal death OMOP:37167130 - Fetal disorder due to abnormality of chorion OMOP:37167166 - Drug resistance to anti-seizure medication OMOP:37167183 - Acute renal failure following molar pregnancy OMOP:37167194 - Early neonatal subdural intracranial hemorrhage OMOP:37167196 - Early neonatal non-traumatic hemorrhage of subarachnoid space of brain OMOP:37167230 - Inflammation of muscle of forearm OMOP:37167254 - Neonatal disorder caused by antibacterial transmitted via breast milk OMOP:37167267 - Neonatal disorder caused by immune serum transmitted via breast milk OMOP:37167279 - Fetal disorder caused by medicinal agent transmitted via placenta OMOP:37167345 - Piercing in middle third of upper lip OMOP:37167350 - Early neonatal disorder caused by maternal analgesia transmitted via placenta during labor OMOP:37167364 - Early neonatal disorder due to maternal epidural anesthesia during labor OMOP:37167388 - Fetal parasitic infection OMOP:37167440 - Multiple open wounds of lower limb OMOP:37167469 - Osteolysis of bone adjacent to knee joint prosthesis OMOP:37167517 - Primary small cell carcinoma of lung OMOP:37167531 - Methylenedioxymethamphetamine user OMOP:37167533 - Primary undifferentiated carcinoma of body of uterus OMOP:37167542 - Congenital radioulnar synostosis OMOP:37167589 - Obstructed labor due to interlocked twins OMOP:37167631 - Primary lymphoepithelial carcinoma OMOP:37167653 - Primary gliosarcoma of central nervous system OMOP:37167654 - Primary choroid plexus carcinoma OMOP:37167659 - Primary malignant dysgerminoma of ovary OMOP:37167709 - Siberian elm (pollen) specific immunoglobulin E OMOP:37167731 - Pediatric anesthesiology specialty OMOP:37167770 - Thoracic laser surgery service OMOP:37167778 - Primary primitive neuroectodermal tumor of cervix uteri OMOP:37167836 - Primary mixed germ cell tumor OMOP:37167841 - Primary gemistocytic astrocytoma of central nervous system OMOP:37167868 - Disorder of fetus and/or mother during labor OMOP:37168017 - Focal onset impaired awareness myoclonic epileptic seizure OMOP:37168024 - Central cord syndrome of thoracic spinal cord due to closed dislocation of joint of thoracic spine OMOP:37168033 - Central cord syndrome of thoracic spinal cord due to open subluxation of joint of thoracic spine OMOP:37168050 - Fetal intrapartum disorder OMOP:37168078 - Face to face consultation with patient OMOP:37168136 - Multiple lesions of retina of right eye without detachment OMOP:37168303 - Break of retina of right eye OMOP:37168346 - Acute occlusion of peripheral artery due to thrombosis OMOP:37168355 - Autosomal recessive mendelian susceptibility to mycobacterial disease due to partial JAK1 deficiency OMOP:37168386 - Calpain-3-related limb girdle muscular dystrophy D4 OMOP:37168405 - Histologic type of neoplasm of testis OMOP:37168438 - Entrapment of musculocutaneous nerve OMOP:37168487 - Choanal atresia, athelia, hypothyroidism, delayed puberty, short stature syndrome OMOP:37168521 - Focal onset impaired awareness sensory epileptic seizure OMOP:37168569 - Presence of primary malignant neoplasm of upper urinary tract at surgical margin in ureterectomy specimen OMOP:37168685 - Traumatic injury of globe of eye OMOP:37168705 - Peripheral exudative hemorrhagic chorioretinopathy OMOP:37168817 - Episcleritis caused by Mycobacterium tuberculosis OMOP:37168822 - Ocular hypertension due to anterior segment anomaly OMOP:37168846 - Fracture of bone of shoulder girdle OMOP:37168858 - Metastatic collecting duct renal cell carcinoma OMOP:37168880 - Ulocladium chartarum antigen OMOP:37168930 - High priority for vaccination against monkeypox OMOP:37168933 - Sepsis caused by monkeypox virus OMOP:37169172 - Fast track referral for suspected cancer due to non-site-specific symptoms OMOP:37169179 - Popping of right knee joint OMOP:37169208 - Bilateral myositis of forearms OMOP:37169219 - Periostitis of left lower leg OMOP:37169255 - Hyperpigmentation of right lower eyelid and periocular area OMOP:37169287 - Bilateral enthesopathy of shoulders OMOP:37169338 - Allergic reaction caused by analgesic OMOP:37169354 - Partial occlusion of left fallopian tube OMOP:37169361 - Bilateral fallopian tube endometriosis OMOP:37169384 - Preinfarction syndrome due to arteriosclerosis of nonautologous biological coronary artery bypass graft OMOP:37169385 - Cardiac arrest during cardiac surgery OMOP:37169387 - Nodule of skin of bilateral thumbs OMOP:37169412 - Digital exclusion OMOP:37169431 - Congenital anomaly of right lacrimal drainage system OMOP:37169440 - Angioid streaks of choroid of left eye OMOP:37169449 - Left iritis due to secondary syphilis OMOP:37169456 - Keratopathy of right eye caused by drug OMOP:37169459 - Iodine/creatinine molar concentration ratio in urine OMOP:37169474 - Arthritis of joint of bilateral knees due to viral infection OMOP:37169514 - Chondromalacia of right foot OMOP:37169537 - Bilateral transplant failure of corneas OMOP:37169544 - Tobacco dependence caused by chewing tobacco in remission OMOP:37169551 - Arthrofibrosis of joint of left hand OMOP:37169570 - Anaphylaxis caused by hornet venom OMOP:37169572 - Nickel molar concentration in plasma OMOP:37169593 - Mercury/creatinine molar concentration ratio in urine OMOP:37169633 - Abusive head trauma OMOP:37169676 - Chromium molar concentration in 24 hr urine OMOP:37169692 - Erectile dysfunction due to and following interstitial seed therapy OMOP:37169698 - Infection of brain neurostimulator OMOP:37169722 - Melanocytic nevus of nose OMOP:37169726 - Partial obstruction of intestine following procedure OMOP:37169733 - Traumatic perforation of rectum OMOP:37169796 - Agranulocytosis caused by antithyroid agent OMOP:37169957 - Dissent to receive invitation from GP (general practitioner) practice to participate in research OMOP:37170044 - Hantavirus IgM antibody arbitrary concentration in serum OMOP:37170086 - AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor IgG antibody arbitrary concentration in serum OMOP:37170102 - Trichinella spp total antibody arbitrary concentration in serum OMOP:37170112 - Olive tree IgE antibody arbitrary concentration in serum OMOP:37170115 - Presence of ductal carcinoma in situ at posterior surgical margin in excised breast specimen OMOP:37170174 - Acquired deformity of left pelvic region OMOP:37170242 - Megrim specific IgE antibody arbitrary concentration in serum OMOP:37170252 - Apricot specific IgE antibody arbitrary concentration in serum OMOP:37170255 - Neonatal transient metabolic disturbance OMOP:37170302 - Ryegrass pollen specific IgE antibody arbitrary concentration in serum OMOP:37170589 - Rabbit serum proteins specific IgE antibody arbitrary concentration in serum OMOP:37170613 - Dermatophagoides pteronyssinus house dust mite specific IgE antibody arbitrary concentration in serum OMOP:37170741 - Bilateral mass of axillary regions OMOP:37170760 - Pressure injury of right hip stage II OMOP:37170784 - Pressure injury of right heel stage II OMOP:37170831 - Pressure injury of right ankle stage I OMOP:37170863 - Adult osteochondrosis of thoracolumbar spine OMOP:37170867 - Aneurysmal bone cyst of right radius OMOP:37170881 - Anterior spinal artery compression syndrome of thoracic spinal cord OMOP:37171006 - Pyogenic infection of lumbosacral intervertebral disc OMOP:37171020 - Metadrenaline molar concentration in plasma OMOP:37171021 - Morphologically normal sperm number concentration in semen OMOP:37171102 - Johnson grass pollen specific IgE antibody arbitrary concentration in serum OMOP:37171108 - Pigweed pollen specific IgE antibody arbitrary concentration in serum OMOP:37171114 - Thoracic postural kyphosis OMOP:37171157 - Sacrococcygeal spinal instability OMOP:37171184 - Inflammation of semimembranosus muscle bursa of left knee OMOP:37171234 - Right purulent endophthalmitis OMOP:37171286 - Left toxic maculopathy OMOP:37171350 - Bilateral Soemmerring's ring OMOP:37171380 - Bilateral idiopathic corneal edema OMOP:37171438 - Malignant melanoma of skin of left hip OMOP:37171453 - Primary malignant neoplasm of right eye OMOP:37171499 - Pressure injury of ankle stage II OMOP:37171531 - Free protein S/total protein S ratio in plasma OMOP:37171548 - Sperm tail defect percent count in semen OMOP:37171582 - ssDNA (single stranded DNA) antibody arbitrary concentration in serum OMOP:37171584 - Chronic pain following musculoskeletal injury OMOP:37171585 - Chronic painful polyneuropathy OMOP:37171606 - Chronic visceral pain in abdominal region due to disorder OMOP:37171624 - Bite wound of left eye region OMOP:37171680 - Foreign body in left auricle OMOP:37171681 - Foreign body in left forearm OMOP:37171687 - Foreign body in right lower leg OMOP:37171700 - Malignant melanoma of skin of left elbow OMOP:37171714 - Hematoma of left elbow region OMOP:37171722 - Hematoma of left great toe OMOP:37171948 - Corynebacterium ulcerans number concentration by culture OMOP:37172043 - Cut of skin of right hand OMOP:37172216 - Interstitial lung disorder due to dabbing OMOP:37172244 - Persistent atrial fibrillation due to heart valve disorder OMOP:37172276 - Large volume of residual urine after micturition OMOP:37172324 - HIV (human immunodeficiency virus) 1 RNA nucleic acid amplification qualitative result OMOP:37172325 - Poliovirus 2 RNA nucleic acid amplification qualitative result OMOP:37172593 - Ambulant renin arbitrary concentration in plasma OMOP:37172681 - Mass of ankle OMOP:37172693 - Mass of right colic flexure OMOP:37172694 - Mass of left frontal lobe of brain OMOP:37172696 - Mass of neurohypophysis OMOP:37172838 - Referral to transportation network company program OMOP:37172846 - Referral to microtransit program OMOP:37172899 - Hyaluronic acid molar concentration in serum OMOP:37172954 - nAna c 2 Bromelain, Pineapple specific IgE antibody arbitrary concentration in serum OMOP:37172997 - Salicylate mass concentration in serum OMOP:37173080 - Palmitoylcarnitine molar concentration in blood OMOP:37173098 - Monoparesis of right upper limb OMOP:37173101 - Weakness of left upper limb OMOP:37173246 - AMPA2 (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid 2) receptor antibody arbitrary concentration in serum OMOP:37173335 - Pressure injury of back stage II OMOP:37173341 - Pressure injury of left thoracic region of back stage III OMOP:37173346 - Pressure injury of right thoracic region of back stage III OMOP:37173388 - Pseudomonas spp antibody in serum qualitative result OMOP:37173398 - Aldosterone mass concentration in 24 hr urine OMOP:37173444 - Assistance with application for microtransit program OMOP:37173474 - Counseling for readiness to achieve transportation security OMOP:37173514 - Chlamydophila pneumoniae antibody in serum qualitative result OMOP:37173575 - Limited access to healthcare due to lack of time OMOP:37173606 - Measles antigen qualitative result OMOP:37173674 - Felbamate mass concentration in serum OMOP:37173787 - Education about continuation of health coverage program OMOP:37173797 - Education about Department of Veterans Affairs Veteran Services Officer OMOP:37173817 - Education about military funded education program OMOP:37173822 - Arthritis of joint of left shoulder region OMOP:37173825 - Arthritis of joint of right shoulder region OMOP:37173835 - Assistance with application for state general assistance program OMOP:37173841 - Assistance with application for English as a second language program OMOP:37173856 - Assistance with application for Department of Veterans Affairs Intimate Partner Violence Assistance Program OMOP:37173865 - Assistance with application for AmericaServes Program OMOP:37173876 - Assistance with application for Department of Veterans Affairs Veteran Readiness and Employment Program OMOP:37173888 - Referral to community wellness program OMOP:37173910 - Referral to social connection resource directory OMOP:37173915 - Referral to vocational education program OMOP:37173942 - Referral to Department of Veterans Affairs Veteran Call Center OMOP:37173948 - Porphyrin/creatinine molar concentration ratio in urine OMOP:37174054 - CD4/CD8 ratio in blood OMOP:37174167 - Methaemoglobin percent in whole blood OMOP:37174193 - Primary squamous cell carcinoma of prepuce OMOP:37174211 - Head circumference of biological mother OMOP:37174228 - Chronic synovitis of left wrist due to hemarthrosis OMOP:37174241 - Hemophilic arthropathy of left elbow OMOP:37174245 - Hemophilic arthropathy of right hip OMOP:37174248 - Hemophilic arthropathy of left knee OMOP:37174254 - Anaphylaxis caused by component of vaccine product containing only acellular Bordetella pertussis and Clostridium tetani and Corynebacterium diphtheriae antigens OMOP:37174278 - Bilateral dystrophy of anterior surface of cornea of eyes OMOP:37174281 - Visual field defect due to and following intracerebral hemorrhage OMOP:37174296 - Acquired cerebellar atrophy OMOP:37174355 - Percentage of time above level 2 hyperglycaemic threshold to total continuous glucose monitoring time using minimally-invasive continuous glucose monitoring device OMOP:37174425 - Nucleated red blood cells percent in blood OMOP:37175230 - Chryseobacterium aquifrigidense OMOP:37175325 - Poisoning caused by household product OMOP:37175334 - Anaphylaxis caused by allergy skin test OMOP:37175342 - SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) vaccination invitation email OMOP:37175346 - On palliative care register OMOP:37175349 - Chronic hepatitis B during pregnancy OMOP:37203813 - Xp22.13p22.2 duplication syndrome OMOP:37203831 - Progressive myoclonic epilepsy type 6 OMOP:37204037 - Vitamin K epoxide reductase complex 1 ultra-rapid metabolizer OMOP:37204049 - Sclerostin inhibitor OMOP:37204059 - Muenke syndrome OMOP:37204089 - Progressive avascular necrosis of lunate OMOP:37204097 - Chromium supplement therapeutic role OMOP:37204147 - Retraction of left nipple OMOP:37204169 - Benign neoplasm of right adrenal gland OMOP:37204211 - Severe intellectual disability, progressive spastic diplegia syndrome OMOP:37204212 - Multisystemic smooth muscle dysfunction syndrome OMOP:37204403 - Progressive myoclonic epilepsy type 5 OMOP:37204409 - Progressive myoclonic epilepsy type 3 OMOP:37204486 - Iatrogenic immunodeficiency-associated lymphoproliferative disorder OMOP:37205042 - Windswept hip deformity OMOP:37205064 - Familial infantile myoclonic epilepsy OMOP:37205066 - Cortical dysgenesis with pontocerebellar hypoplasia due to TUBB3 mutation OMOP:37205105 - Hematoma of ovary OMOP:37205774 - Autosomal recessive spastic paraplegia type 24 OMOP:37206124 - Dickeya fangzhongdai OMOP:37206205 - Maternal history of pyrexia in labor OMOP:37206249 - Contracture of joint following injury OMOP:37207422 - Mild muscle atrophy OMOP:37207426 - Moderate generalized edema OMOP:37207609 - First intranasal seasonal influenza vaccination not done OMOP:37207722 - Disorder of joint of lumbosacral vertebra OMOP:37207809 - Seronegative rheumatoid arthritis of multiple joints OMOP:37207833 - Arthritis of right wrist caused by Staphylococcus OMOP:37207836 - Pigmented villonodular synovitis of joint of left knee OMOP:37207900 - Vitreous prolapse of left eye OMOP:37208025 - Primary malignant neoplasm of right adrenal gland OMOP:37208054 - Referral to diabetes prevention program OMOP:37208057 - Neoplasm of bone of left foot OMOP:37208065 - Neoplasm of right ulna OMOP:37208113 - Acute repetitive seizure OMOP:37208162 - Suicide attempt by burning self OMOP:37208203 - Bilateral neovascularization of choroid of eye OMOP:37208226 - Scar of conjunctiva of right eye OMOP:37208254 - Schwannoma of nerve of head OMOP:37208267 - Acquired deformity of left calcaneus OMOP:37208354 - Royal College of Physicians NEWS2 (National Early Warning Score 2) OMOP:37208415 - Subacute combined degeneration of spinal cord due to use of nitrous oxide OMOP:37208434 - Haemoglobinopathy screening declined OMOP:37208448 - Hepatitis C screening not indicated OMOP:37208578 - Auditory threshold of left ear at 250 Hertz OMOP:37208630 - Complement C4 mass concentration in plasma OMOP:37208947 - Fetal skeletal dysplasia OMOP:37209059 - Abscess of skin of left shoulder OMOP:37209067 - Abscess of pulp of left thumb OMOP:37209120 - Open fracture of middle phalanx of middle finger of left hand OMOP:37209140 - Open bicondylar fracture of upper end of right tibia OMOP:37209146 - Open fracture of right clavicle OMOP:37209151 - Open fracture of left scapula OMOP:37209294 - Mass of left ovary OMOP:37209297 - Bilateral atypical ductal hyperplasia of breasts OMOP:37209349 - Effusion of bilateral hip joints OMOP:37209360 - Bilateral blepharochalasis OMOP:37209361 - Cupping of left optic disc due to open-angle glaucoma of left eye OMOP:37209412 - Bilateral eye strain OMOP:37209458 - Congenital ulnar negative variant of bilateral wrists OMOP:37209461 - Articular cartilage disorder of joint of left elbow OMOP:37209514 - Hypogammaglobulinemia due to multiple myeloma OMOP:37209605 - Pain of left testicle OMOP:37209609 - Bilateral hemorrhagic corpus luteum cysts OMOP:37209623 - Macular retinal edema due to occlusion of right central retinal vein OMOP:372328 - Otitis media OMOP:372547 - Viral encephalitis OMOP:372642 - Corneal staphyloma OMOP:372766 - Open wound of head with complication OMOP:372842 - Gonococcal conjunctivitis neonatorum OMOP:37309660 - Memory deficit due to and following hemorrhagic cerebrovascular accident OMOP:37309678 - Enchondroma of left humerus OMOP:37309682 - Delirium due to methamphetamine intoxication OMOP:37309690 - Bilateral peripheral visual field defect OMOP:37309786 - Partial thickness burn of left upper arm OMOP:37309815 - Chemical burn of left forearm OMOP:37309850 - Chemical burn of back of right hand OMOP:37309891 - Full thickness burn of right hand OMOP:37309947 - Infected wound of right foot due to nonvenomous insect bite OMOP:37309950 - Hematoma of left foot OMOP:37309968 - Hematoma of left knee region OMOP:37309982 - Wound of left shoulder due to nonvenomous insect bite OMOP:37309995 - Wound of left breast due to nonvenomous insect bite OMOP:37310005 - Wound of left knee region due to nonvenomous insect bite OMOP:37310043 - Abrasion of skin of left ring finger OMOP:37310045 - Abrasion of skin of left little finger OMOP:37310084 - Laceration of left popliteal artery OMOP:37310098 - Open wound of left lower leg due to animal bite OMOP:37310108 - Open wound of left elbow region OMOP:37310120 - Open wound of left index finger due to dog bite OMOP:37310121 - Open wound of left middle finger due to dog bite OMOP:37310198 - Laceration of right breast OMOP:37310217 - Open wound of left eyelid OMOP:37310238 - Open mallet fracture of distal phalanx of ring finger of right hand OMOP:37310605 - Benign neoplasm of left epididymis OMOP:37310607 - Benign neoplasm of left orbit OMOP:37310619 - Idiopathic cyst of left iris OMOP:37310844 - Post-MRI OMOP:37310950 - Streptococcus pneumoniae Danish serotype 4 capsular polysaccharide antigen conjugated to Corynebacterium diphtheriae CRM197 protein OMOP:37310975 - Inactivated whole Human poliovirus serotype 1 Mahoney strain antigen OMOP:37310993 - General pediatric specialty OMOP:37311151 - Normal tone in skeletal muscle OMOP:37311186 - Unequal reaction of bilateral pupils OMOP:37311200 - Intact hypoglossal nerve OMOP:37311243 - Pleasant dreams OMOP:37311244 - Fullness of rectum due to feces OMOP:37311250 - Bilateral lower limb edema OMOP:37311251 - Edema of right lower leg OMOP:37311258 - Measured gestational weight loss OMOP:37311294 - Exaggeration of brachioradialis reflex OMOP:37311332 - Normal pulse in left dorsalis pedis artery OMOP:37311343 - Lasiobolidium OMOP:37311402 - Genus Pleurotus OMOP:37311448 - Live attenuated Junin virus antigen OMOP:37311466 - Pteronotus parnellii OMOP:37311535 - Infant formula intake concentration OMOP:37311555 - Estimated quantity of intake of iodine in 24 hours OMOP:37311567 - Estimated intake of grain servings in 24 hours OMOP:37311669 - Tethering of lymph node OMOP:37311742 - Infant formula feedings in 24 hours OMOP:37311792 - Amputated toe of left foot OMOP:37311826 - Labor and birth support OMOP:37311833 - Stable treated proliferative retinopathy of right eye due to diabetes mellitus OMOP:37311864 - Focal facial dermal dysplasia type II OMOP:37311882 - Estimated quantity of intake of fat and oil via enteral route in 24 hours OMOP:37311912 - Necrotizing enterocolitis of newborn, stage 1A OMOP:37311923 - Late syphilis of skin OMOP:37311983 - Henipavirus encephalitis OMOP:37311987 - Dissociative neurological symptom disorder co-occurrent with parkinsonism OMOP:37312000 - Delusion of misidentification OMOP:37312055 - Pituicytoma of posterior pituitary gland OMOP:37312080 - Pulse present in right popliteal artery OMOP:37312091 - Lipoma of nerve OMOP:37312191 - Lasiurus xanthinus OMOP:37312218 - Neuropathy due to type 1 diabetes mellitus OMOP:37312362 - Repetitive motion disorder of right forearm OMOP:37312504 - Enriched food intake OMOP:37312542 - Normal pulse in left posterior tibial artery OMOP:37312605 - Requires vaccination against leishmaniasis OMOP:37312691 - Antibacterial therapeutic role OMOP:37312693 - Anthelmintic therapeutic role OMOP:373127 - Herpes simplex disciform keratitis OMOP:37312749 - Yeast not Candida species and not Cryptococcus neoformans detected OMOP:373469 - Symptomatic torsion dystonia OMOP:373494 - Cholesterol granuloma of middle ear OMOP:373638 - Superficial injury of cornea OMOP:37394012 - Has DOAC (direct-acting oral anticoagulant) alert card OMOP:37394045 - Referral to NHS Diabetes Prevention Programme declined OMOP:37394378 - Hepatitis A IgM antibody test OMOP:37394685 - Has CHAT (Comprehensive Health Assessment Tool) care plan OMOP:37394696 - Anxiety resolved OMOP:37395491 - Arrival by helicopter air ambulance OMOP:37395521 - Acute kidney injury due to acute tubular necrosis due to circulatory failure with histological evidence OMOP:37395552 - O/E - swallowing normal OMOP:37395572 - Alzheimer's disease co-occurrent with delirium OMOP:37395648 - Primary small cell malignant neoplasm of lung, TNM stage 1 OMOP:37395753 - Carbapenem resistant Escherichia coli OMOP:37395759 - Digitotalar dysmorphism OMOP:37395884 - Microcephalic primordial dwarfism Toriello type OMOP:37395903 - Infection of central nervous system caused by Borrelia burgdorferi OMOP:37395919 - Weismann Netter syndrome OMOP:37396052 - Brachydactyly type A4 OMOP:37396086 - Acute motor axonal neuropathy OMOP:37396131 - Familial advanced sleep phase syndrome OMOP:37396141 - Normal periodontium with attachment loss OMOP:37396175 - Anaphylaxis caused by sulfite salt OMOP:37396259 - Fetal diethylstilbestrol syndrome OMOP:37396375 - Morse Rawnsley Sargent syndrome OMOP:37396455 - Neisseria meningitidis serogroup C capsular polysaccharide antigen OMOP:37396462 - Epilepsy with eyelid myoclonia OMOP:37396532 - Logopenic progressive aphasia OMOP:37396549 - Able to identify interests OMOP:37396558 - Able to manage urinary catheter care OMOP:37396606 - Difficulty understanding three word instructions OMOP:37396656 - Finding related to ability to use consonant vowel consonant vowel combination OMOP:37396747 - Autosomal dominant late onset Parkinson disease OMOP:37396761 - Dominant beta-thalassemia OMOP:37396787 - Spinocerebellar ataxia type 15/16 OMOP:37396808 - Cancer-related fatigue OMOP:37396891 - Antineoplastic chemotherapy regimen OMOP:37397046 - Non carious lesion at cervical margin of tooth OMOP:37397050 - Terribacillus goriensis OMOP:37397116 - Take on an empty stomach OMOP:37397118 - Trisomy 10p OMOP:37397162 - Neisseria meningitidis serogroup Y or Neisseria meningitidis serogroup W135 OMOP:37397168 - Streptococcus pneumoniae or Streptococcus viridans group OMOP:37397176 - Hereditary palmoplantar keratoderma Gamborg Nielsen type OMOP:37397182 - Torula herbarum OMOP:37397198 - Secondary intestinal lymphangiectasia OMOP:37397208 - Left renal vein entrapment syndrome OMOP:37397340 - Mouth care OMOP:37397353 - Melanoma and neural system tumor syndrome OMOP:37397397 - Education about take home naloxone for opiate overdose intervention OMOP:37397515 - 30 item General Health Questionnaire OMOP:37397557 - Autosomal dominant popliteal pterygium syndrome OMOP:37397558 - Progressive hemifacial atrophy OMOP:37397667 - Temporomandibular joint normal OMOP:37397746 - Complication due to imaging of patient with implanted medical device OMOP:37398551 - HEp-2 (human epithelial type 2) cell autoantibody screening test OMOP:37398909 - Arrival by own transport OMOP:37398919 - Familial abdominal aortic aneurysm OMOP:37398930 - Combined deficiency of factor V and factor VIII OMOP:37398939 - Pituitary stalk interruption syndrome OMOP:37398992 - Able to adapt to sensory changes in body part OMOP:37399028 - X-linked reticulate pigmentary disorder with systemic manifestation syndrome OMOP:37399347 - Oceanobacillus oncorhynchi subspecies incaldanensis OMOP:37399443 - Autosomal recessive cerebellar ataxia with oculomotor apraxia type 1 OMOP:37399451 - Autosomal recessive spastic paraplegia type 11 OMOP:373995 - Delirium OMOP:374021 - Acute disseminated encephalomyelitis OMOP:374226 - Burn of eye region OMOP:374363 - Posterior dislocation of lens OMOP:374377 - Paralytic syndrome OMOP:374639 - Chronic headache disorder OMOP:374641 - Round hole of retina without detachment OMOP:374954 - Optic neuritis OMOP:376106 - Disorder of the central nervous system OMOP:376331 - Post measles otitis media OMOP:376394 - Menstrual migraine OMOP:376399 - Incipient cataract OMOP:376405 - Binocular vision disorder OMOP:376657 - Lipoma of skin and subcutaneous tissue of face OMOP:376699 - Cicatricial ectropion OMOP:377271 - Neuralgic amyotrophy OMOP:377565 - Optic atrophy associated with retinal dystrophy OMOP:377789 - Syphilitic retrobulbar neuritis OMOP:377886 - Chronic purulent otitis media OMOP:378135 - Facial nerve disorder OMOP:378264 - Open fracture of base of skull with cerebral laceration AND contusion OMOP:378849 - Microtia OMOP:379806 - Migraine variants OMOP:38003563 - Hispanic or Latino OMOP:38003564 - Not Hispanic or Latino OMOP:38003572 - American Indian OMOP:38003573 - Alaska Native OMOP:38003574 - Asian Indian OMOP:38003575 - Bangladeshi OMOP:38003576 - Bhutanese OMOP:38003577 - Burmese OMOP:38003578 - Cambodian OMOP:38003579 - Chinese OMOP:38003580 - Taiwanese OMOP:38003581 - Filipino OMOP:38003582 - Hmong OMOP:38003583 - Indonesian OMOP:38003584 - Japanese OMOP:38003585 - Korean OMOP:38003586 - Laotian OMOP:38003587 - Malaysian OMOP:38003588 - Okinawan OMOP:38003589 - Pakistani OMOP:38003590 - Sri Lankan OMOP:38003591 - Thai OMOP:38003592 - Vietnamese OMOP:38003593 - Iwo Jiman OMOP:38003594 - Maldivian OMOP:38003595 - Nepalese OMOP:38003596 - Singaporean OMOP:38003597 - Madagascar OMOP:38003598 - Black OMOP:38003599 - African American OMOP:38003600 - African OMOP:38003601 - Bahamian OMOP:38003602 - Barbadian OMOP:38003603 - Dominican OMOP:38003604 - Dominica Islander OMOP:38003605 - Haitian OMOP:38003606 - Jamaican OMOP:38003607 - Tobagoan OMOP:38003608 - Trinidadian OMOP:38003609 - West Indian OMOP:38003610 - Polynesian OMOP:38003611 - Micronesian OMOP:38003612 - Melanesian OMOP:38003613 - Other Pacific Islander OMOP:38003614 - European OMOP:38003615 - Middle Eastern or North African OMOP:38003616 - Arab OMOP:380942 - Western equine encephalitis OMOP:381569 - Myogenic ptosis OMOP:381576 - Extrinsic cartilagenous obstruction of eustachian tube OMOP:381677 - Spina bifida occulta OMOP:381866 - Degenerative disorder of eyelid OMOP:3964638 - Alternaria alternata IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3964694 - Arrowroot IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3964717 - Stachybotrys chartarum IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3964812 - Foundation pain index Document by based on lab data OMOP:3964820 - Corn IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3964921 - History of Health informatics pioneer and the father of LOINC OMOP:3964942 - Vitamin B3 and metabolites panel - Serum or Plasma by LC/MS/MS OMOP:3964972 - Silver Birch recombinant (rBet v) 2 + 4 IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965004 - Bone DXA Calcaneus [T-score] Bone density OMOP:3965081 - CD3+CD4+ (T4 helper) cells [#/volume] in Blood --after stimulation with SARS-CoV-2 Nucleocapsid peptide OMOP:3965104 - Alpha-1-Antitrypsin Proteotype Panel - Serum or Plasma OMOP:3965119 - 17-Hydroxyprogesterone [Mass/volume] in Saliva (oral fluid) OMOP:3965164 - Beta lactoglobulin IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965199 - The Primary Care PTSD Screen for DSM-5 [PC-PTSD-5] OMOP:3965203 - Beta lactoglobulin IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965233 - Grape IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965241 - Ceruloplasmin [Mass/volume] in 24 hour Urine OMOP:3965284 - Bacterial carbapenem resistance blaIMI+blaNMC genes [Presence] by Molecular method OMOP:3965377 - Hantavirus IgG panel - Serum or Plasma by Line blot OMOP:3965510 - Rhizopus nigricans IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965559 - ETV6 gene rearrangements in Tissue by FISH OMOP:3965602 - Peanut IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965610 - Peach IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965627 - Guinea pig epithelium IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965712 - Sphingolipid panel - Serum OMOP:3965734 - Apricot IgG Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3965996 - Dog dander IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966017 - Burrobrush IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966096 - Follitropin and lutropin post leuprolide stimulation panel - Serum OMOP:3966197 - Sodium urate crystals [Energy Difference] in Urine OMOP:3966203 - Peach recombinant (rPru p) 1 IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966226 - Sesamum indicum 1 IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966240 - Wake time after sleep onset OMOP:3966406 - Rat urine proteins IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966491 - Pear IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:3966493 - Dipeptidyl aminopeptidase-like protein 6 Ab [Presence] in Serum or Plasma by Immunofluorescence OMOP:3966531 - Have you tried not to think about or avoided situations that reminded you of the event(s) [PC-PTSD-5] OMOP:3966733 - Aspergillus sp IgE Ab [Presence] in Serum by Radioallergosorbent test (RAST) OMOP:4000050 - Caranx lugubris OMOP:4000176 - Heterodera radicicola OMOP:4000981 - Peroneus brevis tenosynovitis OMOP:4001297 - Infection of phalanx of toe OMOP:4001314 - Paget's disease-lumbar spine OMOP:4001448 - Cervical root syndrome OMOP:4001453 - Sacroiliac disorder OMOP:4001514 - Vertical fracture of root of tooth OMOP:4001654 - Paralytic calcification / ossification of muscle OMOP:4001674 - Fracture of dental root OMOP:4001681 - Complex laceration of floor of mouth OMOP:4001682 - Avulsion of floor of mouth OMOP:4001686 - Contaminated simple laceration of buccal mucosa OMOP:4001831 - Abrasion of maxillary vestibule OMOP:4001887 - Carbuncle of heel OMOP:4001989 - Streptococcal infection of mouth OMOP:4002012 - Absent reticulin OMOP:4002142 - Cervical spine instability OMOP:4002147 - Pes anserinus tendinitis and bursitis OMOP:4002308 - Congenital stenosis of larynx, trachea and bronchus OMOP:4002343 - Overlapping malignant neoplasm of peripheral nerves and autonomic nervous system OMOP:4002348 - Primary malignant neoplasm of peripheral nerves of shoulder OMOP:4002352 - Primary malignant neoplasm of peripheral nerves of thorax OMOP:4002477 - Congenital absence of hepatic ducts OMOP:4002504 - Simple laceration of cheek OMOP:4002508 - Simple laceration of malar region of cheek OMOP:4002658 - Avulsion of tonsil OMOP:4002659 - Traumatic hemorrhage OMOP:4002670 - Burn of circumoral region OMOP:4002791 - Extensor digitorum longus tenosynovitis OMOP:4002809 - Infective myositis of forearm OMOP:4002859 - Maxillary asymmetry due to hemifacial atrophy OMOP:4002901 - Benign teratoma of ovary OMOP:4002969 - Infection of fibula OMOP:4003021 - Angiosarcoma of liver OMOP:4003024 - Mesothelioma of omentum OMOP:4003195 - Simple periorbital laceration OMOP:4003313 - Tuberculosis of lumbar spine OMOP:4003331 - Avulsion of maxilla OMOP:4003352 - Abrasion of skin of circumoral region of face OMOP:4003512 - Osteomyelitis of maxilla OMOP:4003633 - Female hypospadias OMOP:4003834 - Malignant immunoproliferative disease (clinical) OMOP:4003837 - Salmonella Potto OMOP:4003847 - Avulsion of forehead OMOP:4003981 - Abnormal palmar creases OMOP:4004299 - Congenital fecal fistula OMOP:4004317 - Congenital aplasia of round ligament OMOP:4004484 - Tongue swallowing OMOP:4004536 - Carbidopa measurement OMOP:4004718 - Protein C antigen OMOP:4004839 - Fletcher factor assay OMOP:4004953 - Brachydactyly-missing phalanx OMOP:4005022 - Phosphatidyl glycerol antibody OMOP:4005037 - Childhood type dermatomyositis OMOP:4005215 - Isobutyl acetate measurement OMOP:4005251 - Bone marrow hyperplasia OMOP:4005358 - Procaine measurement OMOP:4005614 - Hypoplasia of spinal vessel OMOP:4005639 - Second degree burn of soft palate OMOP:4005818 - Malignant odontogenic ghost cell tumor OMOP:4006126 - Transverse arrest carpal level OMOP:4006131 - Mercury-203 OMOP:4006169 - Topiramate measurement OMOP:4006291 - Perodactylia of multiple toes OMOP:4006325 - Hypertension secondary to renal disease in obstetric context OMOP:4006334 - Aliphatic hydrocarbon measurement OMOP:4006659 - Inini virus OMOP:4006958 - Contact dermatitis caused by phenol OMOP:4006989 - Cephalodiprosopus OMOP:4006990 - Gingival hypertrophy caused by diphenylhydantoin OMOP:4007183 - Halothane measurement OMOP:4007189 - Hyoscyamine measurement OMOP:4007333 - Measurement of Salmonella enterica subspecies enterica serovar Typhi O antibody OMOP:4007453 - Gammopathy OMOP:4007457 - Burn scar OMOP:4007483 - Bluetongue virus serotype determination OMOP:4007505 - Dermatoxys veligera OMOP:4007611 - Salmonella Sherbrooke OMOP:4007621 - Open wound of thumbnail with complication OMOP:4007651 - Decanoylcarnitine measurement OMOP:4007664 - Methylcitrate measurement OMOP:4007730 - Accessory pituitary gland OMOP:4007946 - Pigmentary atrophy OMOP:4008006 - Peanut butter OMOP:4008236 - Absent renal function OMOP:4008356 - Multiple fractures of lumbar spine and/or pelvis OMOP:4008394 - Stonemason (construction) OMOP:4008488 - Efrotomycin OMOP:4008544 - Habronema zebrae OMOP:4008567 - Kleine-Levin syndrome OMOP:4008570 - Fukuyama congenital muscular dystrophy OMOP:4008572 - Distal muscular dystrophy, Miyoshi type OMOP:4008731 - Infection by Draschia OMOP:4008883 - Onset of labor induced OMOP:4009039 - Scapulocostal syndrome OMOP:4009075 - Cost accountant OMOP:4009190 - Building inspector OMOP:4009204 - Housing manager OMOP:4009349 - Inspector of taxes OMOP:4009350 - Industrial relations officer OMOP:4009361 - Government intelligence officer OMOP:4009394 - Liver pain OMOP:4009456 - Open fracture of sesamoid bone of hand OMOP:4009593 - Closed fracture finger distal phalanx, base OMOP:4009608 - Closed fracture proximal femur, subcapital, Garden grade III OMOP:4009694 - Telecine operator OMOP:4009715 - Microphobia OMOP:4009748 - Closed fracture calcaneus, extra-articular OMOP:4009762 - Closed traumatic dislocation superior radioulnar joint OMOP:4009799 - Mechanical complication of internal orthopedic device OMOP:4009872 - Patient reaction finding OMOP:4009886 - Age 60 to 64 years OMOP:4009897 - Open traumatic subluxation, distal interphalangeal joint OMOP:4009931 - Salmonella Herzliya OMOP:4009978 - Ships agent OMOP:4010012 - Edema of knee OMOP:4010081 - Hemicaranx amblyrhynchus OMOP:4010087 - Betula OMOP:4010220 - Cough fracture of ribs OMOP:4010232 - Open fracture pelvis, iliac wing OMOP:4010293 - Helicopter co-pilot OMOP:4010333 - Postmenopausal osteoporosis OMOP:4010353 - Semi-erect body position OMOP:4010405 - Leukocyte antibody measurement OMOP:4010429 - Platelet antigen HPA-1b OMOP:4010478 - Uterine dysfunction OMOP:4010483 - Pancreatic sign OMOP:4010534 - Closed fracture finger distal phalanx, tuft OMOP:4010611 - Trainee - animal health OMOP:4010613 - Writer - journalism OMOP:4010616 - Director - films OMOP:4010628 - Newsreader (radio/television) OMOP:4010768 - Electrical engineer - trainee OMOP:4010804 - Site agent OMOP:4010937 - Accountant manager OMOP:4010972 - Trepopnea OMOP:4011106 - Betting counter clerk OMOP:4011120 - Copy typist OMOP:4011125 - Supervisor: radio operator OMOP:4011165 - Cytoplasmic immunoglobulin Mu chain antigen OMOP:4011205 - Glutamicibacter uratoxydans OMOP:4011226 - Human rhinovirus 101 OMOP:4011244 - Babesia felis OMOP:4011251 - Onchocerca armillata OMOP:4011256 - Office manager - sales OMOP:4011432 - Trainee radio/telegraph operator OMOP:4011626 - Normal sexual behavior OMOP:4011639 - Compound nerve action potential OMOP:4011685 - Salmonella Goma OMOP:4011795 - Lymphocyte antigen CD107B OMOP:4011871 - Muehrcke's lines OMOP:4011876 - Manager - arable and livestock farm OMOP:4011913 - Selling occupation OMOP:4011967 - Open traumatic subluxation, subtalar joint OMOP:4012114 - Abusive sexual relationship with wife OMOP:4012122 - Sensation of hot and cold OMOP:4012198 - Pain in female genitalia OMOP:4012233 - Urine looks normal OMOP:4012242 - Lumbosacral nerve root pain OMOP:4012251 - Delta-5-pregnanetriol OMOP:4012345 - Nipple discharge symptom OMOP:4012445 - Open fracture distal femur, bicondylar (T-Y fracture) OMOP:4012520 - Dizziness present OMOP:4012579 - Open fracture ankle, trimalleolar, low fibular fracture OMOP:4012603 - Closed traumatic subluxation of elbow OMOP:4012711 - Human gammaherpesvirus 4 early antigen OMOP:4012724 - Lymphocyte antigen CD104 OMOP:4012729 - Closed traumatic subluxation distal radioulnar joint OMOP:4012760 - Dendroaspis jamesoni OMOP:4012812 - Laboratory test not necessary OMOP:4012854 - Acetylcholine receptor binding antibody OMOP:4012857 - Eptatretus stouti OMOP:4012988 - Kingdom Protozoa oocyst OMOP:4013004 - Atypical cells of undetermined significance OMOP:4013130 - S blood group typing OMOP:4013182 - Camelus dromadarius OMOP:4013322 - Closed fracture acetabulum, anterior lip alone OMOP:4013685 - Intelligence quotient OMOP:4013697 - Independent walking OMOP:4013730 - Transtentorial approach OMOP:4013759 - Closed spinal fracture with posterior lumbar cord lesion OMOP:4013811 - Bordetella trematum OMOP:4013895 - Specimen less than optimal for diagnosis for lack of clinical information OMOP:4014094 - Sensory isolation OMOP:4014126 - Serum anti-cardiolipin measurement OMOP:4014170 - Isolated gonadotropin deficiency OMOP:4014223 - Strain of patellar tendon OMOP:4014263 - Sutcliffiella cohnii OMOP:4014268 - Sutcliffiella horikoshii OMOP:4014395 - Tsukamurella pulmonis OMOP:4014529 - Sprain, symphysis pubis OMOP:4014573 - Bifidobacterium lactis OMOP:4014599 - Child weight=3rd-9th centile OMOP:4014636 - Measurement of Mycoplasma species antibody OMOP:4014677 - Helicobacter rodentium OMOP:4014736 - Child HC = > 97th centile OMOP:4014792 - Closed traumatic subluxation, metatarsophalangeal joint, single OMOP:4014985 - Salmonella Poitiers OMOP:4014992 - Child 3 year exam abnormal - on treatment OMOP:4015038 - Serous atrophy OMOP:4015143 - Spontaneous rupture of fetal membranes OMOP:4015203 - Closed fracture subluxation of multiple metatarsophalangeal joints OMOP:4015240 - Alicyclobacillus acidocaldarius OMOP:4015358 - Closed fracture thumb metacarpal neck OMOP:4015376 - Family Campylobacteraceae OMOP:4015386 - Carnobacterium divergens OMOP:4015394 - Streptococcus thoraltensis OMOP:4015421 - Triplets - two live and one stillborn OMOP:4015533 - Dialister pneumosintes OMOP:4015676 - Circumoral paresthesia OMOP:4015696 - Salmonella Leer OMOP:4015769 - Salmonella Douala OMOP:4015771 - Salmonella Torhout OMOP:4015773 - Salmonella Ockenheim OMOP:4015789 - Salmonella II 41:k:z6 OMOP:4015824 - Using inhaled steroids - high dose OMOP:4015956 - Neurological disorder monitoring OMOP:4015965 - Open fracture finger distal phalanx, shaft OMOP:4015983 - Closed fracture distal femur, bicondylar (T-Y fracture) OMOP:4015992 - Closed fracture proximal tibia, lateral condyle (plateau) OMOP:4016000 - Family Methanococcaceae OMOP:4016011 - Order Chlamydiales OMOP:4016031 - Salmonella Kindia OMOP:4016046 - Chronic hyperglycemia OMOP:4016050 - Diabetic annual review OMOP:4016130 - Open fracture proximal phalanx, toe OMOP:4016379 - Microbial antigen assay by radioimmunoassay method OMOP:4016484 - Age when first stood OMOP:4016498 - Renal vein renin stimulation panel OMOP:4016502 - Lupus anticoagulant assay, platelet neutralization method OMOP:4016568 - Salmonella IIIb 11:l,v:z53 OMOP:4016636 - Child 3 year exam not wanted OMOP:4016690 - Complete tear, finger, metacarpophalangeal joint, ulnar collateral ligament OMOP:4016731 - Salmonella II 1,9,12:g,z62:[e,n,x] OMOP:4016789 - Identification of antibody to RBC antigens from Gerbich system (ISBT 020) OMOP:4016799 - Direct antiglobulin test, polyspecific reagent OMOP:4016866 - Curtobacterium pusillum OMOP:4016874 - Fremitus OMOP:4016956 - Ureteritis glandularis OMOP:4016976 - Thermoactinomycetes OMOP:4016998 - Salmonella Woodhull OMOP:4017023 - Oral steroids started OMOP:4017112 - Salmonella Lancaster OMOP:4017141 - Salmonella II 1,9,12:b:e,n,x OMOP:4017144 - Salmonella II 9,12:d:e,n,x OMOP:4017260 - Salmonella II 3,10:l,z28:e,n,x OMOP:4017274 - Synovial like neoplasm OMOP:4017306 - Fit frequency OMOP:4017428 - Antibody band pattern OMOP:4017430 - Borrelia burgdorferi 29-kDa protein antigen OMOP:4017497 - Albumin measurement, serum OMOP:4017670 - Closed fracture subluxation of knee joint OMOP:4017712 - Salmonella IV 43:z4,z32:- OMOP:4017836 - Salmonella II 56:z:z6 OMOP:4017861 - Aeromonas ichthiosmia OMOP:4017940 - Closed traumatic subluxation toe, interphalangeal joint, single OMOP:4017984 - Cristispira OMOP:4018042 - Brush border antibody measurement OMOP:4018060 - Alanine aminopeptidase measurement OMOP:4018108 - Salmonella Hegau OMOP:4018122 - Salmonella II 41:z10:e,n,x,z OMOP:4018128 - Salmonella II 1,42:l,w:e,n,x OMOP:4018187 - Cholic acid measurement OMOP:4018262 - Salmonella II 53:l,z28:e,n,x OMOP:4018345 - Closed fracture dislocation multiple digits OMOP:4018385 - Listonella pelagia OMOP:4018621 - Complete tear dorsal radiocarpal ligament OMOP:4018651 - Salmonella II 47:b:1,5 OMOP:4018657 - Salmonella II 48:d:z6 OMOP:4018819 - Antigen in Knops blood group system OMOP:4018829 - i-adult phenotype OMOP:4018852 - Acute genitourinary disorder OMOP:4018965 - Sprain thumb, interphalangeal joint, ulnar collateral ligament OMOP:4019159 - Open division, finger, distal interphalangeal joint, radial collateral ligament OMOP:4019180 - Primate T-lymphotropic virus 2 protein 36 antigen OMOP:4019288 - HMB-45 protein antigen cell marker OMOP:4019482 - Order Thermoproteales OMOP:4019680 - Labetalol measurement OMOP:4019692 - Lupus vulgaris OMOP:4019768 - Antigen in Scianna blood group system OMOP:4019847 - Death of companion OMOP:4019889 - Amycolatopsis OMOP:4019976 - Lack of heat in house OMOP:4020301 - Superficial frostbite involving multiple body regions OMOP:4020303 - Frostbite with tissue necrosis of knee and lower leg OMOP:4020615 - Clostridium perfringens enterotoxin OMOP:4020700 - Triosephosphate measurement OMOP:4020764 - i-1 phenotype OMOP:4020783 - Blood group antigen HAG OMOP:4021129 - Peptidyl dipeptidase A measurement OMOP:4021165 - Skin care OMOP:4021189 - Does not recognize self in mirror OMOP:4021208 - Blood group antigen R.S. OMOP:4021324 - Non-participant observation OMOP:4021348 - Wears brightly colored clothes OMOP:4021447 - Cephalexin measurement OMOP:4021460 - Spiritual strength OMOP:4021472 - Disease caused by Nosematidae OMOP:4021492 - Stiff legs OMOP:4021657 - Wears nightwear during the day OMOP:4021706 - Kx blood group system OMOP:40217094 - The start of an episode of care documented in the medical record OMOP:4021712 - Pycnoscelus surinamensis OMOP:40217261 - Depression, anxiety, apathy, and psychosis not assessed OMOP:4021859 - Colton blood group phenotype OMOP:4021860 - Co(a-b-) phenotype OMOP:4021905 - Second cranial nerve finding OMOP:40219448 - PANSS: General Psychopathology scale - Tension OMOP:4021954 - Touching the deceased OMOP:40219561 - Edwards personal preference schedule autonomy subscale OMOP:40219588 - Ewha Defense Mechanism Test: Displacement OMOP:4022071 - Convalescence OMOP:4022133 - Finding relating to grief and dying OMOP:4022228 - Disease caused by Annelida OMOP:4022271 - Tamarind OMOP:4022395 - Low copper diet OMOP:4022398 - Elemental diet OMOP:4022407 - Non-therapeutic diets OMOP:4022440 - Torus mandibularis OMOP:4022518 - Xylene measurement OMOP:4022533 - Water soluble vitamin requirement OMOP:4022603 - Sydowia polyspora OMOP:4022653 - Early retirement OMOP:4022680 - Injecting drug user OMOP:4022702 - Low fructose diet OMOP:4022832 - Salmonella group O:58 OMOP:4022850 - Omega 6 fatty acid requirement OMOP:4022871 - Docosahexaenoic acid OMOP:4023049 - Cross-generation sex partner OMOP:4023078 - Thermomonospora mesouviformis OMOP:4023094 - Scotochromogenic mycobacteria OMOP:4023321 - Disease caused by Chilomastigidae OMOP:4023359 - Displays ethical principles OMOP:4023366 - Parting from the deceased's body OMOP:4023374 - Animal fat intake OMOP:4023387 - Salmonella Omuna OMOP:4023419 - Mixed venous blood OMOP:4023482 - Correspondence AND/OR reporting clerk OMOP:4023539 - Shortbread biscuit OMOP:4023573 - Acute abdominal pain OMOP:4023574 - Bank teller OMOP:4023602 - Abnormal vascular flow OMOP:4023790 - Retarded OMOP:4023810 - Crane AND/OR hoist operator OMOP:4023877 - Rusk OMOP:4023901 - Fresh cream-filled sponge cake OMOP:4023909 - Extractable nuclear antibody OMOP:4023913 - Pathologist report OMOP:4023944 - Contact urticaria OMOP:4023985 - Skeletal dysplasia OMOP:4023999 - Secretory AND/OR excretory function OMOP:4024040 - Buttermilk powder OMOP:4024123 - Choking due to airways obstruction OMOP:4024182 - Stewed extra-lean minced beef OMOP:4024193 - Minced chicken OMOP:4024303 - Insect iridescent virus 26 OMOP:4024320 - Miner, quarryman, well driller AND/OR related worker OMOP:4024370 - Low polyunsaturated fat diet OMOP:4024374 - Modified alcohol diet OMOP:4024384 - High magnesium diet OMOP:4024712 - Finding of sense of smell OMOP:4024796 - Human immunodeficiency virus, type II protein 68 antibody OMOP:4024817 - Parotid sialectasia OMOP:4024876 - Poultry farm worker OMOP:4024892 - Lamb OMOP:4024922 - Ling OMOP:4024935 - Grilled smoked mackerel OMOP:4025079 - Salsify OMOP:4025120 - Blister with infection OMOP:4025132 - Helicobacter pylori antibody OMOP:4025203 - Self perception, self concept pattern OMOP:4025209 - Teflon poisoning OMOP:4025308 - Helicobacter species antibody OMOP:4025363 - Gamboa virus OMOP:4025380 - Life scientist AND/OR related technician OMOP:4025418 - Turmeric OMOP:4025574 - Ghee intake OMOP:4025587 - Black tea OMOP:4025595 - Dry white wine OMOP:4025605 - Grilled papadum OMOP:4025612 - Penicillium roqueforti antibody OMOP:4025613 - Human poliovirus 1 antibody OMOP:4025633 - Aureobasidium pullulans antibody OMOP:4025676 - Tilapia mariae OMOP:4025702 - Squirrels, marmots and chipmunks OMOP:4025773 - White spaghetti OMOP:4025811 - Keratin protein antigen OMOP:4025957 - Degenerative polyarthritis OMOP:4025960 - Does not recognize photographs of self OMOP:4025986 - Clostridium tetani antibody OMOP:4026073 - Curds OMOP:4026121 - Cysticercus antibody OMOP:4026125 - Chronic active hepatitis OMOP:4026126 - Recurrent hepatitis OMOP:4026144 - Bile duct calculus with acute cholecystitis OMOP:4026161 - Vulnerability to exploitation OMOP:4026177 - Preference to be present at time of death OMOP:4026183 - Canned mushy peas OMOP:4026281 - Order Cyclophyllidea OMOP:4026292 - Greengage OMOP:4026300 - Dried pear OMOP:4026316 - Horseradish sauce OMOP:4026318 - Tomato chutney OMOP:4026328 - Savory snacks OMOP:4026333 - Cheese and egg quiche OMOP:4026349 - Chlamydophila pneumoniae antigen OMOP:4026378 - Teichoic acid antibody OMOP:4026390 - Family Reduviidae - assassin bug OMOP:4026450 - Spaghetti canned in bolognese sauce OMOP:4026452 - Aubergine and potato bhaji OMOP:4026462 - Vegetable casserole made with beans and root vegetables OMOP:4026565 - Sweet and sour pork OMOP:4026566 - Bakewell tart OMOP:4026567 - Blancmange OMOP:4026573 - Rubber AND/OR plastics product maker OMOP:4026574 - Poisoning by ketamine OMOP:4026576 - Compositor AND/OR typesetter OMOP:4026590 - Basidiomycotina OMOP:4026619 - Instant desert powder made with semi-skimmed milk OMOP:4026702 - Family Pulicidae OMOP:4026703 - Family Morphoidae OMOP:4026709 - Nut croquette fried in vegetable oil OMOP:4026830 - Fried haddock OMOP:4026842 - Rohu OMOP:4026863 - Tobacco preparer OMOP:4026875 - Rubber and/or plastics product maker, except tire maker and/or tire vulcanizer OMOP:4026952 - Family Scyphidiidae OMOP:4026966 - Family Diplostomatidae OMOP:4026999 - Rum OMOP:4027042 - Family Halarachnidae OMOP:4027079 - Cow's milk protein-free diet OMOP:4027090 - Non-essential amino acid requirement OMOP:4027093 - Monounsaturated fatty acid requirement OMOP:4027117 - Acute diffuse nephritis OMOP:4027145 - Family Moringuidae - spaghetti eel OMOP:4027164 - Family Gasterosteidae - stickleback OMOP:4027198 - Nut and rice roast OMOP:4027377 - Cell mediated lympholysis assay OMOP:4027439 - Opisthocomidae OMOP:4027505 - Trifolium repens OMOP:4027553 - Disorder of lower respiratory system OMOP:4027558 - Chronic disease of lymphatic vessels OMOP:4027566 - Disorder of visual cortex OMOP:4027582 - Coraciidae - rollers OMOP:4027601 - Cinclidae OMOP:4027770 - Family Synodontidae - lizardfish OMOP:4027775 - Order Percopsiformes OMOP:4027960 - Lychee OMOP:4028072 - Disorder of cerebral cortex OMOP:4028075 - B lymphocyte disorder OMOP:4028086 - Congenital sensory neuropathy with selective loss of small myelinated fibers OMOP:4028131 - Muscicapidae OMOP:4028134 - Nectariniidae OMOP:4028204 - Conjugated visual deviation OMOP:4028242 - Chronic duodenal ulcer OMOP:4028375 - Aortic fistula OMOP:4028391 - Family Cobitidae - loach OMOP:4028443 - Chocolate cake with butter icing OMOP:4028483 - Bayonet sign OMOP:4028571 - Facial myokymia OMOP:4028573 - Cervidae OMOP:4028618 - Artamidae OMOP:4028636 - Cystocele in pregnancy, childbirth and the puerperium OMOP:4028661 - Calculus of common duct with obstruction OMOP:4028670 - Salmonella Freetown OMOP:4028751 - Myxiniformes OMOP:4028765 - Isolated thyroliberin deficiency OMOP:4028776 - Plumbeous warbler OMOP:4028806 - Primary hyperaldosteronism due to adrenal adenoma OMOP:4028889 - Family Aphredoderidae - pirate perch OMOP:4028892 - Family Chaunacidae - gaper OMOP:4028905 - Sectator ocyurus OMOP:4028961 - Acidipropionibacterium acidipropionici OMOP:4029002 - Eimeria nocens OMOP:4029107 - Depletion of mitochondrial DNA OMOP:4029163 - Plasmodium inopinatum OMOP:4029190 - Fibroblastic liposarcoma OMOP:4029278 - Protein overload OMOP:4029296 - Acacia erioloba OMOP:4029299 - Salmonella Regent OMOP:4029335 - Alpha amino isobutyric acid OMOP:4029345 - Cardiac catheterization bailout phase OMOP:4029374 - Family Scombridae - mackerel OMOP:4029409 - Family Convolvulaceae - morning glory OMOP:4029486 - Nonvenomous insect bite of buttock without infection OMOP:4029497 - Cerebral arterial aneurysm OMOP:4029512 - Clear cell cystadenoma OMOP:4029531 - Gastrointestinal stromal sarcoma OMOP:4029573 - Congenital adrenal hyperplasia OMOP:4029576 - Addison's disease with adrenoleucodystrophy OMOP:4029580 - Enlarged adrenal gland OMOP:4029623 - Wattled false sunbird OMOP:4029803 - Bacterial infection of skin OMOP:4029812 - Bacterial infection of eye OMOP:4029850 - Family Pomacentridae - damselfish OMOP:4029931 - Batai virus OMOP:4029946 - Abnormal thickness OMOP:4029949 - Fecampia erythrocephala OMOP:4030054 - Thyroid hormone resistance syndrome OMOP:4030081 - Poisoning by Lophyrotoma interrupta OMOP:4030184 - Pseudohypoparathyroidism and pseudopseudohypoparathyroidism OMOP:4030197 - Psychosocial growth hormone deficiency OMOP:4030208 - Artefactual pseudo-Cushing's syndrome OMOP:4030271 - Serous cystadenoma, borderline malignancy OMOP:4030296 - Procedure phase OMOP:4030348 - Pseudo-puberty - virilization OMOP:4030419 - Carbon (11-C) methionine OMOP:4030439 - Metabolic presbycusis OMOP:4030507 - Fungal infection of kidney OMOP:4030526 - Hyporeninemic hypoaldosteronism OMOP:4030557 - Mercury isotope OMOP:4030585 - Cystic duct stump syndrome OMOP:4030591 - Tympanic plexus neuralgia syndrome OMOP:4030639 - Patient disposition OMOP:4030711 - Rose-breasted rose finch OMOP:4030758 - Communication with community resources OMOP:4030844 - Eczema vaccinatum OMOP:4030850 - Sycosis cruris OMOP:4030851 - Lupoid sycosis of beard OMOP:4030897 - Mammographic mass of breast OMOP:4030989 - Insect bite granuloma OMOP:4031155 - Lichen planus of penis OMOP:4031156 - Maculopapular sarcoidosis OMOP:4031195 - HLA-Cw3 antigen OMOP:4031243 - 5 o'clock position on mammogram OMOP:4031360 - Acute erythroid leukemia OMOP:4031371 - At risk for imbalanced nutrition, less than body requirements OMOP:4031662 - Anemia due to disturbance of hemoglobin synthesis OMOP:4031754 - Contact mucous membrane inflammation OMOP:4031756 - Melanoma in situ of skin (clinical) OMOP:4031762 - Melanocytic nevus of perianal skin OMOP:4031797 - Lactate dehydrogenase deficiency OMOP:4031820 - Acute endomyometritis OMOP:4031841 - Racemose aneurysm OMOP:4031844 - Human rhinovirus 88 OMOP:4031861 - Round shaped calcification OMOP:4032086 - Contact dermatitis caused by urushiol from poison sumac OMOP:4032172 - Boiler and pipe insulator OMOP:4032176 - Eremichthys acros OMOP:4032215 - Oxygen (15-O) carbon dioxide OMOP:40323559 - Dislocation of knee joint OMOP:4032369 - Change since last mammogram OMOP:4032456 - Testicular prosthesis displacement OMOP:4032458 - Transfusion reaction caused by anti B OMOP:4032460 - Mycoplasma balanitis OMOP:4032518 - Height abnormal for age OMOP:4032590 - Gonococcal epididymo-orchitis OMOP:4032708 - Congenital transverse mandibular hypoplasia OMOP:4032711 - Precocious exfoliation of teeth due to idiopathic root resorption OMOP:4032714 - Failure of tooth eruption OMOP:4032715 - Cleft of primary palate OMOP:4032732 - Gingival cleft OMOP:4032806 - Neoplasm, metastatic OMOP:4032842 - Hyperplasia of retromolar gingiva OMOP:4032847 - Secondary occlusal trauma OMOP:4032884 - Palmar varices OMOP:4032888 - Venous stasis syndrome OMOP:4032894 - Infantile acute hemorrhagic edema OMOP:4032908 - Giant cell fibroblastoma of skin OMOP:4033045 - Repetitive self-excoriation OMOP:4033054 - Acral erythema OMOP:4033055 - Drug-induced ichthyosiform reaction OMOP:4033078 - Heterakis dispar OMOP:4033153 - Minimally attached gingiva OMOP:4033154 - Narrow gingival width OMOP:4033182 - Plate-glass polisher OMOP:4033186 - Ectodermal dysplasia, syndactyly and pili torti OMOP:4033192 - Hereditary clubbing OMOP:4033194 - Keratolysis exfoliativa OMOP:4033301 - Melanocytic nevus of shoulder OMOP:4033303 - Melanoma in situ of hip OMOP:4033339 - Trichomalacia OMOP:4033404 - Anomalous origin of right subclavian artery OMOP:4033472 - Tooth in linguoversion OMOP:4033491 - Omphalith OMOP:4033497 - Sclerodermatomyositis OMOP:4033520 - Normal voice flexibility OMOP:4033643 - Ectodermal dysplasia with sweating defect OMOP:4033644 - Erythrokeratoderma progressiva of Gottron OMOP:4033667 - Cutaneous microwave burn OMOP:4033770 - Constitutional fingertip eczema OMOP:4033803 - Acute skin sarcoidosis OMOP:4033979 - Dentin bridge OMOP:4033983 - Inadequately attached gingiva OMOP:4034159 - Fresh stillbirth OMOP:4034219 - Mycoplasma penetrans OMOP:4034222 - Neisseria weaveri OMOP:4034228 - Retention cyst of gland of Montgomery OMOP:4034342 - Acidovorax temperans OMOP:4034538 - Assault and battery OMOP:4034561 - Odontotrichomelic syndrome OMOP:4034565 - Ectodermal dysplasia with tooth-nail defects OMOP:4034605 - Mycoplasma gypis OMOP:4034681 - Vitreous floaters OMOP:4034682 - Posthodiplostomum OMOP:4034702 - Trichiurus nitens OMOP:4034714 - Regional ventilation differences due to unequal bronchial pathway lengths OMOP:4034792 - Pseudomonas flavescens OMOP:4034794 - Pseudomonas savastanoi OMOP:4034852 - Torpedo californica OMOP:4034860 - Halogeton glomeratus OMOP:4034861 - Thallium-197 OMOP:4034932 - Hydrogenophaga flava OMOP:4034960 - Secondary endocrine diabetes mellitus OMOP:4034985 - Trypanosoma evansi OMOP:4034987 - Hypothalamic mass OMOP:4034992 - Osmoregulation defect - absent thirst OMOP:4035075 - Pseudoramibacter alactolyticus OMOP:4035120 - Late onset congenital adrenal hyperplasia OMOP:4035136 - Carcinoid crisis OMOP:4035150 - Vitamin D-dependent rickets type II without alopecia OMOP:4035161 - Blood group antigen Ch1 OMOP:4035171 - HIV-1 dot blot immunobinding assay OMOP:4035179 - Zoonotic form of cutaneous leishmaniasis OMOP:4035327 - Stricture of pulmonary vessel OMOP:4035420 - Deficiency of lateral collateral ligament of the knee OMOP:4035470 - Blautia obeum OMOP:4035606 - Deficiency of posterior cruciate ligament OMOP:4035607 - Rupture of lateral collateral ligament of knee OMOP:4035633 - Obturation obstruction of intestine OMOP:4035657 - Calculus of pancreas OMOP:4035736 - Chromosome mosaicism OMOP:4035808 - Congenital stricture of bile duct OMOP:4035821 - Abnormal epinephrine OMOP:4035868 - Pooled blood product identifier OMOP:4035884 - Blood product unit status OMOP:4035925 - Dried egg OMOP:4035926 - Fried egg OMOP:4036029 - Thrombin induced platelet aggregation OMOP:4036127 - Increased size OMOP:4036177 - Abnormal thyroid hormone OMOP:4036271 - Store guide OMOP:4036292 - Foreman: electrical production OMOP:4036297 - Steel rigger OMOP:4036448 - Foreman electrical mechanic OMOP:4036601 - Telephone fitter OMOP:4036606 - Etcher (printing) OMOP:4036678 - Measurement of Human immunodeficiency virus 1 protein 65 antibody OMOP:4036711 - Prealbumin amyloid antigen OMOP:4036772 - Symptom very severe OMOP:4036879 - Curried omelette OMOP:4036896 - Treacle tart OMOP:4036916 - Bean and lentil chili OMOP:4037115 - Exercise aggravates symptom OMOP:4037221 - Antibody to intercalated disc OMOP:4037254 - Pork burger OMOP:4037264 - Bele OMOP:4037284 - Jackfish OMOP:4037303 - Harmful thoughts OMOP:4037339 - Blood group O-HmB OMOP:4037474 - Tinned potato OMOP:4037500 - Superovulation OMOP:4037890 - No speech problem OMOP:4037899 - Salmonella serotype C2,6,8:eh:- OMOP:4037943 - Heart murmur quality, twanging OMOP:4038026 - Shooting headache OMOP:4038045 - Necrobiosis lipoidica, necrobiotic type OMOP:4038231 - Cooks for himself or herself OMOP:4038528 - Application for benefit status OMOP:4038563 - Drinks with work colleagues OMOP:4038601 - Falco rusticolus OMOP:40386117 - Bilateral acquired blindness of eyes OMOP:4038713 - Undue priority given to drug-related activities OMOP:4038803 - Abnormal vanillylmandelic acid OMOP:40391300 - Glomangiomyoma OMOP:4039212 - Separation anxiety disorder of childhood OMOP:4039223 - Bread pudding OMOP:4039251 - Mustard leaves and spinach bhaji OMOP:4039573 - Passive movements to the trunk OMOP:4039691 - Necrotizing vasculitis OMOP:4039707 - Measurement of Human T-lymphotropic virus 1 protein 26 antibody and Human T-lymphotropic virus 2 protein 26 antibody OMOP:4039737 - Dysarthria of velopharynx OMOP:4039953 - Macropus fuliginosus OMOP:4040129 - Disability evaluation disability 65 percent OMOP:4040197 - Vibrio mimicus OMOP:4040301 - Blastomyces parvus OMOP:4040475 - Cutaneous larva migrans by Ancylostoma braziliense OMOP:4040982 - Coffee-workers' lung OMOP:4041004 - Kidney stone analysis OMOP:4041123 - Vegetable tagliatelle OMOP:4041346 - Posterior open dislocation OMOP:4041479 - White plain flour OMOP:4041481 - Food composition types OMOP:4041493 - Lunge sideways trunk position OMOP:4041687 - Oral-verbal dyspraxia OMOP:4041826 - Developmental dysphasia OMOP:4041869 - Urine dipstick test OMOP:4042033 - Beverage whiteners OMOP:4042034 - Savory food OMOP:4042077 - Rhinoclemmys OMOP:4042192 - Staphylococcus epidermidis meningitis OMOP:4042256 - Foreign body present on urine microscopy OMOP:4042400 - Chronic eosinophilic inflammation OMOP:4042406 - Anotopterus pharao OMOP:4042705 - Weight-bearing gait training OMOP:4042714 - Voice associated with deafness OMOP:4043037 - Psychological tolerance to drug OMOP:4043038 - No craving for drugs OMOP:4043042 - Sexually active OMOP:4043168 - HLA-DRw10 antigen OMOP:4043345 - Disorder of ocular adnexa OMOP:4043384 - Chorea due to thyrotoxicosis OMOP:4043513 - Housework assisted OMOP:4043516 - Telephone dependent OMOP:4043556 - Toothbrushing epilepsy OMOP:4043562 - Excessive day and night-time sleepiness OMOP:4043699 - Osteocartilagenous loose body OMOP:4043738 - Hydrocephalus OMOP:4043847 - HLA-Cw7 antigen OMOP:4043884 - Monoplegic cerebral palsy affecting lower limb OMOP:4043896 - Blister of perineum with infection OMOP:4043907 - Periodic ataxia OMOP:4043910 - Progressive cerebellar ataxia with palatal myoclonus OMOP:4043918 - Cluster A personality disorder OMOP:4044017 - Traumatic dislocation of joint of thoracic vertebra OMOP:4044021 - Piriformis syndrome OMOP:4044060 - Diurnal dystonia OMOP:4044222 - Hemiplegia-hemiconvulsion-epilepsy syndrome OMOP:4044232 - Migraine aura without headache OMOP:40443516 - Xanthelasma OMOP:4044394 - Myxedema neuropathy OMOP:4044408 - Supracondylar process entrapment OMOP:4044412 - Traumatic neuroma OMOP:4044425 - Human echovirus 6 antibody OMOP:4044611 - Legionella pneumophila serogroup 3 antibody OMOP:4044722 - Dependent for bathing OMOP:4044727 - Money managing dependent OMOP:4044743 - White flour OMOP:4044754 - General food and drink types OMOP:4044804 - Measurement of Borrelia burgdorferi 41 kD antibody OMOP:4044917 - Hot drink intake OMOP:4044930 - Meningitis in Lyme disease OMOP:4045087 - Auscultation - action OMOP:4045327 - Measurement of Yersinia pseudotuberculosis antibody OMOP:4045424 - Pleuropericardial chest pain OMOP:4045732 - Myopathy in myasthenia gravis OMOP:4045749 - Cerebral amyloid angiopathy OMOP:4045752 - Isolated angiitis of central nervous system OMOP:4045756 - Venous infarction of spinal cord OMOP:4045838 - Intermittently raised pressure hydrocephalus OMOP:4046019 - Open reverse Colles' fracture OMOP:4046133 - Chlamydia pneumoniae RNA assay OMOP:4046219 - Acquired epileptic aphasia OMOP:4046336 - Neuropathy in benign monoclonal gammopathy OMOP:4046348 - Cold injury of peripheral nerve OMOP:4046552 - Obstetrical laceration care OMOP:4046696 - Passive movements to the ankle joint OMOP:4046805 - Normal non-fluency OMOP:4046808 - Borderline stuttering OMOP:4046884 - Deep vein thrombosis of leg related to air travel OMOP:4046903 - Hydrocephalus following traumatic injury OMOP:4046908 - Congenital pseudobulbar palsy OMOP:4047035 - Exophiala OMOP:4047095 - Varicella-zoster antibody level OMOP:4047116 - Articulatory dyspraxia OMOP:4047152 - Candida culture OMOP:4047260 - Impaired glucose tolerance associated with genetic syndrome OMOP:4047271 - Blended spread 70 to 80 percent fat OMOP:4047293 - Chick pea flour OMOP:4047471 - Post measles meningitis OMOP:4047509 - Toxic cytopenia OMOP:4047536 - Reads Urdu OMOP:4047628 - Acute viral transverse myelitis OMOP:4047745 - Traumatic encephalopathy OMOP:4047756 - Isolated cervical dystonia OMOP:4047781 - Cellulitis of skin OMOP:4047787 - Colles' fracture OMOP:4047838 - Bite to own tongue OMOP:40478891 - Erythropoietin resistance in anemia of chronic kidney disease OMOP:40478938 - Infection by Bacteroides fragilis OMOP:40478940 - Ganglioside GM1b antibody OMOP:40478951 - Bilateral deep vein thrombosis of lower extremities OMOP:40478972 - Viridibacillus arenosi OMOP:4047931 - Deficiency of benzaldehyde dehydrogenase (NADP+) OMOP:40479431 - Grade 1 on a scale of 0 to 3 OMOP:40479565 - Carrier of cystic fibrosis gene mutation OMOP:40479606 - Septic pulmonary embolism OMOP:40479671 - Streptococcus pyogenes type emm117 OMOP:40479718 - Streptococcus pyogenes type emm7 OMOP:40479766 - Injury of lateral collateral ligament of knee OMOP:40479778 - Rate of blood flow through cardiovascular device OMOP:40479974 - Myoclonus associated with fever OMOP:40480158 - Suprasternal sagittal view OMOP:40480178 - Obstruction of percutaneous endoscopic gastrostomy tube OMOP:40480254 - Reticuloendotheliosis virus antibody OMOP:40480274 - Nonsustained ventricular tachycardia OMOP:40480291 - Hyperemesis OMOP:40480452 - Excess subcutaneous fat of lower limb OMOP:40480461 - Infarction of lung due to iatrogenic pulmonary embolism OMOP:40480539 - Turkey adenovirus B OMOP:4048062 - Normal extension OMOP:40480657 - Bilateral enlargement of atria OMOP:40480683 - Meets eligibility criteria for breast conservation surgery OMOP:40480684 - Intraspecies Canis lupus hybrid OMOP:40481031 - Medulloblastoma OMOP:40481113 - Deficiency of 2-methylbutyryl-CoA dehydrogenase OMOP:40481118 - Testudo hermanni OMOP:40481137 - Meningomyelocele of lumbosacral spine OMOP:40481159 - Phalangerinae OMOP:40481302 - Injury of superior glenoid labrum of shoulder joint OMOP:40481354 - Speech and language deficit as late effect of cerebrovascular accident OMOP:40481371 - Mass of tongue OMOP:40481373 - No cardiac pacemaker in situ OMOP:40481442 - Measurement of Barmah Forest virus antibody OMOP:40481504 - Age of caregiver OMOP:4048171 - Perennial allergic rhinitis with seasonal variation OMOP:40481763 - Acute exacerbation of chronic asthmatic bronchitis OMOP:40481801 - Stress incontinence after prostatectomy OMOP:40481833 - Abnormal structure of globulin OMOP:40481902 - Malignant neoplasm of anorectum OMOP:4048219 - South American caecilian OMOP:40482215 - Referral to infectious disease clinic OMOP:40482223 - Measurement of occult blood in gastric fluid specimen OMOP:40482238 - Calculation of ionized calcium concentration OMOP:40482410 - Edema of entire limb OMOP:40482440 - Instability of foot joint OMOP:40482465 - Congenital dilation of ascending aorta OMOP:40482507 - Incipient senile cataract OMOP:40482698 - Rash of genitalia OMOP:4048273 - Clostridial intra-amniotic fetal infection OMOP:40482752 - Equus caballus przewalskii OMOP:4048282 - Perinatal melena OMOP:40482942 - Clinical chronic obstructive pulmonary disease questionnaire OMOP:40483136 - Hepatitis B and hepatitis C OMOP:40483273 - EuroQoL five dimension questionnaire OMOP:40483347 - Skin folds visible on edematous limb OMOP:4048347 - Papaveraceae poisoning OMOP:4048353 - Linaceae poisoning OMOP:40483532 - Anasarca OMOP:40483538 - Atherosclerosis of bypass graft of limb OMOP:40483548 - Fracture of head of radius with dislocation of distal radioulnar joint and interosseous membrane disruption OMOP:40483619 - Progressive encephalopathy with edema, hypsarrhythmia and optic atrophy syndrome OMOP:40483628 - Inflammation of rotator cuff tendon OMOP:40483752 - Right ventricular aneurysm OMOP:40484120 - Small vessel cerebrovascular disease OMOP:40484146 - Skin loss exposing bone OMOP:40484147 - Skin loss exposing muscle OMOP:40484195 - Pathological fracture of distal radius OMOP:40484306 - Chooses not to use contraception OMOP:40484491 - Swelling of left tonsil OMOP:40484534 - Swollen 28 joint count OMOP:40484543 - Highest recorded European pressure ulcer advisory panel classification OMOP:40484556 - Finding of difference in number of calcifications compared to previous radiologic examination OMOP:40484621 - Streptococcus pneumoniae serogroup 9 antibody OMOP:40484631 - Virilization of female due to SRY gene translocation OMOP:40484961 - Agavaceae OMOP:40484983 - Streptococcus pyogenes type emm40 OMOP:4048502 - Granulomatosis with polyangiitis of larynx OMOP:40485057 - Carries emergency treatment OMOP:40485374 - Streptococcus pyogenes type emm81 OMOP:40485417 - Streptococcus pyogenes type emm21 OMOP:40485458 - Genus Haematopus OMOP:40485518 - Anaplasma marginale antibody OMOP:40485982 - Hernia hydrocele complex OMOP:40486037 - Interatrial communication through coronary sinus orifice OMOP:40486057 - Discontinuity between mitral valve and pulmonary valve OMOP:40486063 - Prolapse of Eustachian valve through atrial septum OMOP:40486080 - Double aortic arch with left arch dominant and coarctation of right arch OMOP:40486084 - Leiomyosarcoma of cardia of stomach OMOP:40486085 - Malignant germ cell neoplasm of anterior mediastinum OMOP:40486118 - Paget's disease of skin of scrotum OMOP:40486136 - Muscular ventricular septal defect in trabecular septum OMOP:40486217 - Montifringilla OMOP:40486428 - Traumatic dislocation of interphalangeal joint of finger OMOP:40486453 - Granuloma of buttock OMOP:40486481 - Laceration of tendon of foot OMOP:40486484 - Emberiza OMOP:40486489 - Pomatostomidae OMOP:40486500 - Infection caused by multidrug resistant Acinetobacter OMOP:40486565 - Sarcoma of axillary tail of female breast OMOP:40486633 - Right ventricle posterior to left ventricle OMOP:40486637 - Non-Hodgkin's lymphoma of tonsil OMOP:40486654 - Follicular non-Hodgkin's lymphoma of ovary OMOP:40486663 - Congenital abnormality of right atrioventricular valve chordae tendinae in double inlet ventricle OMOP:40486698 - Knows partner's method of contraception OMOP:4048672 - Fracture, ununited, pathologic OMOP:4048673 - Diffuse proliferative inflammation OMOP:40486902 - Psarocolius OMOP:40486904 - Subluxation of sternum OMOP:40486938 - Diastolic blood pressure on admission OMOP:40486949 - Candida freyschussii OMOP:40486974 - Streptomyces tritolerans OMOP:40486982 - Copsychus OMOP:40486990 - Red food coloring OMOP:40487013 - Ventricular septal defect of inlet of right aspect of ventricular septum OMOP:40487021 - Partial anomalous pulmonary venous connection of part of right lung OMOP:4048712 - Haemoproteus sacharovi OMOP:40487135 - Chryseobacterium gambrini OMOP:4048718 - Buruli ulcer OMOP:40487193 - Spiza americana OMOP:40487345 - Necrotizing lymphadenitis OMOP:40487495 - Measurement of thiopurine methyltransferase in whole blood specimen OMOP:40487507 - Double aortic arch with left arch dominant and atresia of right arch OMOP:40487572 - Supravalvar pulmonary trunk stenosis OMOP:40487573 - Congenital left ventricular submitral valve aneurysm OMOP:40487585 - Ithaginis cruentus OMOP:40487627 - Intracardiac location of anomalous pulmonary venous connection to midline with isomeric atria OMOP:40487960 - Medication dosage interval too long OMOP:40487978 - Single inlet ventricle with absent atrioventricular connection OMOP:40487981 - Uniatrial biventricular connection with absent right sided atrioventricular connection with straddling valve OMOP:40487982 - Iontophoresis technique OMOP:40487996 - Medication dose too high OMOP:40488056 - Rufous-crowned sparrow OMOP:4048807 - Hypothermic coma OMOP:40488076 - Subaortic outflow tract obstruction in solitary indeterminate ventricle OMOP:40488396 - Atrioventricular septal defect with atrial and ventricular components and separate atrioventricular valves OMOP:40488415 - Benign teratoma of pineal region OMOP:40488429 - Functioning pituitary neoplasm OMOP:40488471 - Deformity of thoracic structure OMOP:4048864 - Salmonella Dahlem OMOP:40488825 - Systemic vein obstruction OMOP:40488901 - Follicular non-Hodgkin's lymphoma of prostate OMOP:40488956 - Fibroma of upper limb OMOP:40488973 - Genus Cyanoloxia OMOP:40488988 - Dermatofibrosarcoma protuberans of skin of chest OMOP:40488997 - Vascular ring with left aortic arch to right descending aorta and right arterial ligament OMOP:40489451 - Midline anterior apex of heart OMOP:40489844 - Foreign body in maxillary sinus OMOP:40489909 - Sepsis caused by Streptococcus agalactiae OMOP:40489922 - Phaenicophaeinae OMOP:40489950 - Emberizoides OMOP:40489967 - Congenital abnormality of ascending aorta OMOP:40489983 - Anomalous pulmonary to systemic collateral vein OMOP:4049000 - 21q partial monosomy syndrome OMOP:40490319 - Nonvenomous snake bite wound of lower extremity OMOP:40490348 - Measurement of Influenza A virus A/Port Chalmers/1/73 (H3N2) antibody OMOP:40490383 - Class Arachnida egg OMOP:40490851 - Bacillus butanolivorans OMOP:40490888 - Herniation of rectum into vagina OMOP:40490926 - Deep third degree burn of genitalia OMOP:40490958 - Cecum in right sided position OMOP:40490986 - Tenderness of right lower quadrant of abdomen OMOP:40491009 - Thickened atrial septum OMOP:40491017 - Allergy to phosphodiesterase 5 inhibitor OMOP:40491325 - Technetium (99m-Tc) labeled carbon OMOP:40491414 - Angiomyomyelolipoma OMOP:40491466 - Benign neoplasm of soft tissue of lower leg OMOP:40491484 - Sanguineous exudate from wound OMOP:40491866 - Traumatic injury of celiac artery OMOP:40492009 - Artificial airway patent OMOP:4049208 - Psenes cyanophrys OMOP:4049214 - Pseudomonas anguilliseptica OMOP:4049219 - Romano-Ward syndrome OMOP:40492266 - Gastrointestinal stromal tumor of stomach OMOP:4049237 - Palatopharyngeal incoordination OMOP:40492385 - Leiomyosarcoma of uterus OMOP:40492415 - Median raphe cyst of penis OMOP:40492509 - Carcinoma of urethra OMOP:40492523 - Osteochondritis dissecans of tarsal bone OMOP:40492697 - Traumatic injury of spinal cord at T7-T12 level OMOP:40492698 - Infection caused by carbapenem resistant Acinetobacter OMOP:40492828 - Aquila OMOP:40492845 - Community hospital acquired pressure injury OMOP:40492960 - Fenestration of atrioventricular valve leaflet in atrioventricular septal defect OMOP:40492977 - Distal origin of brachiocephalic artery with tracheal compression OMOP:40493019 - Diffuse non-Hodgkin's lymphoma of nose OMOP:40493255 - Viral syndrome OMOP:40493301 - Oecophyllini OMOP:40493303 - Lutetium-177 OMOP:40493327 - Complete spinal cord injury at T1-T6 level OMOP:40493350 - Myelodysplastic/myeloproliferative neoplasm, unclassifiable OMOP:40493352 - Deep third degree burn of face OMOP:40493432 - Sarcoma of bone of pelvis OMOP:40493435 - Sarcoma of sternum OMOP:40493491 - Struthio OMOP:40493516 - Hemangioma of nose OMOP:4049356 - Infestation by Cochliomyia OMOP:4049401 - Anti neutrophilic cytoplasm antibody OMOP:4049440 - Deficiency of NAD(P)H dehydrogenase (quinone) OMOP:4049442 - Deficiency of sulfite reductase OMOP:4049489 - Borrelia graingeri OMOP:4049491 - Xenopsylla cheopis OMOP:4049523 - Equisetum poisoning OMOP:4049557 - Deficiency of squalene monooxygenase OMOP:4049558 - Deficiency of progesterone 11alpha-monooxygenase OMOP:4049647 - California gull OMOP:4049701 - Deficiency of polyribonucleotide nucleotidyltransferase OMOP:4049727 - Deficiency of beta-fructofuranosidase OMOP:4049750 - Phlebitis of basilar sinus OMOP:4049810 - Inflammatory neuropathy OMOP:4049847 - Extracorporeal immunoadsorption OMOP:4049857 - Deficiency of inorganic pyrophosphatase OMOP:4049960 - Open wound of lip OMOP:4049964 - Acute bacterial bronchitis OMOP:4049965 - Fungal pneumonia OMOP:4050008 - Alpha-globulin above reference range OMOP:4050063 - Foreman - tannery production OMOP:4050183 - Corset maker OMOP:4050184 - Textile sewing machinist OMOP:4050202 - Barmen/barmaids OMOP:4050335 - Tannery production worker OMOP:4050358 - Foreman -textile material work OMOP:4050445 - Deficiency of AMP nucleosidase OMOP:4050453 - Deficiency of peptidoglycan endopeptidase OMOP:4050458 - Deficiency of IMP cyclohydrolase OMOP:4050469 - Delayed bone age OMOP:4050476 - Mannoheptulose above reference range OMOP:4050511 - Swimming pool attendant OMOP:4050616 - Deficiency of 3-hydroxybutyrate dehydrogenase OMOP:4050651 - Packer - heavy goods OMOP:4050752 - Deficiency of succinate dehydrogenase OMOP:4050763 - Deficiency of tryptophan 5-monooxygenase OMOP:4050766 - Deficiency of oxidase OMOP:4050810 - Clark melanoma level 5 OMOP:4050811 - FH: Migraine OMOP:4050876 - Obstructive bronchiectasis OMOP:4050883 - Asbestos-induced pleural fibrosis OMOP:4050903 - Deficiency of pyridoxal kinase OMOP:4050906 - Deficiency of guanidinoacetate kinase OMOP:4050914 - Deficiency of pentosyltransferase OMOP:4051099 - No current problems or disability OMOP:4051202 - Rosaceae poisoning OMOP:4051271 - School child OMOP:4051341 - Drug-induced pleurisy OMOP:4051454 - Cotyledon decusata OMOP:4051484 - Fractured nasal septum OMOP:4051485 - Suppurative sinusitis with complications OMOP:4051572 - FH: Epilepsy OMOP:4051608 - Splinter of knee, without major open wound OMOP:4051630 - Malingering OMOP:4051733 - Nanny OMOP:4051747 - Abrasion of skin of toe OMOP:4051844 - Medial dislocation OMOP:4051848 - Amputated structure, immediate OMOP:4051874 - Acute myocardial infarction of posterolateral wall OMOP:4051895 - Crush injury, shoulder and upper arm OMOP:4051969 - Solitary embryonic cyst OMOP:4052054 - Benign adenoma of prostate OMOP:4052170 - Pleads not guilty OMOP:4052209 - Injury of ulnar artery at wrist and hand level OMOP:4052324 - Member of large family OMOP:4052337 - Ophthalmoplegia OMOP:4052339 - Asthma society member OMOP:4052359 - Abrasion of skin of breast OMOP:4052364 - Infected abrasion of skin of buttock OMOP:4052375 - Splinter of flank without major open wound, infected OMOP:4052511 - Abrasion and/or friction burn of forearm, infected OMOP:4052562 - Psilocybe yungensis OMOP:4052568 - Abnormal curvature, compound curve OMOP:4052572 - Deficiency of formamidase OMOP:4052598 - Deficiency of ligase OMOP:4052750 - Disorder of immunoglobulin OMOP:4052759 - Guardian's allowance OMOP:4052945 - Stopped drinking alcohol OMOP:4053042 - Wound, closed OMOP:4053079 - Syphilitic cirrhosis OMOP:4053133 - Partial division, hamstring tendon OMOP:4053183 - Listeria OMOP:4053196 - Deficiency of nucleosidase OMOP:4053206 - Deficiency of methylglutaconyl-CoA hydratase OMOP:4053289 - Spongiotic dermatitis OMOP:4053306 - Spinal cord decompression injury OMOP:4053339 - Heterochromia of hair OMOP:4053387 - FH: Polycystic kidney OMOP:4053424 - Motor vehicle on road in collision with lamp post OMOP:4053443 - Vibrio cholerae serogroup O139 OMOP:4053447 - Equus caballus gmelini OMOP:4053465 - Nuclear membrane alteration OMOP:4053478 - Fall from heavy goods vehicle OMOP:4053480 - Off-road land motor vehicle in collision with object OMOP:4053484 - Injury to driver of non-racing motor bicycle driven off public roadway OMOP:4053502 - Aural barotrauma of ascent OMOP:4053563 - Pedestrian trapped under motor vehicle wheel OMOP:4053572 - Fall while boarding or alighting from public service vehicle OMOP:4053583 - Disorder of placenta OMOP:4053588 - Traumatic dislocation of elbow joint OMOP:4053631 - Crash landing of glider OMOP:4053660 - Lintoniella adhaerens OMOP:4053707 - Dry drowning OMOP:4053760 - Plasma membrane reduplication OMOP:4053792 - Accidental ingestion of aflatoxin OMOP:4053814 - Diffuse metaplasia OMOP:4053876 - Accident caused by fumes from burning plastic in conflagration in public building OMOP:4053901 - Multiple calculi OMOP:4053926 - Accident caused by fumes from burning PVC in conflagration in commercial premises OMOP:4053927 - Accident caused by fumes from burning polyurethane in conflagration on commercial premises OMOP:4053965 - Nuclear membrane thickening OMOP:4054014 - Accidental exposure to corrosive or caustic chemical OMOP:4054018 - Accidental ingestion of toxic berries OMOP:4054087 - Fall due to wet surface OMOP:4054176 - Transposition, right OMOP:4054204 - Progressive inflammation OMOP:4054377 - Injury to parachutist on landing OMOP:4054388 - Accidental exposure to solid paint OMOP:4054448 - Fallopian tube injury with open wound into cavity OMOP:4054460 - Open wound of auditory canal OMOP:4054496 - Neoplasm of muscle of thorax OMOP:4054501 - Neoplasm of trunk OMOP:4054503 - Neoplasm of intra-abdominal organs OMOP:4054529 - Neoplasm of epicardium OMOP:4054574 - Burning due to contact with hot drinks, liquid foods, fats and cooking oils OMOP:4054589 - Poisonous insect bite OMOP:4054592 - Poisoned bite of blue ring octopus OMOP:4054605 - Neoplasm of lip OMOP:4054613 - Neoplasm of alveolar ridge mucosa OMOP:4054675 - Crushing by grasp of animal limbs OMOP:4054769 - Thoracic nerve root injury - T12 OMOP:4054796 - Assault with body part OMOP:4054809 - Injury due to legal intervention, struck with birch OMOP:4054878 - Injury of ulnar nerve at upper arm level OMOP:4054879 - Injury of multiple nerves at shoulder and upper arm level OMOP:4054984 - Open crush injury wrist, dorsum OMOP:4055020 - Crohn's disease of terminal ileum OMOP:4055032 - Accidentally caught in folding ladder OMOP:4055048 - Accident caused by horticultural tool OMOP:4055051 - Accident caused by sharp pointed object OMOP:4055130 - Assault by poisoning with local irritant OMOP:4055140 - Assault by stabbing OMOP:4055178 - Corrosion of second degree of shoulder and upper limb, except wrist and hand OMOP:4055236 - Injury due to shotgun pellets OMOP:4055278 - Salmonella Rottnest OMOP:4055399 - Accident caused by farm trailer OMOP:4055535 - Assault by cutting with craft knife OMOP:4055594 - Closed injury, anterior tibial artery OMOP:4055604 - Late effect of nervous system injury OMOP:4055713 - Abrasion of anus OMOP:4055748 - Enterostomy malfunction OMOP:4055771 - Sexual assault of female with touching of sexual parts OMOP:4055780 - Injury due to rifle bullet OMOP:4055849 - Infected abrasion of skin of upper arm OMOP:4055997 - Splinter of toe, without major open wound OMOP:4056017 - Glomerular disorders in blood diseases and disorders involving the immune mechanism OMOP:4056158 - Degloving injury wrist, dorsum OMOP:4056249 - Sample fungus not isolated OMOP:4056310 - Complete division, extensor tendon, foot OMOP:4056347 - Nephrotic syndrome, dense deposit disease OMOP:4056439 - Closed injury of subclavian artery OMOP:4056579 - Disorder due to and following fracture at wrist and/or hand level OMOP:4056590 - Traumatic rupture of thoracic intervertebral disc OMOP:4056601 - Peripelvic (lymphatic) cyst OMOP:4056612 - Recurrent cystitis OMOP:4056712 - Actinomyces howellii OMOP:4056824 - Postoperative monitoring OMOP:4056891 - Open injury, brachial plexus, upper roots OMOP:4056953 - Doctor stopped drugs - side effect OMOP:4057013 - Sputum inspection OMOP:4057018 - Closed injury, musculocutaneous nerve OMOP:4057031 - Injury of multiple nerves at hip and thigh level OMOP:4057362 - Multiple intussusception OMOP:4057363 - Secondary intussusception OMOP:4057426 - Medication decreased OMOP:4057642 - Superficial partial thickness burn of buttock OMOP:4057798 - Corrosion of ankle and foot OMOP:4058080 - Splinter of vulva without major open wound, infected OMOP:4058135 - Drinks wine OMOP:4058143 - Anaerobic exercise zero times a week OMOP:4058148 - Willing to be donor of body OMOP:4058215 - Splinter of axilla, without major open wound, infected OMOP:4058256 - Morbidity index low OMOP:4058396 - Primary chronic pseudo-obstruction of small intestine OMOP:4058509 - Traumatic amputation of part of thorax OMOP:4058818 - Occlusion of gallbladder OMOP:4058935 - Brevoortia tyrannus OMOP:4058954 - Spinal cord injury of multiple sites without spinal bone injury OMOP:4059035 - Not willing to be a donor OMOP:4059061 - Bronchography abnormal OMOP:4059091 - Closed injury, median nerve, motor branch OMOP:4059243 - Compartment syndrome of thigh due to traumatic injury OMOP:4059367 - Forensic examination abnormal OMOP:4059420 - Infantile dwarf OMOP:4059430 - Lobeline poisoning OMOP:4059455 - Acute nephritic syndrome, diffuse mesangial proliferative glomerulonephritis OMOP:4059642 - House rented from private landlord OMOP:4059769 - Entitled to benefits OMOP:4059775 - Travel abroad for business OMOP:4059869 - Corrosion of third degree of wrist and hand OMOP:4059897 - Salmonella Marylebone OMOP:4059901 - Numeric atrophy OMOP:4059958 - Trying to conceive OMOP:4060052 - Dyspnea at rest OMOP:4060159 - Pseudoainhum OMOP:4060205 - Notropis mekistocholas OMOP:4060224 - Productive cough -clear sputum OMOP:4060330 - Blue toes OMOP:4060654 - Accident due to jumping from moving motor vehicle on road OMOP:4060769 - Barium enema requested OMOP:4060953 - Subacute perimetritis OMOP:4061211 - Leucocytozoon simondi OMOP:4061285 - Polymorphus boschadis OMOP:4061411 - Pregnant, sheath failure OMOP:4061528 - Antenatal amniocentesis - not wanted OMOP:4061594 - Cervical discharge OMOP:4061678 - Antigen in Rh blood group system OMOP:4061796 - Feeling hatred OMOP:4061798 - Parent craft classes OMOP:4061933 - Initial skin assessment OMOP:4061944 - Occupation risk monitoring OMOP:4062040 - Repeat prescription - initial assessment OMOP:4062131 - Maternal distress with postnatal problem OMOP:4062242 - Open injury superficial peroneal nerve OMOP:4062253 - Injury of multiple blood vessels at shoulder and upper arm level OMOP:4062338 - HRT: combined estrogen/progestogen OMOP:4062532 - Phenacetin poisoning OMOP:4062687 - Pre-existing malnutrition-related diabetes mellitus OMOP:4062790 - Disease of the digestive system complicating pregnancy, childbirth and/or the puerperium OMOP:4062791 - Endocrine, nutritional and metabolic disease complicating pregnancy, childbirth and puerperium OMOP:4063238 - Abnormal respiratory rate OMOP:4063251 - Blood disorder - initial assessment OMOP:4063385 - No consent for MMR OMOP:4063458 - Alopecia of pregnancy OMOP:4063574 - Leukoderma estivale OMOP:4063806 - Carbuncle of back OMOP:4063920 - Salmonella Aesch OMOP:4063926 - Pyogenic progressive granuloma OMOP:4064057 - Actinic lichen planus OMOP:4064167 - Elastic vascular sclerosis OMOP:4064384 - Urine screening due OMOP:4064492 - No immunization history record OMOP:4064732 - Type 1 skin hypersensitivity reaction OMOP:4064993 - Respiratory flow rate not measured OMOP:40650479 - Primary malignant neoplasm of posterior wall of urinary bladder OMOP:4065241 - Turtleback nail OMOP:4065242 - Alopecia localis OMOP:4065412 - Ovulation temperature chart started OMOP:4065473 - Hit by object falling from unpowered aircraft, occupant of unpowered aircraft injured OMOP:4065483 - Reactive arthritis of joint of knee OMOP:4065503 - Entamoeba wenyoni OMOP:4065587 - Accident in boarding aircraft, member of ground crew or airline employee injured OMOP:4065625 - Spinal and epidural anesthesia-induced headache during the puerperium OMOP:4065627 - Spinal and epidural anesthesia-induced headache during labor and delivery OMOP:4065731 - Flaring of alae nasi OMOP:40659144 - I intend to report the heart failure (hf) measures group (Deprecated) OMOP:4066047 - Spherocytosis OMOP:4066113 - Deliveries by destructive operation OMOP:4066137 - Chronic anoxic encephalopathy OMOP:40661655 - Referred to a physician (preferably a physician with training in disorders of the ear) for an otologic evaluation (Deprecated) OMOP:40661656 - Patient treated for attention but not scored on the attention functional communication measure either at admission or at discharge (Deprecated) OMOP:4066285 - Tephrosia cinerea OMOP:4066291 - Portal triaditis OMOP:40664443 - Most recent diastolic blood pressure >= 90 mm hg (Deprecated) OMOP:40664444 - Most recent systolic blood pressure < 130 mm hg (Deprecated) OMOP:40664598 - Tobacco use not assessed, reason not otherwise specified (Deprecated) OMOP:40664599 - Current tobacco smoker or current exposure to secondhand smoke (Deprecated) OMOP:40664639 - Most current ldl-c <100mg/dl (Deprecated) OMOP:40664644 - Serum creatinine test not performed, reason not given (Deprecated) OMOP:40664657 - Patient not discharged to home by post-operative day #2 following cea OMOP:40664667 - Antithrombotic therapy was not prescribed at discharge, reason not given (Deprecated) OMOP:40664691 - Documentation that prophylactic antibiotics were given within 4 hours prior to surgical incision or intraoperatively (Deprecated) OMOP:40664732 - Aneurysm minor diameter <= 5.5 cm for men (Deprecated) OMOP:40664737 - I intend to report the cardiovascular prevention measures group (Deprecated) OMOP:4066622 - Hyperplastic dystrophy OMOP:4066708 - Pedilanthus OMOP:4066723 - Impetigo neonatorum OMOP:4066746 - Ebstein's anomaly with atrial septal defect OMOP:4066757 - Saguinus midas OMOP:4066831 - Psoriasis inveterata OMOP:4066946 - Macerated perianal skin OMOP:4066997 - Arius felis OMOP:4067040 - Motor vehicle nontraffic accident involving injury by being thrown against some part of, or object in motor vehicle, except off-road motor vehicle, while in motion, not on public highway OMOP:4067171 - Hypertrichosis partialis OMOP:4067401 - Pulex simulans OMOP:4067429 - Clicking interphalangeal joint of toe OMOP:4067550 - Microsporum ferrugineum OMOP:4067772 - Osteonecrosis of head of humerus OMOP:4067861 - Deviation of finger OMOP:4067872 - Adolescent idiopathic scoliosis OMOP:4067933 - Avulsion of nerve of eyelid OMOP:4068117 - Anterior chamber anomalies OMOP:4068239 - Acquired forefoot abductus OMOP:4068259 - Lorikeet OMOP:4068367 - Clicking wrist OMOP:4068371 - Clicking lesser metatarsophalangeal joint OMOP:4068499 - Synovial osteochondromatosis of interphalangeal joint of toe OMOP:4068699 - Congenital zonular cataract OMOP:4068819 - Fire starting in motor vehicle while in motion on road OMOP:4069205 - Lumbar disc prolapse with radiculopathy OMOP:4069298 - Cholecystenteric fistula OMOP:4069301 - Normal enjoyment of sex OMOP:4069690 - Class in prenatal exercises OMOP:4069806 - Abnormal blue sclerae OMOP:4069857 - Khalilia pileata OMOP:4069957 - Masturbation OMOP:4070032 - Cotyledon leucophylla OMOP:4070038 - Arthritis caused by Escherichia coli OMOP:4070404 - Flattening deformity OMOP:4071027 - Hyla regilla OMOP:4071158 - Anolis carolinensis OMOP:4071316 - War injury due to fumes OMOP:4071356 - Peptococcus OMOP:4071444 - Anemia of thyroid dysfunction OMOP:4071595 - Fracture of femur due to birth trauma OMOP:4071597 - Dislocation of spine due to birth trauma OMOP:4071627 - Cyrnea OMOP:4071701 - Reticuloendothelial cell migration OMOP:4071709 - Injury of teeth OMOP:4071727 - Sepsis of newborn caused by Escherichia coli OMOP:4072012 - Instructor OMOP:4072086 - Acute bloody pericarditis OMOP:4072305 - War injury due to airplane exploded OMOP:4072375 - Tooth brushing education OMOP:4072406 - Salmonella Ord OMOP:4072618 - Lives in unfurnished rented accommodation OMOP:4072731 - Domestic facilities OMOP:4072733 - Only received primary school education OMOP:4072939 - Accidental ingestion of red bryony berries OMOP:4072950 - Accidental ingestion of toxic non-essential plant oil OMOP:4073073 - Burning caused by hydrochloric acid OMOP:4073173 - Adequate shower facilities at work OMOP:4073176 - Adequate drinking water facilities at work OMOP:4073353 - Accident caused by awl OMOP:4073381 - Insect iridescent virus 28 OMOP:4073401 - Bipolar I disorder, most recent episode manic with catatonic features OMOP:4073440 - Religious observance nominal OMOP:4073719 - On maternity leave OMOP:4073720 - Work relocated OMOP:4074310 - Countertransference OMOP:4074313 - Excessive weight gain OMOP:4074314 - Working through the pain of grief OMOP:4074619 - Sewage OMOP:4074815 - Inflammatory bowel disease OMOP:4074857 - Certification of admission OMOP:4074925 - In sheltered work OMOP:4075072 - Types of appliances education OMOP:4075218 - Psychodynamic finding OMOP:4075230 - Anger stage of grief OMOP:4075232 - Distortion of memory OMOP:4075240 - Giving mouth wash OMOP:4075498 - Countries planned to visit OMOP:40757274 - Gardnerella vaginalis DNA [Presence] in Vaginal fluid by Probe with signal amplification OMOP:40757335 - Thiacetazone [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:40757495 - Calcium [Moles/volume] in Nonbiological fluid OMOP:40757532 - Glucose [Moles/volume] in Serum or Plasma --10 minutes post dose glucagon OMOP:40757538 - Transfuse pooled fresh frozen plasma units [#] OMOP:40757571 - Newberyite/Total in Stone OMOP:40757584 - Semen analysis test method OMOP:40757640 - Cognitive patterns OMOP:40757652 - Staff assessment of daily and activity preferences OMOP:40757668 - Metabolic OMOP:40757714 - Federal OBRA reason for assessment during assessment period [CMS Assessment] OMOP:40757720 - Preadmission Screening and Resident Review (PASRR) during assessment period [CMS Assessment] OMOP:40757791 - Feeling or appearing down, depressed or hopeless in last 2 weeks.presence [Observed PHQ-9 CMS] OMOP:40757792 - Feeling or appearing down, depressed, or hopeless in last 2 weeks.frequency [Observed PHQ-9 CMS] OMOP:40757805 - States that life isn't worth living, wishes for death, or attempts to harm self in last 2 weeks.frequency [Observed PHQ-9 CMS] OMOP:40757985 - Number of falls since admission or prior assessment [CMS Assessment] OMOP:40758090 - Number of pressure injuries noted on prior assessment that have completely closed - stage 4 during assessment period [CMS Assessment] OMOP:40758142 - Hospice care in last 14 days - while not a resident [MDSv3] OMOP:40758186 - Resident's overall goals during assessment period [CMS Assessment] OMOP:40758395 - Haemophilus influenzae B immunization status OMOP:40758434 - Fungus [Presence] in Specimen by KOH preparation OMOP:40758460 - Lu sup(b) Ab [Titer] in Serum or Plasma OMOP:40758463 - little k Ab [Titer] in Serum or Plasma OMOP:40758553 - Calories burned in unspecified time Pedometer OMOP:40758671 - Hydroxybupropion [Moles/volume] in Serum or Plasma OMOP:40758712 - Tranylcypromine [Moles/volume] in Serum or Plasma OMOP:40758850 - Tinidazole [Susceptibility] by Disk diffusion (KB) OMOP:40758855 - Borrelia burgdorferi IgA and IgG and IgM panel - Cerebral spinal fluid OMOP:40758857 - Yersinia sp IgG and IgM panel - Serum OMOP:40758922 - Platelet aggregation ristocetin induced [Presence] in Platelet rich plasma --500 mg/L OMOP:40758925 - Leukocyte phosphatase [Presence] in Leukocytes OMOP:40759029 - Alpha galactosidase A [Enzymatic activity/volume] in DBS OMOP:40759216 - Birth weight more or less than 9.0 pounds (4100 g) - Reported OMOP:4075936 - Memory recall finding OMOP:40759507 - Sesame Seed IgG4 Ab [Mass/volume] in Serum OMOP:40759519 - Sweet Vernal grass IgG4 Ab [Mass/volume] in Serum OMOP:40759539 - Cultivated Wheat IgG4 Ab [Mass/volume] in Serum OMOP:40759540 - Cow whey IgG4 Ab [Mass/volume] in Serum OMOP:40759759 - Aspartate/Creatinine [Ratio] in 24 hour Urine OMOP:40759772 - Mercury/Creatinine [Ratio] in Urine OMOP:40759884 - Oligoclonal Bands IgM [Presence] in Cerebral spinal fluid by Isoelectric focusing OMOP:40760000 - Rickettsia typhi IgG Ab [Presence] in Serum by Immunofluorescence OMOP:40760041 - Entamoeba histolytica IgG Ab [Presence] in Serum by Immunoassay OMOP:40760215 - HPA 1a/1a+HPA 3a/3a [Presence] in Blood OMOP:40760327 - Influenza vaccination received in Reporting Period [CMS Assessment] OMOP:40760337 - Speech and oral expression of language during assessment period [CMS Assessment] OMOP:40760363 - Toilet transferring - functional ability during assessment period [CMS Assessment] OMOP:40760416 - HLA-Cw [Type] by High resolution OMOP:40760444 - Influenza virus A IgG Ab [Units/volume] in Serum by Immunoassay --2nd specimen OMOP:40760492 - Porphyrins/Creatinine [Molar ratio] in Urine OMOP:40760671 - 18-Hydroxycortisol [Moles/volume] in Serum or Plasma --1 hour post dose corticotropin OMOP:40760685 - 3-Alpha-Androstanediol glucuronide [Moles/volume] in Serum or Plasma --pre dose corticotropin OMOP:40760687 - 3-Alpha-Androstanediol glucuronide [Moles/volume] in Serum or Plasma --1 hour post dose corticotropin OMOP:40760752 - Androsterone [Mass/time] in 24 hour Urine --2 days post high dose dexamethasone OMOP:40761056 - Cow whey IgE Ab/IgE total in Serum OMOP:4076112 - Lives as unpaid companion OMOP:40761140 - Xanthine/Total in Stone OMOP:40761173 - Rg sup(a) Ab [Presence] in Serum or Plasma OMOP:40761174 - Wr sup(a) Ag [Presence] on Red Blood Cells OMOP:40761184 - Vw Ag [Presence] on Red Blood Cells OMOP:40761269 - Psychosocial well-being - addressed in care plan [MDSv3] OMOP:40761271 - Mood state - addressed in care plan [MDSv3] OMOP:40761377 - Ever had outpatient test(s) performed for deep vein thrombosis [Date and time] OMOP:40761464 - Alpha hydroxyalprazolam/Creatinine [Mass Ratio] in Urine OMOP:40761568 - Horse Bot Fly IgG4 Ab [Mass/volume] in Serum OMOP:40761594 - C peptide [Mass/volume] in Serum or Plasma --1.5 hours post dose glucose OMOP:40761639 - Corticotropin [Moles/volume] in Plasma --10th specimen post XXX challenge OMOP:40761642 - Corticotropin [Moles/volume] in Plasma --12 AM specimen OMOP:40761697 - Corticotropin [Moles/volume] in Plasma --3 hours post dose glucose OMOP:40761728 - Corticotropin [Moles/volume] in Plasma --pre dose metyraPONE OMOP:40761783 - Complement C5 [Presence] in Serum or Plasma OMOP:40762074 - Timothy recombinant (rPhl p) 5b IgE Ab [Units/volume] in Serum OMOP:40762124 - CD25+C69+ cells/100 cells in Blood OMOP:40762176 - Heart Isovolumic relaxation time by US OMOP:4076219 - Lives in squalid conditions OMOP:4076226 - Duration of formal education OMOP:40762264 - Norclozapine [Presence] in Urine OMOP:40762304 - Alloisoleucine [Moles/time] in Urine collected for unspecified duration OMOP:40762309 - Beta-2-Microglobulin [Mass/volume] in Pleural fluid OMOP:4076237 - Involved in criminal activity OMOP:40762418 - Salvinorin B [Mass/volume] in Serum or Plasma OMOP:40762500 - Oxygen saturation in Arterial blood by Pulse oximetry --during treatment OMOP:40762516 - Morse Fall Scale panel OMOP:40762517 - History of falling; immediate or within 3 months [Morse Fall Scale] OMOP:40762564 - Collaborative staging site-specific factor 20 Cancer OMOP:40762572 - Date case initiated Cancer case OMOP:40762647 - GSTP1 gene+APC gene methylation [Presence] in Tissue by Molecular genetics method OMOP:40762836 - Procedure disposition Narrative OMOP:40762890 - Leukocytes in 3 hour Urine sediment by Light microscopy OMOP:40762939 - chlordiazePOXIDE [Moles/volume] in Urine OMOP:40762976 - Isopropanol [Moles/volume] in Gastric fluid OMOP:40763074 - Corticotropin [Moles/volume] in Plasma --baseline OMOP:40763101 - N-acetylprocainamide [Mass/volume] in Blood OMOP:40763354 - Cotinine [Moles/volume] in Specimen OMOP:40763410 - Pinto Bean IgG Ab [Mass/volume] in Serum OMOP:40763476 - Honey bee phospholipase A2 recombinant (rApi m) 1 IgE Ab [Units/volume] in Serum OMOP:4076356 - Availability of workplace canteen facilities OMOP:40763689 - Gonial angle Skull X-ray measured OMOP:40763703 - Tonsilar width Skull X-ray measured OMOP:40763730 - Ethyl sulfate [Mass/volume] in Urine OMOP:40763745 - Individual right finger movement [TIMP] OMOP:40763877 - Mitochondria rRNA targeted mutation analysis in Blood or Tissue by Molecular genetics method OMOP:40763970 - Mushroom IgE Ab/IgE total in Serum OMOP:40764057 - Timothy IgE Ab/IgE total in Serum OMOP:40764074 - Sesame Seed IgE Ab/IgE total in Serum OMOP:40764185 - Noroxycodone [Presence] in Urine by Confirmatory method OMOP:40764200 - How often did you eat cold cereal in the past 30 days [PhenX] OMOP:40764254 - What is your serving size for espresso and espresso drinks, not decaffeinated (latte, mocha, Americano) [PhenX] OMOP:40764256 - What is your serving size for green tea [PhenX] OMOP:40764258 - What is your serving size for Jolt, Surge, Mountain Dew, Red Bull and other highly caffeinated sodas [PhenX] OMOP:4076436 - Neisseria meningitidis OMOP:40764444 - Are you able to lift one pound (a full pint container) to shoulder level without bending your elbow [PROMIS] OMOP:40764446 - Are you able to walk a block on flat ground [PROMIS] OMOP:40764524 - How much did pain interfere with doing your tasks away from home (e.g., getting groceries, running errands) in past 7 days [PROMIS] OMOP:40764538 - How much did pain interfere with your enjoyment of social activities in past 7 days [PROMIS] OMOP:40764584 - How often did your fatigue limit you at work (include work at home) in past 7 days [PROMIS] OMOP:40764586 - To what degree did your fatigue make it difficult to organize your thoughts when doing things at home in past 7 days [PROMIS] OMOP:40764674 - I felt annoyed in past 7 days [PROMIS] OMOP:40764689 - I was concerned about my mental health in past 7 days [PROMIS] OMOP:40764735 - I felt ignored by people in past 7 days [PROMIS] OMOP:40764755 - I woke up and had trouble falling back to sleep in past 7 days [PROMIS] OMOP:4076480 - Care breaking down OMOP:40764845 - My body felt bad when I was out of breath in past 7 days [PROMIS] OMOP:40764848 - I didn't care about anything in past 7 days [PROMIS] OMOP:40764849 - I wanted to be by myself in past 7 days [PROMIS] OMOP:40764861 - Being tired made it hard for me to play or go out with my friends as much as I'd like in past 7 days [PROMIS] OMOP:40764886 - I could stand up by myself in past 7 days [PROMIS] OMOP:40764911 - I missed school when I had pain in past 7 days [PROMIS] OMOP:40764913 - It was hard to have fun when I had pain in past 7 days [PROMIS] OMOP:40764969 - PROMIS pediatric short form - asthma 8a - version 1.0 OMOP:40764977 - I could put toothpaste on my toothbrush by myself in past 7 days [PROMIS] OMOP:40764995 - Albumin [Moles/volume] in Serum or Plasma by Bromocresol purple (BCP) dye binding method OMOP:40765037 - PhenX - calcium intake - adult protocol 050202 OMOP:40765059 - Gaucher disease newborn screening panel OMOP:40765093 - Chromosome analysis panel - Products of Conception by G-banded OMOP:40765107 - Recommended follow-up [Identifier] OMOP:40765109 - Cell phase [Type] OMOP:40765198 - Trichomonas vaginalis DNA [Presence] in Vaginal fluid by NAA with probe detection OMOP:40765256 - PhenX - environmental exposures - exposure at work and daily life protocol 060401 OMOP:40765262 - PhenX - environmental exposures - current environmental tobacco smoke exposure protocol 060701 OMOP:40765465 - PhenX - medications - pain relievers, statins, steroids protocol 071201 OMOP:40765814 - Cayenne IgG Ab [Mass/volume] in Serum OMOP:40765939 - False ragweed IgG Ab [Mass/volume] in Serum OMOP:40765968 - DNA double strand IgM Ab [Presence] in Serum by Immunofluorescence OMOP:40765989 - Ganglioside GT1b IgG Ab [Presence] in Serum by Immunoassay OMOP:40766062 - Baker's yeast IgA Ab [Units/volume] in Body fluid by Immunoassay OMOP:40766065 - Baker's yeast IgG Ab [Presence] in Serum by Immunofluorescence OMOP:40766090 - Smooth muscle Ab [Titer] in Cerebral spinal fluid by Immunofluorescence OMOP:40766100 - Carbapenem resistance genes [Identifier] by NAA with probe detection OMOP:40766212 - Methotrimeprazine [Mass/volume] in Serum or Plasma OMOP:40766262 - Jo-1 extractable nuclear Ab [Presence] in Body fluid OMOP:40766287 - aPTT actual/normal in Platelet poor plasma by Coagulation assay OMOP:40766323 - On the days that you drank during the past 30 days, how many drinks did you usually have each day [PhenX] OMOP:40766329 - Health problem resulting from long stretches of drinking [SSAGA II] OMOP:40766335 - During the past 30 days, have you smoked part or all of a cigarette [PhenX] OMOP:40766412 - Drug used in past 30 days [PhenX] OMOP:40766421 - What year did you start living there [LIBCSP] OMOP:40766433 - Which types of air conditioning units do you use [NHEXAS] OMOP:40766437 - Does this house or apartment have a central heating system with ducts that blow air into most rooms [NHEXAS] OMOP:40766459 - Materials to which you were exposed in your work or daily life [ACSCP-II] OMOP:40766471 - What kind of business or industry did you work in for the longest period of time [NHANES] OMOP:40766473 - About how long did you work at that job or business OMOP:4076648 - Feeling empty OMOP:40766545 - Did you ever get a blistering sunburn [NHL] OMOP:40766581 - In this age range, did you drink alcoholic beverages at least once a week for 6 months or more [PhenX] OMOP:40766612 - Cause of menopause [PhenX] OMOP:40766644 - What was the longest length of time you stopped smoking because you were trying to quit [PLCO] OMOP:40766689 - Items added to babys bottle or breast milk [IFPS-II] OMOP:40766695 - What beverage does your child most often consume at meals [PhenX] OMOP:40766724 - Did you have this pain or toothache more than once, in past 6 months [PhenX] OMOP:40766800 - Mycobacterium tuberculosis stimulated gamma interferon release by CD4+ T-cells [Units/volume] corrected for background in Blood OMOP:40766808 - Cells analyzed [#] in Amniotic fluid by Molecular genetics method OMOP:40766821 - Reason stopped or paused before 6 minutes OMOP:40768892 - Trial attempt [PhenX] OMOP:40766859 - Do you usually cough at all on getting up, or first thing in the morning [PhenX] OMOP:40766861 - Do you usually cough like this on most days for 3 consecutive Mos or more during the year [PhenX] OMOP:40766926 - Was gas or chemical fumes exposure [PhenX] OMOP:40766928 - Do you now smoke cigarettes, as of 1 month ago [PhenX] OMOP:40767039 - Incenter patients starting dialysis for first time ever Population # OMOP:40767091 - Kidney transplant center patients who received at least one kidney transplant who is neither a US citizen nor a foreign national US resident and not eligible for enrollment in Medicare at end of period Population # OMOP:40767131 - KIR gene allele 2DS1 [Presence] in Blood or Tissue by Molecular genetics method OMOP:40767174 - My medication does not help me very much [PhenX] OMOP:40767182 - If I walk up one flight of stairs, I have to go slowly or stop [PhenX] OMOP:40767215 - Have you ever been concerned about your childs breathing during sleep [PhenX] OMOP:40767224 - At night, does your child usually become sweaty, or do the pajamas usually become wet with perspiration [PhenX] OMOP:40767254 - What time does your child usually get out of bed on weekend or vacation mornings [PhenX] OMOP:40767272 - Has your child felt an irresistible urge to take a nap at times, forcing him or her to stop what he or she is doing in order to sleep [PhenX] OMOP:40767295 - Psychological, psychiatric, emotional, or behavioral problems diagnosed or suspected by a physician in your child [PhenX] OMOP:40767310 - Technician [Identifier] OMOP:40767318 - Current stage of physical development [PhenX] OMOP:40767362 - Other estrogen you are currently using [PhenX] OMOP:40767369 - Have you ever had the HPV vaccination OMOP:40767374 - Did the testicle go down to the scrotum by itself [PhenX] OMOP:40767420 - Was the baby a boy or a girl [PhenX] OMOP:40767450 - In the last 12 months, have you noticed this eye problem [PhenX] OMOP:40767469 - How many of his or her grandparents have, had, or were suspected of having this eye problem [#] [PhenX] OMOP:40767550 - How much pain or discomfort have you had in and around your eyes, for example, burning, itching, or aching [PhenX] OMOP:40767575 - Were the glasses or contact lenses prescribed for short-sightedness or myopia [PhenX] OMOP:40767612 - I follow my parents wherever they go [SCARED-R] OMOP:40767620 - I am afraid to visit the dentist [SCARED-R] OMOP:40767635 - I feel weak and shaky [SCARED-R] OMOP:40767690 - Grade in school, if applicable OMOP:40767714 - I find myself drawn more strongly to people than to things [AQ] OMOP:40767717 - When I talk, it isn't always easy for others to get a word in edgeways [AQ] OMOP:40767729 - I don't usually notice small changes in a situation or a person's appearance [AQ] OMOP:40767772 - Your child notices patterns in things all the time [AQ Adolescent] OMOP:40767800 - Does your child come up to you spontaneously for a chat [CAST] OMOP:40767803 - Is it important to your child to fit in with the peer group [CAST] OMOP:40767814 - Does your child often bring you things he or she is interested in to show you [CAST] OMOP:40767853 - I see myself as someone who is full of energy [BFI] OMOP:40767856 - I see myself as someone who can be tense [BFI] OMOP:40767884 - I see myself as someone who likes to cooperate with others [BFI] OMOP:40767891 - Taking them altogether, did these feelings occur more often in the past 30 days than is usual for you, about the same as usual, or less often than usual [Kessler 6 Distress] OMOP:40767902 - Have you ever been bothered by unwanted thoughts, or dreams, or images that kept coming back to you, about a traumatic event that you experienced or witnessed [PhenX] OMOP:40767945 - Compared to other children, does this child engage in tasks that require sustained mental effort [SWAN] OMOP:40767949 - Compared to other children, does this child sit still, control movement of hands or feet or control squirming [SWAN] OMOP:40767958 - I'm optimistic more often than not [PhenX] OMOP:40767975 - I've gotten in trouble because I missed too much school [PhenX] OMOP:40767976 - I have a knack for influencing people [PhenX] OMOP:40768066 - Did anyone ever tell you that when you were a small child, you would daydream or stare into space more than other children [PhenX] OMOP:40768090 - If diagnosed with migraines, at what age were you first diagnosed with migraines [PhenX] OMOP:40768105 - Arms held in wing position for 15 seconds [PhenX] OMOP:40768155 - Have you experienced such highs in the past 12 months [HCL-32] OMOP:40768226 - Did you worry most days [CIDI-SF] OMOP:40768285 - How old were you the last time you experienced these problems [PhenX] OMOP:40768297 - Has your difficulty with sleeping occurred or worsened during menopause [PhenX] OMOP:4076837 - Hypertrophic laryngitis OMOP:40768501 - How many girls did you have [#] [PhenX] OMOP:40768574 - When you have panic attacks do you experience this thing [CIDI-SF] OMOP:40768633 - Dysphoria - depression [DI-PAD] OMOP:40768650 - Initial insomnia [DI-PAD] OMOP:40768662 - Racing thoughts [DI-PAD] OMOP:40768710 - Agitated activity [DI-PAD] OMOP:40768770 - Wearing glasses, how much difficulty do you have reading the small print in a telephone book, on a medicine bottle, or on legal forms [PhenX] OMOP:40768849 - When did you have coffee or tea with cream and sugar [Date and time] [PhenX] OMOP:40768871 - Tremor at rest Lower extremity - right [UPDRS] OMOP:40768901 - Modified pull-ups [#] [PhenX] OMOP:40768927 - Why participant did not attempt test or failed [PhenX] OMOP:40768932 - Time for 3 or 4 meters [PhenX] OMOP:40768933 - Aids for the walk [PhenX] OMOP:40768944 - Time period [PhenX] OMOP:40768984 - Reviews form for completeness [PhenX] OMOP:40769028 - How much difficulty do you have pushing or pulling large objects like a living room chair [PhenX] OMOP:40769045 - Degree of confidence for exercising 3 times per week in the next 3 months [PhenX] OMOP:40769098 - Number of medication items prescribed Current medication [PhenX] OMOP:40769202 - What color is an average spot of your psoriasis [PhenX] OMOP:40769212 - Other biologicals - injected [PhenX] OMOP:40769237 - Now thinking about your physical health, which includes physical illness and injury, for how many days during the past 30 days was your physical health not good [HRQOL] OMOP:40769253 - Unfinished tasks really bother me [UPPS-P] OMOP:40769289 - I would enjoy parachute jumping [UPPS-P] OMOP:40769304 - I sometimes like doing things that are a bit frightening [UPPS-P] OMOP:40769389 - Adenovirus DNA [#/volume] (viral load) in Skin by NAA with probe detection OMOP:40769446 - How well can you study a chapter for a test [SEQ-C] OMOP:40769457 - How well can you tell a friend that you don't feel well [SEQ-C] OMOP:40769478 - In the last month, how often have you felt nervous and stressed [PSS-10] OMOP:40769480 - In the last month, how often have you felt that things were going your way [PSS-10] OMOP:40769572 - Have you ever been kidnapped or held captive [LTVH] OMOP:40769602 - How many times in the last year have you purposely damaged or destroyed property that did not belong to you [Denver Youth Survey] OMOP:40769620 - How many times in the last year have you attacked someone with a weapon or with the idea of seriously hurting or killing them [Denver Youth Survey] OMOP:40769737 - Body location affected by psoriasis now [Anatomy] [PhenX] OMOP:40769797 - Other reason for initial visit for clinical assessment [PhenX] OMOP:40769818 - Type of complication OMOP:40769820 - Diagnostic evaluation for colorectal cancer [PhenX] OMOP:40769847 - Summary staging [PhenX] OMOP:40769848 - Adenomas procedure [PhenX] OMOP:40769859 - What years did this happen [DateRange] [PhenX] OMOP:40769902 - My child's ability to keep a conversation going with other children is [PhenX] OMOP:40769912 - I almost always finish projects that I start [UPPS-R-Child] OMOP:40769942 - Anyone in your child's family that has a poorer vocabulary than other family members [PhenX] OMOP:40769993 - Because of your problem, do you feel handicapped [PhenX] OMOP:40770007 - People ask, what's wrong with your voice [PhenX] OMOP:40770009 - People ask me to repeat myself when speaking face-to-face [PhenX] OMOP:40770029 - How quickly did your hearing difficulty develop [PhenX] OMOP:4077004 - Copsychus malabaricus OMOP:40770052 - How often do you generally have attacks [PhenX] OMOP:40770120 - Cardiac arrest NEMSIS OMOP:40770121 - Cardiac arrest cause NEMSIS OMOP:40770157 - Medication administered prior to this unit's EMS care OMOP:40770229 - It is easy to talk with teachers [PhenX] OMOP:40770257 - My school is usually clean and tidy [PhenX] OMOP:40770294 - Got seriously sick or injured [PhenX] OMOP:40770327 - Unspecified body region Image ID OMOP:40770328 - Reason for your hearing difficulty [PhenX] OMOP:40770354 - Person [PhenX] OMOP:40770383 - Other symptoms NEMSIS OMOP:40770425 - Lymphocytes [#/volume] in Pericardial fluid OMOP:40770441 - EMS social history Narrative NEMSIS OMOP:40770549 - How much difficulty do you currently have checking the accuracy of financial documents, like bills, checkbook, or bank statements [NeuroQol] OMOP:40770642 - I am able to do all of the activities with friends that I want to do in the past 7 days [NeuroQol] OMOP:40770645 - I am able to do all of my regular leisure activities in the past 7 days [NeuroQol] OMOP:40770679 - I feel that others are disappointed in my ability to do community activities in the past 7 days [NeuroQol] OMOP:40770684 - I am disappointed in my ability to work in the past 7 days [NeuroQol] OMOP:40770721 - Neuro-Qol pediatric item bank - stigma - version 1.0 [NeuroQol.Peds] OMOP:40770760 - I felt frustrated in the past 7 days [NeuroQol.Peds] OMOP:40770787 - I was so mad that I felt like yelling at someone in the past 7 days [NeuroQol.Peds] OMOP:40770798 - My friends ignored me in the past 7 days [NeuroQol.Peds] OMOP:40770842 - I could walk for 15 minutes in the past 7 days [NeuroQol.Peds] OMOP:40770893 - I was able to button and unbutton my shirt in the past 7 days [NeuroQol.Peds] OMOP:40770922 - CMS certification number - CCN Dialysis facility OMOP:40770933 - Primary cause of death OMOP:40770935 - Secondary cause of death OMOP:40770944 - Hospice prior to death OMOP:40771032 - Date transplant OMOP:40771053 - Epstein-Barr virus-encoded RNA 1 [Presence] in Tissue by Probe OMOP:40771097 - How many soda and sweetened drinks, regular, not diet, did you drink each day in past 7 days [SAMHSA] OMOP:40771112 - Are you always able to stop using drugs when you want to [SAMHSA] OMOP:4186392 - Murmur OMOP:40771114 - Do you ever feel bad or guilty about your drug use [SAMHSA] OMOP:4077149 - Actinium-228 OMOP:40771538 - Lymphocyte proliferation.phytohemagglutinin.maximum/CD3 in Blood by Flow cytometry (FC) OMOP:40771542 - Immature granulocytes/100 leukocytes in Synovial fluid OMOP:40771565 - Date first prenatal visit OMOP:40771891 - A1 Ab [Presence] in Cord blood OMOP:40771942 - Street address where death occurred if not facility OMOP:40771984 - Unit was back in service and available for response [Date and time] Vehicle OMOP:4077200 - Subarachnoid hemorrhage from posterior cerebral artery aneurysm OMOP:40772005 - Jumping - difficulty [OPTIMAL] OMOP:4077204 - Preoccupation with death OMOP:40772043 - Genetic variant assessment OMOP:40772049 - Grasping - confidence - score change [OPTIMAL] OMOP:40772084 - Squatting - difficulty - score change [OPTIMAL] OMOP:40772111 - Getting tired very easily in last 4 weeks [Reported.PHQ] OMOP:40772159 - Generalized anxiety disorder 7 item (GAD-7) OMOP:4077595 - Dysplasia of eye OMOP:4077601 - Bone turnover rate absent OMOP:4077912 - Cerebellar vertigo OMOP:4077951 - Country of origin OMOP:4078064 - Saguinus nigricollis OMOP:4078065 - Placenta reflexa OMOP:4078330 - Focal onset cognitive epileptic seizure with hallucinations OMOP:4078683 - Salmonella Ahepe OMOP:4078715 - Bifidobacterium pseudocatenulatum OMOP:4078866 - Translucent tympanic membrane OMOP:4078922 - Ilex vomitoria OMOP:4079021 - Ruptured internal carotid-anterior communicating artery zone aneurysm OMOP:4079162 - Thomasclavelia cocleata OMOP:4079169 - Parachute reflex OMOP:4079217 - Artedius creaseri OMOP:4079236 - Parenchymatous mastitis associated with childbirth OMOP:4079303 - Swollen nasopharynx OMOP:4079441 - Manchester picture test OMOP:4079442 - Speech in noise discrimination test OMOP:4079541 - Between locations OMOP:4079553 - Anaplastic astrocytoma of brain OMOP:4079621 - Pediatric emergency hospital admission OMOP:4079627 - Night hospital care OMOP:4079637 - Burns referral OMOP:4079831 - Traumatic division of long flexor tendon - zone 2 OMOP:4079850 - Diabetes mellitus in neonate small for gestational age OMOP:4079881 - Zellweger's-like syndrome OMOP:4079882 - Loss of single peroxisomal function OMOP:4079884 - Acyl-CoA oxidase deficiency OMOP:4079931 - Open fracture of upper limb OMOP:4080202 - Chemoreceptor apnea OMOP:4080301 - Streptococcal cellulitis OMOP:4080312 - Desert sore OMOP:4080321 - Animal-induced dermatosis OMOP:4080332 - Neonatal echovirus disease OMOP:4080425 - Neonatal chlamydial infection OMOP:4080427 - Early lymphogranuloma venereum OMOP:4080432 - Old World tick typhus OMOP:4080556 - Purpura simplex OMOP:4080560 - Juvenile elastoma OMOP:4080621 - Micropapular yaws OMOP:4080671 - Anterior chamber membrane OMOP:4080677 - Turning of head towards light source OMOP:4080682 - Eyes sensitive to light OMOP:4080862 - Limbal hyperemia OMOP:4080872 - Flat sacral curve OMOP:4080937 - Chronic prurigo OMOP:4080944 - Keratosis pilaris decalvans OMOP:4081013 - Anterior chamber deposits OMOP:4081019 - Displacement of iris OMOP:4081048 - Overlapping sites OMOP:4081053 - Papillary tumor of ampulla of Vater OMOP:4081129 - Discharged from private hospital OMOP:4081144 - Spontaneous reabsorption of cataract OMOP:4081146 - Lens capsule opacity in pseudophakia OMOP:4081167 - Eye cornering in direction of sound OMOP:4081168 - Cranial nerve reflex OMOP:4081177 - Median nerve finding OMOP:4081204 - Kiel classification OMOP:4081226 - Atrophic scarring of cheeks OMOP:4081335 - Incomitant exophoria OMOP:4081336 - Incomitant hyperphoria OMOP:4081466 - Downward slant of palpebral fissure OMOP:4081471 - Lid adhesions OMOP:4081485 - Palpebral conjunctiva granuloma OMOP:4081488 - Vascularization of cornea OMOP:4081521 - Anticoagulant excess without bleeding OMOP:4081528 - Animal serum protein OMOP:4081631 - Pupil motor light reaction OMOP:4081644 - Anterior capsular lens opacities OMOP:4081648 - Acute vaginitis OMOP:4081745 - Follow-up 1 month OMOP:4081781 - General surgery domiciliary visit requested OMOP:4082022 - Nasal hump OMOP:4082038 - Amebic abscess of skin OMOP:4082142 - Evidence of recent epistaxis OMOP:4082148 - Subglottic erythema OMOP:4082292 - Peripheral drusen OMOP:4082303 - Large optic disc and cup OMOP:4082317 - Secondary pulmonary hypoplasia OMOP:4082320 - Secondary endolymphatic hydrops OMOP:4082329 - Solitary fibrous tumor of meninges OMOP:4082346 - Disorder of soft tissue due to diabetes mellitus OMOP:4082356 - Alopecia, onychodysplasia, hypohidrosis, deafness ectodermal dysplasia OMOP:4082386 - Doctor stopped drugs - ineffective OMOP:4082442 - Sensation as if period due OMOP:4082454 - Deep pain on intercourse OMOP:4082586 - Comedone OMOP:4082588 - Wheal OMOP:4082599 - Neonatal hair appearance OMOP:4082604 - Hair characteristics OMOP:4082605 - Texture of hair OMOP:4082609 - Split hair OMOP:4082613 - Retinal vein appearance OMOP:4082733 - Excellent response to treatment OMOP:4082794 - Painful teething OMOP:4082912 - Colostomy aid education OMOP:4083101 - Photogravure retoucher OMOP:4083309 - Morbilliform eruption OMOP:4083465 - Concretion of appendix OMOP:4083504 - Paratesticular tumor OMOP:4083505 - Avulsion of ligament with bony fragment OMOP:4083558 - Late onset polyarticular juvenile chronic arthritis OMOP:4083606 - Peripheral retina - white with pressure OMOP:4083612 - Cilioretinal artery OMOP:4083613 - Optic disc cup OMOP:4083614 - Optic disc venous collaterals OMOP:4083629 - Middle ear cleft finding OMOP:4083681 - Juvenile ankylosing spondylitis OMOP:4083689 - Intra-articular steroid-induced arthritis and periarthritis OMOP:4083788 - Skin punctum OMOP:4083820 - Wedge fracture of thoracic vertebra OMOP:4083863 - PVA adhesive causing toxic effect OMOP:4083870 - Private sick cert-not paid OMOP:4083921 - Pseudo-clubbing OMOP:4083928 - Banded hair OMOP:4083951 - Dislocation classification types OMOP:4083953 - Dandy grade 4 OMOP:4084054 - Plasmodium cathemerium OMOP:4084134 - Sample not visibly lipemic OMOP:4084161 - Wallpaper adhesive causing toxic effect OMOP:4084192 - Convalescence after psychotherapy OMOP:4084273 - Lumbarized first sacral vertebra OMOP:4084341 - Cardiothoracic emergency hospital admission OMOP:4084342 - Non-urgent pediatric admission OMOP:4084364 - Refer for terminal care OMOP:4084465 - Poisoning caused by venom of back-fanged snake OMOP:4084466 - Poisoning caused by boomslang venom OMOP:4084487 - Paint causing toxic effect OMOP:4084494 - Gardening product causing toxic effect OMOP:4084500 - Discharged from inpatient care OMOP:4084534 - Inpatient stay 4 days OMOP:4084541 - Delusion of special mission OMOP:4084549 - Delusion of control of handwriting OMOP:4084564 - Integrated attention for short spells OMOP:4084677 - Non-urgent neurology admission OMOP:4084678 - Non-urgent urology admission OMOP:4084896 - Delusional perplexity OMOP:4084948 - Anal warts OMOP:4084975 - Primary lobomycotic nodule OMOP:4084999 - Inpatient stay 2 days OMOP:4085011 - Refer for angiography OMOP:4085130 - Nepeta cataria OMOP:4085177 - Cervical smear - recall delete OMOP:4085190 - Obsessional doubts OMOP:4085557 - Rupture of tendon of upper limb OMOP:4085596 - Accessory thymic tissue OMOP:4085600 - Enveloped ssRNA virus without a DNA step in life-cycle OMOP:4085614 - Mansonella perstans OMOP:4085688 - Loss of identity OMOP:4085691 - Attempts to promote omnipotence OMOP:4085796 - Failed encounter - message left on answer machine OMOP:4085820 - Feelings of omnipotence OMOP:4085852 - Temper problem OMOP:4086116 - Breast screening requested OMOP:4086117 - Hypertension monitoring third letter OMOP:4086137 - Well woman monitoring telephone invite OMOP:4086185 - Primitive reflex OMOP:4086195 - Superficial injury of head OMOP:4086196 - Superficial injury of throat OMOP:4086234 - Metal foreign body in hand OMOP:4086333 - Peripheral ring scotoma OMOP:4086368 - Fishing hook in abdomen OMOP:4086397 - Congenital abnormality of salivary duct OMOP:4086499 - Central alveolar hypoventilation syndrome OMOP:4086512 - Excess subcutaneous fat OMOP:4086530 - Injury of ileum OMOP:4086534 - Burn of duodenum OMOP:4086560 - Unable to walk on a narrow line OMOP:4086561 - Able to walk heel to toe OMOP:4086847 - Response to commands OMOP:4087011 - Smooth, soft hands OMOP:4087071 - Infection by Davainea OMOP:4087079 - p phenotype OMOP:4087156 - Lump at corneal limbus OMOP:4087305 - Neglect of physical health OMOP:4087309 - Head-hitting OMOP:4087427 - Streptococcal sore throat with scarlatina OMOP:4087431 - Hepatic actinomycosis OMOP:4087438 - Increased gastric electrical activity OMOP:4087464 - Flushed complexion OMOP:4087465 - Use of make-up OMOP:4087481 - Lack of energy OMOP:4087491 - Allium schoenoprasum OMOP:4087502 - Flat fontanelle OMOP:4087604 - Human immunodeficiency virus infection with neurological disease OMOP:4087786 - Uniocular nystagmus OMOP:4087899 - New patient screening verbal invitation OMOP:4087958 - Corneal nerve finding OMOP:4088050 - Subcapsular hemorrhage OMOP:4088054 - Formal complaint about GP OMOP:4088094 - Fixed constriction of pupil OMOP:4088253 - Tricuspid inspiratory pansystolic murmur OMOP:4088334 - Lown-Ganong-Levine pattern OMOP:4088349 - Ventricular tachycardia, polymorphic OMOP:4088396 - Notifications OMOP:4088401 - Seen in primary care center OMOP:4088546 - Seen in homeopathy clinic OMOP:4088582 - Pregnant uterus displaced laterally OMOP:4088599 - No sputum OMOP:4088606 - Decreased vocal resonance OMOP:4088609 - Somatic syndrome absent OMOP:4088682 - Dominant delta activity OMOP:4088686 - Low frequency background activity OMOP:4088874 - Chronic disease monitoring - first recall OMOP:4088893 - Seen in lipid clinic OMOP:4088914 - Position of uterine cervix OMOP:4088993 - Prolonged U wave OMOP:4089028 - Seen in oral surgery clinic OMOP:4089071 - Reducible suture overlap OMOP:4089075 - Direct mentoanterior position OMOP:4089079 - Double knee presentation OMOP:4089142 - Hearing change OMOP:4089224 - Sobbing respiration OMOP:4089225 - Whistling in nose OMOP:4089297 - Focal episodic theta activity OMOP:4089373 - Thyroid flow murmur OMOP:4089475 - QRS complex height increased OMOP:4089484 - T wave shape OMOP:4089610 - Susceptible to caries OMOP:4089620 - Nasal resistance OMOP:4089625 - Gastroesophageal reflux status OMOP:4089629 - Small intestine glucose intolerance OMOP:4089755 - Malignant neoplasm of lower lobe bronchus OMOP:4089836 - Tanner girls breast development stage OMOP:4089839 - Sparse growth of downy pubic hair OMOP:4090002 - Seen by professional OMOP:4090122 - Extension of cerebrovascular accident OMOP:4090259 - Macular subretinal hemorrhage OMOP:4090261 - Macular subretinal fibrosis OMOP:4090475 - Dysfunctional voiding of urine OMOP:4090492 - Reactive CTG tracing OMOP:4090494 - Fetal heart acceleration OMOP:4090507 - Mucoid lacrimal regurgitation OMOP:4090722 - Change in quantity of liquor OMOP:4090744 - Color of lochia OMOP:4090811 - Urinary fistula type OMOP:4090816 - Mean arterial flow OMOP:4090954 - Wingate protocol stage achieved OMOP:4090974 - Vitamin C loading test OMOP:4091042 - Hepatozoon cuniculi OMOP:4091054 - Gallbladder palpable on inspiration OMOP:4091150 - Dendroaspis angusticeps OMOP:4091199 - Postpartum vulval hematoma OMOP:4091275 - Number of metastases OMOP:4091348 - Nasal deviation, bone OMOP:4091353 - Alternate nasal obstruction OMOP:4091355 - Moistness of nasal mucosa OMOP:4091366 - Tonsil finding OMOP:4091378 - Bleeding of oral mucosa OMOP:4091482 - Malignant tumor of tunica vaginalis OMOP:4091499 - Vocal cord cyst OMOP:4091503 - Swallowing pattern OMOP:4091604 - Potassium hydroxide skin test OMOP:4091661 - Intact membranes OMOP:4091687 - Couvade OMOP:4091727 - Air conduction pure tone audiometry, manual with ear phones OMOP:4091768 - Burkitt's lymphoma of intrathoracic lymph nodes OMOP:4091789 - Odor of lochia OMOP:4091881 - Tone decay test OMOP:4091946 - No salivation OMOP:4091963 - Bowel spasm OMOP:4092037 - Cardiac pacemaker electrocardiographic pattern OMOP:4092078 - Malignant neoplasm of mesocolon OMOP:4092080 - Malignant neoplasm of the pouch of Douglas OMOP:4092210 - Malignant tumor of nasal vestibule OMOP:4092259 - Forced grasping OMOP:4092264 - Repetitive rubbing of body parts OMOP:4092393 - Infectious bursal disease virus OMOP:4092423 - Anal twitching OMOP:4092499 - Fluid output from wound drain OMOP:4092563 - Absence of hand OMOP:4092569 - Change in ring size - finding OMOP:4092585 - Pseudohypertrophy of muscle OMOP:4092645 - Slow rate of urinary bladder filling OMOP:4092666 - Mean arterial velocity OMOP:4092711 - Weak down pressure of chin OMOP:4092786 - Number of stillbirths OMOP:4092865 - Bouncy gait OMOP:4092875 - Marche a petits pas OMOP:4092888 - Empty rectum OMOP:4092898 - Integrity of anal sphincter OMOP:4092909 - Urinary reservoir OMOP:4092954 - Ammonium chloride acidification test OMOP:4093115 - Static platform test OMOP:4093148 - Rubella deafness OMOP:4093175 - Wall to tragus distance OMOP:4093180 - Paraplegic posture OMOP:4093336 - Spleen palpable OMOP:4093346 - Large prostate OMOP:4093518 - Large finger OMOP:4093599 - Deep caries OMOP:4093803 - Lipoma of spinal canal - intradural OMOP:4093932 - Atrophic lichen planus OMOP:4094001 - Fever defervescence OMOP:4094154 - Fumbles with things OMOP:4094247 - Isomerase OMOP:4094260 - Malignant neoplasm of peripheral nerves and autonomic nervous system OMOP:4094261 - Malignant neoplasm of peripheral nerves of upper limb, including shoulder OMOP:4094336 - Epidermal burn of head OMOP:4094549 - Aleukemic lymphoid leukemia OMOP:4094621 - Intentional butriptyline poisoning OMOP:4094634 - Protriptyline poisoning OMOP:4094684 - Traumatic petechiae OMOP:4094689 - Superficial laceration OMOP:4094755 - Bovine mucosal disease virus OMOP:4094773 - Intentional venlafaxine poisoning OMOP:4094777 - Fluvoxamine poisoning OMOP:4094822 - Foreign body in respiratory tract OMOP:4094947 - Accidental trimipramine poisoning OMOP:4094951 - Intentional iproniazid poisoning OMOP:4094959 - Transection of lumbar nerve root OMOP:4094983 - Adrenal gland hematoma OMOP:4094987 - Serosal tear of stomach OMOP:4094995 - Malignant neoplasm of thoracic vertebra OMOP:4095021 - Phosphate crystal OMOP:4095171 - Determination of calculus composition OMOP:4095193 - Excessive mobility of patella OMOP:4095206 - Footwear too wide OMOP:4095273 - Laceration of oral alveolar mucosa OMOP:4095276 - Penetrating injury of gingivae OMOP:4095285 - ST segment depression OMOP:4095298 - Malignant neoplasm of globus pallidus OMOP:4095313 - Malignant tumor of anterior wall of nasopharynx OMOP:4095378 - Non-opioid analgesic adverse reaction OMOP:4095415 - Injury of oropharynx OMOP:4095457 - Failed attempted termination of pregnancy with laceration of cervix OMOP:4095464 - Kidd antigen type OMOP:4095576 - Malignant neoplasm of scapula and long bones of upper arm OMOP:4095655 - Nortriptyline adverse reaction OMOP:4095674 - Dichloralphenazone adverse reaction OMOP:4095828 - Neostigmine adverse reaction OMOP:4095928 - Cervical excitation OMOP:4095933 - Anteflexed uterus OMOP:4095968 - Dithranol cream adverse reaction OMOP:4095996 - Contusion of sacral cord OMOP:4096009 - Injury of retina OMOP:4096015 - Fragmentation of salivary gland OMOP:4096065 - Shape of sacrosciatic notch OMOP:4096082 - Alpha-1-antitrypsin phenotype PiMM OMOP:4096108 - Paraffin-yellow soft adverse reaction OMOP:4096125 - Disinfectants and cleansers adverse reaction OMOP:4096130 - Intentional chlorothiazide poisoning OMOP:4096182 - Non-dominant side OMOP:4096258 - Effacement of cervix OMOP:4096318 - Impact bruising OMOP:4096387 - Lie of fetus OMOP:4096426 - Mitoxantrone adverse reaction OMOP:4096479 - Traumatic amputation OMOP:4096536 - Scrotum finding OMOP:4096625 - Injury of vertebral artery OMOP:4096671 - Malnutrition-related diabetes mellitus with peripheral circulatory complications OMOP:4096701 - Supraglottic ulcer OMOP:4096713 - Food comes down nose OMOP:4096759 - Cefpirome adverse reaction OMOP:4096793 - Sawdust liver OMOP:4096845 - Gnathagnus egregius OMOP:4096857 - Constipation alternates with diarrhea OMOP:4096864 - Abdominal organ finding OMOP:4096876 - Atovaquone adverse reaction OMOP:4096924 - Cat eye syndrome OMOP:4096991 - Short thorax OMOP:4097013 - Absent bone in hand OMOP:4097065 - Bacterial colony surface appearance OMOP:4097118 - Benign neoplasm of aryepiglottic fold OMOP:4097157 - Difficulty straightening up OMOP:4097183 - Bulk-forming laxative adverse reaction OMOP:4097190 - Ketamine adverse reaction OMOP:4097213 - Congenital tracheocele OMOP:4097220 - Brassica napus poisoning OMOP:4097241 - Blood group antibody Kaj OMOP:4097244 - Leishmania mexicana enriettii OMOP:4097268 - Lipoma of groin OMOP:4097301 - Cryptogenic sexual precocity OMOP:4097376 - Mimosa pudica poisoning OMOP:4097447 - Muscle tension OMOP:4097489 - Sodium valproate adverse reaction OMOP:4097505 - Clozapine adverse reaction OMOP:4097509 - Chlorpromazine adverse reaction OMOP:4097541 - Chemical burn OMOP:4097599 - Howell Jolly bodies OMOP:4097604 - Acanthocytosis OMOP:4097696 - Salmonella Welikade OMOP:4097752 - Pus cells present OMOP:4097770 - Lecithin detected in amniotic fluid OMOP:4097782 - Pheniramine adverse reaction OMOP:4097937 - Rimiterol adverse reaction OMOP:4098017 - Primary cold-type hemolytic anemia OMOP:4098109 - Bulinus (Bulinus) coulboisi OMOP:4098143 - Fritillaria OMOP:4098185 - Phagocytosis/opsonization test OMOP:4098188 - Epstein-Barr virus B-lymphocyte stimulation OMOP:4098265 - Audito-oculogyric reflex OMOP:4098269 - Blood group antigen Schwend OMOP:4098412 - Decreased capillary filling time OMOP:4098563 - Ameloblastic fibrosarcoma OMOP:4098568 - Corynebacterium xerosis OMOP:4098576 - Closed pneumothorax OMOP:4098626 - Lymphocyte function antigen-1 defect OMOP:4098674 - Diloxanide adverse reaction OMOP:4098715 - Lithium isotope OMOP:4098753 - Primary warm-type hemolytic anemia OMOP:4098838 - Dihydrocodeine adverse reaction OMOP:4098851 - Habitual friction injury of tooth OMOP:4099028 - Corynosoma wegeneri OMOP:4099030 - Patient referral for evaluation, aging problem OMOP:4099127 - Trimethoprim adverse reaction OMOP:4099132 - Procaine benzylpenicillin adverse reaction OMOP:4099135 - Carbenicillin adverse reaction OMOP:4099142 - Latamoxef adverse reaction OMOP:4099144 - Cefuroxime adverse reaction OMOP:4099176 - Toothache OMOP:4099177 - Mugil curema OMOP:4099184 - Chronic ischemic colitis OMOP:4099250 - Transient pattern electroretinography OMOP:4099265 - Tinidazole adverse reaction OMOP:4099336 - Autoimmune parathyroiditis OMOP:4099340 - Idiopathic Cushing's syndrome OMOP:4099409 - Iproniazid adverse reaction OMOP:4099520 - Motor terminal latency OMOP:4099544 - Provocative outflow facility test OMOP:4099558 - Dornase alfa adverse reaction OMOP:4099563 - Astemizole adverse reaction OMOP:4099579 - Coal tar bath preparations adverse reaction OMOP:4099582 - Collodion adverse reaction OMOP:4099592 - Hydrogen ion concentration OMOP:4099593 - Infection by Sarcocystis lindemanni OMOP:4099697 - Malignant endocrine tumor morphology OMOP:4099736 - Nystatin adverse reaction OMOP:4099753 - Blood group antigen Geslin OMOP:4099778 - Unifocal premature ventricular complexes OMOP:4099833 - Hydrocephalus associated with late onset aqueduct stenosis OMOP:4099843 - Cerebral arachnoid cyst OMOP:4099856 - Triazole antifungals adverse reaction OMOP:4099861 - Interferon-A-2a adverse reaction OMOP:4099974 - Completed stroke OMOP:4100126 - Anomalous insertion of right superior vena cava to left atrium OMOP:4100157 - Thiouracil antithyroid agent adverse reaction OMOP:4100233 - Cerebral degeneration due to Creutzfeldt-Jakob disease OMOP:4100240 - Drug-induced eosinophilia OMOP:4100296 - Barlow test positive OMOP:4100315 - Posterior drawer test negative OMOP:4100347 - Apogon leptocaulus OMOP:4100464 - Weakness of toe OMOP:4100517 - Glue sniffing dependence, episodic OMOP:4100546 - Malignant myomatous tumor OMOP:4100708 - Sacral dysgenesis OMOP:4100710 - Chronic diarrhea of infants AND/OR young children OMOP:4100792 - Naja melanoleuca OMOP:4100796 - Pyloric atresia OMOP:4100863 - Coronary sinus defect in left atrium OMOP:4100874 - Sinus venosus defect with overriding inferior vena cava OMOP:4100892 - Vertical orbital dystopia OMOP:4100899 - Impaired joint position sense OMOP:4100933 - Bony swelling of knee joint OMOP:4100998 - Aplastic anemia caused by toxic cause OMOP:4101035 - Tricuspid annulus hypoplasia OMOP:4101179 - Right atrioventricular valve stenosis OMOP:4101183 - Congenital abnormality of right atrioventricular valve papillary muscle OMOP:4101184 - Abnormality of left atrioventricular valve in double inlet ventricle OMOP:4101293 - Disorder of glutamine metabolism OMOP:4101318 - Two chambered right ventricle OMOP:4101323 - Primary endocardial fibroelastosis of left ventricle OMOP:4101327 - Perimembranous ventricular septal defect with extension to all right ventricular components OMOP:4101330 - Doubly committed subarterial ventricular septal defect with membranous septum extension OMOP:4101367 - Bandy legged OMOP:4101468 - Gastroenteritis OMOP:4101492 - Common atrioventricular valve chordae too long OMOP:4101498 - Finding of patella structure OMOP:4101508 - Long foot OMOP:4101561 - Mesenteric cyst OMOP:4101597 - Acquired factor II deficiency OMOP:4101611 - Congenital absence of right atrioventricular valve papillary muscle OMOP:4101639 - Flexion deformity of toe OMOP:4101641 - Finding of joint of toe OMOP:4101720 - Myxedema cerebellar degeneration OMOP:4101736 - Hypotonic cerebral palsy OMOP:4101776 - Xiphinema OMOP:4101812 - Horizontal doll's head reflex equivocal OMOP:4101829 - Finding of orgasm OMOP:4101891 - Polyneuropathy in polyarteritis nodosa OMOP:4101928 - Tetrachlorodibenzodioxin poisoning OMOP:4101940 - Cardiac dyskinesia OMOP:4101950 - Ability to perform traveling activities OMOP:4101962 - Difficulty crossing the road OMOP:4102118 - Swelling of respiratory structure OMOP:4102121 - Swelling of body region OMOP:4102124 - Carotid atherosclerosis OMOP:4102127 - Septic finger OMOP:4102170 - Salmonella Lome OMOP:4102208 - Cerebral degeneration due to neoplastic disease OMOP:4102262 - Normal passive range of hip internal rotation OMOP:4102285 - Severe koilocytotic atypia OMOP:4102308 - Visceromegaly OMOP:4102334 - Myelopathy due to spondylosis OMOP:4102344 - Tonic epileptic seizure OMOP:4102402 - Frontoethmoidal encephalocele OMOP:4102429 - Foot joints synovial swelling OMOP:4102434 - Normal passive range of midtarsal supination OMOP:4102620 - Ascher's syndrome OMOP:4102654 - Hereditary retinal dystrophies in lipidoses OMOP:4102794 - Antiribosomal antibody OMOP:4102850 - Gastrojejunocolic fistula OMOP:4102857 - Dilatation of tricuspid annulus OMOP:4102888 - Pink tympanic membrane OMOP:4102913 - Poisoning by actinomycin OMOP:4102951 - Lymphocyte antigen CDw65 OMOP:4102973 - Postviral depression OMOP:4103011 - Chronic upper gastrointestinal hemorrhage OMOP:4103108 - Post paratyphoid vaccination encephalitis OMOP:4103126 - Depressive disorder caused by drug OMOP:4103167 - Pagets disease - hip OMOP:4103195 - Atrial septal defect murmur OMOP:4103318 - Normal venous return in limb vein OMOP:4103335 - Expiratory partial airway obstruction OMOP:4103484 - Tenderness of ear structure OMOP:4103552 - Psychogenic cyclical vomiting OMOP:4103590 - Dock pollen OMOP:4103647 - Malignant frozen pelvis OMOP:4103658 - Foot preference right OMOP:4103780 - Grass and cereal seed mixture OMOP:4103814 - Ankle reflex brisk OMOP:4103853 - Sedative, hypnotic AND/OR anxiolytic-induced mood disorder OMOP:4103877 - Infection by Nosema apis OMOP:4103893 - Filarial infection of conjunctiva OMOP:4103926 - Isolated cystinuria OMOP:4103978 - Tooth problem OMOP:4103983 - Finding of appearance of gingivae OMOP:4104060 - Chronic otitis externa due to moniliasis OMOP:4104144 - Normal abdominal contour OMOP:4104175 - Venous anomaly of umbilical cord OMOP:4104290 - Aluminum hydroxide absorbed plasma OMOP:4104308 - Genitourinary tract problem OMOP:4104381 - Delayed rod or cone adaption OMOP:4104487 - Weakness of foot OMOP:4104494 - Decreased active range of midtarsal pronation OMOP:4104621 - Dandelion pollen OMOP:4104803 - Psoralea tenuiflora OMOP:4104822 - Naematoloma fasciculare OMOP:4104837 - Myelopathy due to acute infarction of spinal cord OMOP:4105005 - Multiple cranial nerve palsies in sarcoidosis OMOP:4105016 - Acute painful diabetic neuropathy OMOP:4105020 - Serum neuropathy OMOP:4105088 - Hypernasality syndrome OMOP:4105166 - Salmonella Reubeuss OMOP:4105178 - Cystoid macular edema OMOP:4105277 - Glass in perineum OMOP:4105385 - Mechanisms OMOP:4105454 - Does roll on to side OMOP:4105587 - Atony of colon OMOP:4105610 - Journalist OMOP:4105717 - Ability to rise from squatting OMOP:4105836 - A*1101 OMOP:4105843 - B*4004 OMOP:4105886 - Adverse reaction OMOP:4105985 - DQB1*03031 OMOP:4106184 - Fracture of spinous process of lumbar vertebra OMOP:4106287 - Athanasia trifurcata poisoning OMOP:4106341 - Ability to turn head OMOP:4106417 - Hyperpnea OMOP:4106457 - External drainage OMOP:4106495 - Scratch of pelvic region OMOP:4106641 - Treadmill level achieved OMOP:4106686 - Scratch of upper limb OMOP:4106807 - DPB1*0402 OMOP:4107030 - Able to walk up hill OMOP:4107070 - Sensory deprivation isolation OMOP:4107213 - Hemorrhage of thyroid OMOP:4107245 - Oryx gazella OMOP:4107277 - Hematoma of tunica vaginalis OMOP:4107335 - Avulsion of pancreas OMOP:4107369 - Aedes normanensis OMOP:4107541 - Neonatal cystine-lysinuria OMOP:4107794 - Difficulty standing up alone OMOP:4107844 - Able to sit up OMOP:4107855 - Ability to turn body OMOP:4107862 - Cruelty towards people OMOP:4107887 - Nostocales OMOP:4108020 - Ability to perform personal hygiene activity OMOP:4108053 - Ability to apply own make-up OMOP:4108197 - Does put on footwear OMOP:4108202 - Able to do up clothes fastenings OMOP:4108381 - Embolism and thrombosis of the axillary artery OMOP:4108483 - Ability to use tripod grip OMOP:4108494 - Able to put one object inside another OMOP:4108497 - Does place one object on top of another OMOP:4108762 - Traumatic blister of ankle OMOP:4108767 - Metal foreign body in palm of hand OMOP:4108814 - Pericardial effusion - noninflammatory OMOP:4108850 - Onychogalea OMOP:4108925 - Akathisia OMOP:4109022 - Autosomal dominant polycystic kidney disease in childhood OMOP:4109024 - Congenital ureteric valves OMOP:4109043 - Cleft hard palate, bilateral OMOP:4109083 - Right sided chest pain OMOP:4109177 - Trichorhinophalangeal dysplasia type I OMOP:4109186 - Osteopathia striata with cranial sclerosis OMOP:4109187 - Worth disease OMOP:4109189 - Oculodento-osseous dysplasia - mild type OMOP:4109193 - Osteoglophonic dysplasia OMOP:4109212 - Does not retract tongue OMOP:4109219 - Difficulty elevating soft palate OMOP:4109231 - Latrodectus variolus OMOP:4109368 - Emotionally deprived OMOP:4109371 - Finding relating to reinforcement of behavior OMOP:4109383 - Tongue chewing OMOP:4109463 - Diffuse supravalvar aortic stenosis OMOP:4109478 - Collaterals to pulmonary arteries OMOP:4109504 - Incoherent speech OMOP:4109519 - Stabbing other person OMOP:4109617 - Congenital redundant rectal mucosa OMOP:4109678 - Pitting edema OMOP:4109729 - Constant vertical heterotropia OMOP:4109850 - Pulling out sutures OMOP:4109861 - Able to sit in bath OMOP:4109893 - Acute phlegmonous pharyngitis OMOP:4109896 - Acute ulcerative tonsillitis OMOP:4110000 - Ability to use toilet OMOP:4110109 - Localized dystrophic epidermolysis bullosa OMOP:4110200 - Radial artery aneurysm OMOP:4110311 - Does use kettle OMOP:4110484 - Acute respiratory syncytial virus bronchitis OMOP:4110565 - Malignant tumor of suprahyoid epiglottis OMOP:4110568 - Carcinoma of thoracic part of esophagus OMOP:4110624 - Does clean self after toilet OMOP:4110632 - Able to adjust clothing OMOP:4110649 - Alternating exotropia with X pattern OMOP:4110676 - Phlebitis of intracranial venous sinus OMOP:4110725 - Superficial spreading malignant melanoma of skin OMOP:4110729 - Proliferative fasciitis OMOP:4110751 - Difficulty managing appliance when undressing OMOP:4110864 - Serous papillary cystadenoma of ovary OMOP:4110874 - Vaginal intraepithelial neoplasia OMOP:4110903 - Unable to remember month of year OMOP:4110959 - Acquired atrioventricular fistula of heart OMOP:4110977 - Salmonella Korlebu OMOP:4111042 - Does not manage appliance when dressing and undressing OMOP:4111046 - Ability to manage medication OMOP:4111114 - Non-suppurative otitis media with eustachian tube disorder OMOP:4111207 - Mental function OMOP:4111216 - Plans to rape OMOP:4111254 - Central positional nystagmus OMOP:4111326 - Osteopetrosis with renal tubular acidosis OMOP:4111337 - Ichthyosis bullosa of Siemens OMOP:4111384 - Difficulty using scissor grip OMOP:4111475 - Segmental neurofibromatosis OMOP:4111504 - Ability to grip using supination of wrist OMOP:4111552 - Re-entry ventricular arrhythmia OMOP:4111570 - Partial atrioventricular block OMOP:4111649 - Malignant tumor of tip of tongue OMOP:4111651 - Benign tumor of tip of tongue OMOP:4111652 - Tumor of glossoepiglottic fold OMOP:4111654 - Carcinoma of anterior part of floor of mouth OMOP:4111678 - Does clean windows OMOP:4111711 - Cerebellar stroke syndrome OMOP:4111789 - Tumor of opening of auditory tube OMOP:4111790 - Tumor of posterior tonsillar pillar OMOP:4111799 - Carcinoma of cervical part of esophagus OMOP:4111805 - Squamous cell carcinoma of bronchus OMOP:4111937 - Ulcerative balanoposthitis OMOP:4111965 - Ability to find words OMOP:4111984 - Difficulty preparing meal OMOP:4111990 - Does follow recipe OMOP:4112020 - Carotid artery syndrome hemispheric OMOP:4112022 - Left sided cerebral hemisphere cerebrovascular accident OMOP:4112096 - Pulmonary atresia with confluent pulmonary arteries OMOP:4112143 - Carcinoma of anal canal OMOP:4112182 - Anal skin tag OMOP:4112290 - Multiple stab wounds OMOP:4112357 - Acute purulent bronchitis OMOP:4112498 - Chronic membranous rhinitis OMOP:4112605 - Carcinoma of upper third of esophagus OMOP:4112671 - Post-infective bronchiectasis OMOP:4112730 - Malignant tumor of anorectal junction OMOP:4112746 - Keratoacanthoma OMOP:4112747 - Pseudoepitheliomatous hyperplasia OMOP:4112767 - Multiple piloleiomyoma OMOP:4112768 - Cobb's syndrome OMOP:4112800 - Position agnosia OMOP:4112809 - Aspiration pneumonitis due to and following anesthesia during labor and delivery OMOP:4112870 - Cutaneous glanders OMOP:4112877 - Regressed malignant testicular tumor OMOP:4112903 - Does not use clothes drying equipment OMOP:4112907 - Unable to empty bath OMOP:4112942 - Menopausal concentration lack OMOP:4112966 - Somatotroph adenoma OMOP:4112975 - Adenocarcinoma of lacrimal gland OMOP:4113101 - Toe joint - cool OMOP:4113102 - Amputated at hip OMOP:4113123 - Benign neoplasm of ileocecal valve OMOP:4113124 - Benign neoplasm of bone structure of spine OMOP:4113144 - Kingdom Protozoa schizont OMOP:4113208 - Primary pituitary - hypothalamic infertility OMOP:4113222 - Asymmetry of pelvis OMOP:4113400 - Vesicles on tympanic membrane OMOP:4113415 - Stills in response to sound OMOP:4113417 - No response to high frequency sounds OMOP:4113454 - Urachal diverticulum OMOP:4113539 - Finding of measures of salivary tract OMOP:4113568 - Abdominal skin scar OMOP:4113620 - Grandiose character OMOP:4113701 - Finding of urinary bladder neck competence OMOP:4113767 - Ziehl-Neelsen stain OMOP:4113813 - Fontaria virginiensis OMOP:4113855 - Does not budget OMOP:4114011 - Subclavian artery stenosis OMOP:4114038 - Disharmony with partner OMOP:4114161 - Tricuspid valve normal OMOP:4114191 - Embryonal tumor of brain OMOP:4114197 - Tumor of hypothalamus OMOP:4114223 - Benign tumor of head and neck OMOP:4114300 - Named sensory sign OMOP:4114340 - Kaposi's sarcoma of conjunctiva OMOP:4114352 - Benign papilloma of larynx OMOP:4114481 - Finding of sensation of tooth OMOP:4114561 - Does not use vocal tunes and phonetic units OMOP:4114625 - Finding of hearing aid OMOP:4114655 - Lower segment OMOP:4114727 - Difficulty speaking at normal rate OMOP:4114853 - Inherited cutis laxa OMOP:4114896 - Able to recognize sounds OMOP:4114974 - Triploidy and polyploidy OMOP:4115027 - Squamous cell carcinoma of skin of upper lip OMOP:4115084 - Difficulty riding and propelling toy OMOP:4115193 - Recurrent dislocation of inferior radioulnar joint OMOP:4115213 - Glenoid labrum tear OMOP:4115224 - Complement component C4 OMOP:4115251 - Nasopharynx normal OMOP:4115275 - Papilloma of bronchus OMOP:4115360 - Villonodular synovitis of elbow OMOP:4115394 - Hand present OMOP:4115459 - Posterior to epiglottis OMOP:4115512 - Unable to clean room OMOP:4115556 - Able to perform educational activities OMOP:4115656 - Does use vocal tunes and phonetic units OMOP:4115787 - Unable to use blended sounds OMOP:4115796 - Unable to use language OMOP:4115807 - Difficulty speaking intelligibly OMOP:4115949 - Ability to mix food ingredients OMOP:4115962 - Depth of periodontal pocket OMOP:4115982 - Does prepare food for eating OMOP:4116022 - Does use telephone OMOP:4116071 - Carcinoma of breast OMOP:4116109 - Unable to carry prepared food OMOP:4116180 - Salmonella II 1,13,23:g,m,s,t:z42 OMOP:4116212 - Corticotroph adenoma OMOP:4116240 - Carcinoma of cecum OMOP:4116251 - Phobic avoidance - mental defense mechanism OMOP:4116341 - Malignant lymphoma, convoluted cell type OMOP:4116648 - Finding of jugular venous pulse OMOP:4116683 - Beech pollen OMOP:4116741 - Ability to turn taps off OMOP:4116743 - Difficulty turning taps on OMOP:4116779 - Difficulty to clear sputum OMOP:4116879 - Use of language OMOP:4116948 - Tenderness of lymphoreticular structure OMOP:4116985 - Vulnerable personality OMOP:4117093 - Transient arthropathy of first metatarsophalangeal joint OMOP:4117245 - Pathological dislocation of midtarsal joint OMOP:4117249 - Habitual subluxation of the shoulder OMOP:4117253 - Recurrent dislocation of interphalangeal joint OMOP:4117261 - Dorsalis pulse present OMOP:4117291 - Dressed - appearance OMOP:4117379 - Over-anxious character OMOP:4117390 - External rotation contracture of hip OMOP:4117549 - Carpal instability with dorsal intercalated segment instability OMOP:4117559 - Adduction contracture-shoulder OMOP:4117727 - Distal interphalangeal joint of finger pain OMOP:4117778 - Does perform educational activities OMOP:4117940 - Milk-free diet OMOP:4117966 - Valgus angulation OMOP:4118013 - Rupture of synovium - ankle/foot OMOP:4118149 - Acquired megacolon in child OMOP:4118225 - Castleman disease OMOP:4118265 - Body odor finding OMOP:4118405 - Acephalogaster OMOP:4118460 - Functional modification OMOP:4118522 - Unable to clean washbasin OMOP:4118694 - Able to articulate clearly OMOP:4118698 - Unable to use consonant vowel combination OMOP:4118704 - Does not produce appropriate voice quality OMOP:4118964 - Salmonella Cardiff OMOP:4119019 - Normothermia OMOP:4119067 - Does steer OMOP:4119070 - Ability to throw objects OMOP:4119136 - Septic thrombophlebitis of sagittal sinus OMOP:4119152 - Congenital absence of multiple toes OMOP:4119169 - Cecal hematoma OMOP:4119221 - Able to perform writing activities OMOP:4119271 - Anopheles umbrosus OMOP:4119278 - Accipiter gentilis OMOP:4119444 - Subacute berylliosis OMOP:4119766 - Venous puncture OMOP:4119788 - Toxic pulmonary edema OMOP:4119824 - Fibrosis of appendix OMOP:4120016 - Protein profiling OMOP:4120225 - Unable to speak at normal rate OMOP:4120241 - Ability to prepare feed OMOP:4120243 - Difficulty preparing drink OMOP:4120247 - Does not maintain correct food temperature OMOP:4120251 - Hen's egg OMOP:4120262 - Cryptogenic pulmonary eosinophilia OMOP:4120266 - Sewage workers' lung OMOP:4120275 - Drug-induced hypotension OMOP:4120307 - Extra-adrenal paraganglioma OMOP:4120415 - Predisposed to startle OMOP:4120463 - Off-road land motor vehicle in collision with fixed object OMOP:4120510 - B*1504 OMOP:4120560 - DRB1*1404 OMOP:4120616 - Glycoprotein Ia defect OMOP:4120625 - Torsion of spleen OMOP:4120753 - Unable to use non-verbal communication OMOP:4120759 - Able to use grammatical constructions OMOP:4120766 - Does not use automatic language OMOP:4120802 - Spongy venous malformation OMOP:4120855 - Linalool OMOP:4120902 - Ability to presuppose in conversation OMOP:4120913 - Able to respond to communication by others OMOP:4121074 - Does retain food in mouth OMOP:4121090 - Ability to suck OMOP:4121123 - Hemophagocytic lymphohistiocytosis OMOP:4121205 - Grade A OMOP:4121278 - Immunoglobulin heavy chain deficiency OMOP:4121282 - Immunoglobulin G4 deficiency OMOP:4121286 - Leukocyte glucose-6-phosphate dehydrogenase deficiency OMOP:4121323 - Forced alkaline diuresis OMOP:4121465 - Acute Q wave infarction - inferolateral OMOP:4121498 - Able to use arithmetic reasoning OMOP:4121589 - Varicose ulcer and inflammation OMOP:4121635 - Arterial hemorrhage OMOP:4121643 - Vibration white finger OMOP:4121680 - Provision of day care OMOP:4121742 - Fine needle aspiration biopsy - action OMOP:4121931 - Tendon rupture - multiple OMOP:4122002 - Rat snake OMOP:4122120 - Periodontal and endodontic lesion OMOP:4122152 - Rhc antigen OMOP:4122156 - Terminal complement pathway factor OMOP:4122162 - Chlamydia trachomatis serotype L1 antibody OMOP:4122163 - Chlamydophila psittaci biogroup 5 antibody OMOP:4122244 - Meningococcal polysaccharide group C antibody OMOP:4122307 - Enlarged septal foramen of heart OMOP:4122578 - Finding of frequency of infant feeding OMOP:4122579 - Finding of speed of drinking OMOP:4122751 - Syphilitic oral leukoplakia OMOP:4122752 - Bilirubin pigmentation of oral mucosa OMOP:4122763 - Leakage due to cardiac device OMOP:4122904 - Ability to perform general purpose physical activities OMOP:4122924 - Anemia of renal disease OMOP:4122989 - Thermodilution technique OMOP:4123008 - Inhaling and exhaling OMOP:4123022 - Scleral stage SX OMOP:4123071 - Passovoy factor deficiency OMOP:4123093 - Benign combined immunodeficiency OMOP:4286801 - Double urethra OMOP:4123127 - Ankle joint approach OMOP:4123153 - Lung involvement stages OMOP:4123189 - Pl-12 antibody OMOP:4123237 - Complement receptor deficiency OMOP:4123282 - Discrimination between rough and smooth OMOP:4123310 - Cluster of differentiation antigen (workshop) 70 OMOP:4123377 - Does not pass things from hand to hand OMOP:4123389 - Able to cut with scissors OMOP:4123444 - Intracranial OMOP:4123458 - Ecchymosis of floor of mouth OMOP:4123525 - Does perform writing activities OMOP:4123594 - Tumor of oral cavity OMOP:4123697 - Unable to perform recreational use of conversation OMOP:4123717 - Unable to comment on events OMOP:4123731 - Drug-induced xerostomia OMOP:4123985 - Organ-specific antibody OMOP:4124097 - Under care of pediatric surgeon OMOP:4124120 - Human leukocyte antigen class I type antigen A1 - B57 OMOP:4124127 - Daltonism OMOP:4124137 - Human leukocyte antigen A allele OMOP:4124213 - Under care of genitourinary nurse OMOP:4124251 - June grass pollen OMOP:4124322 - Large labia majora OMOP:4124357 - Intrinsic staining of tooth - drug-induced OMOP:4124482 - Vagina moist OMOP:4124486 - Uterus finding OMOP:4124512 - Asymmetry of mandible OMOP:4124513 - Reduced overjet OMOP:4124551 - Lysinuric protein intolerance OMOP:4124600 - Lower true occlusal OMOP:4124620 - Via splenic vein OMOP:4124645 - Lump of cervix OMOP:4124723 - No thumb movement OMOP:4124749 - Transpubic approach OMOP:4124810 - Able to talk while playing OMOP:4124830 - Unable to communicate needs and wishes OMOP:4124832 - Pulmonary hypertension associated with chronic underventilation OMOP:4124838 - Critical upper limb ischemia OMOP:4124856 - Inferior mesenteric vein thrombosis OMOP:4124861 - Superior vena cava stenosis OMOP:4124948 - Difficulty commenting on events OMOP:4124988 - Lymph fistula OMOP:4125009 - Vascular graft aneurysm OMOP:4125039 - Helicobacter blood test finding OMOP:4125060 - Performance intelligence quotient OMOP:4125263 - Unable to eat certain food OMOP:4125434 - Unable to use fork to feed self OMOP:4125438 - Difficulty using spoon to feed self OMOP:4125493 - Vegan's anemia OMOP:4125542 - 12 o'clock position OMOP:4125563 - Left Stenver's OMOP:4125629 - Erythrocyte enzyme deficiency OMOP:4125642 - Contact factor deficiency OMOP:4125644 - Hypofibrinogenemia OMOP:4125692 - Seen by hepatobiliary surgeon OMOP:4125707 - Retroperitoneal OMOP:4126123 - Ochoa syndrome OMOP:4126131 - Very mild acute rejection of renal transplant OMOP:4126146 - Referral by surgical fitter OMOP:4126204 - Croton plant OMOP:4126247 - Normal size nipple OMOP:4126261 - No desire to push in labor OMOP:4126267 - Chronic radiation cystitis OMOP:4126314 - Relatives unwilling to allow organ donation OMOP:4126527 - Sheep wool OMOP:4126559 - Posterior fontanelle palpable vaginally OMOP:4126645 - Symbolic play test, second edition OMOP:4126735 - Finding of color of umbilical stump OMOP:4126860 - Valsalva maneuver OMOP:4126925 - Drug-induced oral lichenoid reaction OMOP:4127035 - Continues to trickle liquor OMOP:4127060 - Cervix prolapsed into vagina with straining OMOP:4127061 - Cervix visible at vaginal introitus straining OMOP:4127189 - Haemophilus influenzae type b capsular polysaccharide antibody OMOP:4127371 - Difficulty performing washing and drying of self activities OMOP:4127392 - Gonococcal tubo-ovarian abscess OMOP:4127425 - Decreased range of thumb movement OMOP:4127664 - Does talk while playing OMOP:4127670 - Unable to communicate thoughts OMOP:4127686 - Cervix prolapsed into vagina with traction OMOP:4127692 - Gravid uterus present OMOP:4127754 - Referral to general pathologist OMOP:4127766 - Referral to breast care nurse OMOP:4127848 - Finding of cellularity of cervical mucous OMOP:4127868 - Drug abuse-induced hypospermatogenesis OMOP:4127992 - Female perineum red OMOP:4127994 - Finding of duration of menstrual cycle OMOP:4128044 - Tubal fibrosis OMOP:4128059 - Classical focal segmental glomerulosclerosis OMOP:4128077 - Discharge by community-based midwife OMOP:4128083 - Nonspecific abdominal pain OMOP:4128092 - Immediate transfusion reaction OMOP:4128184 - Cervical mucous acellular OMOP:4128189 - Cervical excitation present OMOP:4128220 - Renal disorders in systemic disease OMOP:4128299 - Via endotracheal tube OMOP:4128377 - Non-obstructive hydroureter OMOP:4128491 - Breast disc palpable OMOP:4128554 - Coital disorder OMOP:4128602 - Dog dander OMOP:4128632 - 10 o'clock position OMOP:4128670 - Unable to feed self OMOP:4128765 - Neoplasm of bronchus of right lower lobe OMOP:4128782 - Segmental setting OMOP:4128842 - Maternal blood loss moderate OMOP:4128965 - Tracheobronchial OMOP:4128967 - Dautrey method OMOP:4129020 - Concealed pregnancy OMOP:4129024 - Non-viable pregnancy OMOP:4129153 - Bulge of vagina OMOP:4129156 - Passing small clots vaginally OMOP:4129234 - Neoplasm of radius OMOP:4129236 - Neoplasm of short bone of upper limb OMOP:4129313 - Flaccid uterus OMOP:4129397 - Injury of duodenum OMOP:4129401 - Injury of vas deferens OMOP:4129402 - Open wound of scapular region OMOP:4129427 - Transcleral approach OMOP:4129500 - Shave excision OMOP:4129528 - Idiopathic hyperprolactinemia OMOP:4129529 - FSH hypersecretion OMOP:4129534 - Pituitary apoplexy OMOP:4129535 - Pituitary hemorrhage OMOP:4129541 - Vaginal vault infection OMOP:4129549 - Blocked fallopian tube OMOP:4129837 - Knot in umbilical cord OMOP:4129843 - Severe postnatal psychosis OMOP:4129892 - Neoplasm of perirenal tissue OMOP:4130004 - Non-cyclical mastalgia OMOP:4130036 - Brain disorder resulting from a period of impaired oxygen delivery to the brain OMOP:4130066 - Hereditary hemoglobinopathy due to globin chain mutation OMOP:4130119 - Acorn OMOP:4130253 - Parastomal approach OMOP:4130336 - Germ cell tumor of ovary OMOP:4130340 - Uterine torsion OMOP:4130362 - Subscapular axillary lymphadenopathy OMOP:4130511 - Neoplasm of body of stomach OMOP:4130537 - Neoplasm of male breast OMOP:4130669 - Neoplasm of choroid OMOP:4130676 - Neoplasm of paraganglion OMOP:4130683 - Superficial lymphadenopathy OMOP:4130733 - 100 hue technique OMOP:4130979 - Neoplasm of inner aspect of lower lip OMOP:4131013 - Neoplasm of clitoris OMOP:4131052 - Ovarian vein syndrome OMOP:4131061 - Auxotyping OMOP:4131136 - Infraclavicular lymphadenopathy OMOP:4131139 - Lateral pericardial lymphadenopathy OMOP:4131295 - Angiofollicular lymph node hyperplasia, plasma cell type OMOP:4131324 - Crystal deposition OMOP:4131345 - 1:03 OMOP:4131439 - Neoplasm of hand OMOP:4131445 - Neoplasm of septum of nose OMOP:4131447 - Neoplasm of frontal sinus OMOP:4131483 - Type 4 hypersensitivity OMOP:4131746 - Neoplasm of pelvic peritoneum OMOP:4131812 - Polyglandular dysfunction AND/OR related disorders OMOP:4132087 - Acute disorder of female genital organ OMOP:4132088 - Acute heart disease OMOP:4132116 - Blood group antigen KREP OMOP:4132157 - Salmonella IV 48:z36,z38:- OMOP:4132307 - Latency of speech response OMOP:4132415 - Melodious laughing thrush OMOP:4132503 - Drug-induced uveitis OMOP:4132560 - Abnormal structure of physiologic substance OMOP:4132599 - Fractured maxillofacial prosthesis OMOP:4132600 - Denture surface finding OMOP:4132728 - Didelphostrongylus OMOP:4132812 - Juvenile idiopathic arthritis, persistent oligoarthritis OMOP:4133008 - Injury of head with rhinorrhagia OMOP:4133015 - Sprain of anterior cruciate ligament of knee OMOP:4133028 - Eubacterium brachy OMOP:4133326 - Facial swelling OMOP:4133578 - Inferior pancreaticoduodenal lymphadenopathy OMOP:4133587 - Colic lymphadenopathy OMOP:4133591 - Iliac lymphadenopathy OMOP:4133871 - Denture teeth show too much OMOP:4133980 - Hemolytic disorder OMOP:4133981 - Benign gestational thrombocytopenia OMOP:4134121 - Lumbar radiculopathy OMOP:4134124 - Abscess of bone of skull OMOP:4134158 - Secondary hemorrhage OMOP:4134165 - Rupture of peroneal tendon OMOP:4134188 - Fracture dislocation of finger or thumb OMOP:4134268 - Pneumovirinae OMOP:4134269 - Human parainfluenza virus 4a OMOP:4134294 - Acute inflammatory disease OMOP:4134304 - Fracture subluxation of wrist OMOP:4134326 - Fracture of proximal end of radius and ulna OMOP:4134329 - Supracondylar fracture femur OMOP:4134335 - Bimalleolar fracture of ankle OMOP:4134436 - Hereditary platelet function disorder OMOP:4134440 - Visual system disorder OMOP:4134554 - Syringe labeling error OMOP:4134782 - Warming intravenous fluid technique OMOP:4134877 - Laceration of nasopharynx OMOP:4134923 - Rupture of renal pelvis OMOP:4134932 - Injury of male genital organ OMOP:4135030 - Salmonella IIIb 60:r:z53 OMOP:4135326 - Pineoblastoma OMOP:4135350 - Limax flavus OMOP:4135421 - Body mass index 20-24 - normal OMOP:4135520 - Foraminal OMOP:4135554 - Urine alpha-aminoadipate measurement OMOP:4135599 - Pseudoarthrosis OMOP:4135617 - Poorly differentiated OMOP:4135630 - Perforation of urinary conduit OMOP:4135812 - Sebastes nigrocinctus OMOP:4135844 - Pithecellobium OMOP:4135936 - Hemorrhagic necrosis of intestine OMOP:4135948 - Barium radioisotope OMOP:4135959 - Sodium (24-Na) chloride OMOP:4136184 - Seen by acute healthcare service OMOP:4136221 - Lupus La protein antibody OMOP:4136244 - Feeling tense OMOP:4136248 - Ulceration OMOP:4136360 - Gaenslen's sign OMOP:4136449 - Infant feeding at birth OMOP:4136573 - Fracture subluxation of joint OMOP:4136611 - Under care of community-based physiotherapist OMOP:4136637 - Seen by clinical nurse specialist OMOP:4136638 - Seen by breast care nurse OMOP:4136641 - Seen by psychiatric nurse OMOP:4136683 - Paraseptal emphysema OMOP:4136717 - Fracture of shaft of radius OMOP:4136753 - Uses transdermal contraception OMOP:4136756 - Risk management administration OMOP:4136896 - Erosive gastropathy OMOP:4136902 - Esophagitis grade IV OMOP:4136920 - Activity of daily living education OMOP:4136974 - Gastric juice OMOP:4136988 - Menopausal osteoporosis OMOP:4137049 - Disability affecting daily living OMOP:4137238 - Actinoplanes philippinensis OMOP:4137243 - Discharge from family planning service OMOP:4137251 - Discharge from nuclear medicine service OMOP:4137263 - Discharge from cardiac surgery service OMOP:4137379 - Anaerobranca californiensis OMOP:4137417 - Difficulty swallowing soft foods OMOP:4137575 - Normal malleus mobility OMOP:4137599 - Toxicodendron vernix poisoning OMOP:4137692 - Limited sensory perception OMOP:4137853 - Contracture of gastrocnemius muscle due to paralysis OMOP:4137905 - Admission by ophthalmologist OMOP:4137930 - Opisthorchis noverca OMOP:4137964 - Esophagojejunal OMOP:4138008 - Philadelphia chromosome-positive acute lymphoblastic leukemia OMOP:4138151 - Subluxation of costovertebral joint OMOP:4138229 - Papillary cystadenoma OMOP:4138241 - Blood group antibody Kasamatsuo OMOP:4138261 - Soluble immune complex OMOP:4138364 - Seen by transplant surgery service OMOP:4138457 - Measles virus genotype C1 OMOP:4138507 - Referral by arts therapist OMOP:4138617 - Psychophysiologic insomnia OMOP:4138747 - Succinivibrionaceae OMOP:4138756 - Shrinking lung syndrome OMOP:4138844 - Haemonchus lawrenci OMOP:4138851 - Icelus spatula OMOP:4138855 - Dasychira OMOP:4138903 - Acute myeloid leukemia with maturation, FAB M2, in remission OMOP:4138928 - Admission by agency nurse OMOP:4138950 - Admission to orthodontics department OMOP:4138952 - Admission to ear, nose and throat department OMOP:4138956 - Wesselsbron virus OMOP:4139070 - Under care of doctor OMOP:4139084 - Under care of medical microbiologist OMOP:4139129 - Candida OMOP:4139172 - Anterior wall OMOP:4139358 - Erythroleukemia, FAB M6 in remission OMOP:4139616 - Lymphocyte antigen CD24 OMOP:4139780 - Crutch paralysis OMOP:4139807 - Brushing OMOP:4139907 - Flat chest OMOP:4140011 - Ammonifex OMOP:4140032 - Referral by health worker OMOP:4140174 - Referral to audiological scientist OMOP:4140210 - Ligustrum - privet OMOP:4140287 - Rubrobacterales OMOP:4140302 - Coriobacterineae OMOP:4140330 - Discharge by clinical hematologist OMOP:4140424 - Medical attendants/orderlies OMOP:4140452 - Actinopolyspora OMOP:4140489 - Discharge from neurology service OMOP:4140504 - Discharge from hospital orthoptics service OMOP:4140510 - Disorder of lymphatic vessel OMOP:4140542 - Human astrovirus OMOP:4140592 - Kaolin dust OMOP:4140643 - Seen by Accident and Emergency doctor OMOP:4140647 - Seen by hematologist OMOP:4140665 - Genus Clemmys OMOP:4140797 - Seen by pain management service OMOP:4140900 - Actinomycineae OMOP:4140944 - Seen by vascular surgery service OMOP:4140959 - Descurainia OMOP:4141032 - Continuous phencyclidine abuse OMOP:4141035 - Nonomuraea turkmeniaca OMOP:4141076 - Referral by occupational health physician OMOP:4141145 - Breast function OMOP:4141163 - Ileocolic OMOP:4141210 - Desulfobacterales OMOP:4141271 - Salmonella Battle OMOP:4141294 - Hemorrhagic cyst of jaw OMOP:4141335 - Hydroxylamine method OMOP:4141452 - Salmonella Birkenhead OMOP:4141454 - Recurrent major depression in partial remission OMOP:4141481 - Enteroviral vesicular stomatitis with exanthem OMOP:4141513 - Complication of prematurity OMOP:4141518 - Restrictive strabismus due to orbital fibrosis OMOP:4141544 - Obstetric co-op card status OMOP:4141545 - Forces sickness on leave certification status OMOP:4141634 - Acquired stricture of ureter OMOP:4141697 - Referral to dental surgery service OMOP:4141779 - FH: Multiple pregnancy OMOP:4141811 - Actinokineospora inagensis OMOP:4141835 - Anaerosinus OMOP:4141857 - Referral to drama therapist OMOP:4141859 - Referral to hospital-based dietitian OMOP:4141860 - Referral to social services department occupational therapist OMOP:4141875 - Discharge by clinical cytogeneticist OMOP:4141906 - Vibrio alginolyticus ss. iophagus OMOP:4141952 - Nontraumatic exertional compartment syndrome OMOP:4142125 - Actinocorallia longicatena OMOP:4142126 - Pyronemataceae OMOP:4142341 - Absence of tickle sensation OMOP:4142582 - Malignant lymphoma in remission OMOP:4142610 - Referral to hospital-based physiotherapy service OMOP:4142627 - Diaphyseal dysplasia OMOP:4142725 - Hemidystonia OMOP:4142731 - Pain radiating to right side of chest OMOP:4142755 - Referral to radiotherapist OMOP:4142757 - Referral to pain management specialist OMOP:4142773 - Referral to contact tracing nurse OMOP:4142791 - Bovine adenovirus 6 OMOP:4142857 - Number of breaks OMOP:4142875 - Solitary nodule of lung OMOP:4143060 - Pale feces OMOP:4143091 - Aqueous humor OMOP:4143102 - Dry cornea OMOP:4143127 - Referral to community-based podiatrist OMOP:4143167 - Autoimmune hemolytic anemia caused by immunoglobulin A plus complement OMOP:4143273 - Total number of sick days in last year OMOP:4143323 - Kingdom Fungi asexual spore OMOP:4143341 - Generalized glycogenosis OMOP:4143390 - Anaerofilum pentosovorans OMOP:4143443 - Discharge to nursing home OMOP:4143616 - Blood group antibody Ku OMOP:4143629 - Anemia due to mechanical damage OMOP:4143844 - Alicyclobacillus acidocaldarius rittmannii OMOP:4143893 - Rupture ulna artery OMOP:4143895 - Rhesus isoimmunization due to anti-E OMOP:4143921 - Ruptured sinus of Valsalva into right atrium OMOP:4143990 - Inspired enflurane concentration OMOP:4144029 - Retraction of ileostomy OMOP:4144066 - Holothyrus coccinella OMOP:4144256 - No follow-up arranged OMOP:4144279 - Home problems OMOP:4144286 - Single parent family, mother present OMOP:4144334 - Discharge by pediatric nurse OMOP:4144361 - Discharge from hospital physiotherapy service OMOP:4144367 - Idiosyncratic drug effect OMOP:4144407 - Gynecological history OMOP:4144482 - Discharge from trauma service OMOP:4144505 - Ability to produce voiceless sounds OMOP:4144530 - Thorium-228 OMOP:4144671 - Zebra body myopathy OMOP:4144736 - Pauljensenia hongkongensis OMOP:4144751 - Agromyces luteolus OMOP:4144780 - Place of origin OMOP:4144811 - Anemia due to zinc deficiency OMOP:4144930 - Rupture anterior tibial artery OMOP:4144940 - Congenital athetosis OMOP:4144980 - Chlorpyrifos poisoning OMOP:4145057 - Cardiac chest pain OMOP:4145074 - Hornet sting OMOP:4145093 - Purulent discharge OMOP:4145113 - Blood group antibody Lu9 OMOP:4145247 - Mail administration procedure OMOP:4145251 - Test of everyday attention - adult OMOP:4145277 - HNSHA due to pyrimidine-5'-nucleotidase deficiency OMOP:4145293 - Hoisting equipment rigger (construction) OMOP:4145318 - Outcome of delivery OMOP:4145393 - Application procedure OMOP:4145418 - Pin prick sensation of left foot normal OMOP:4145475 - Rash of secondary syphilis OMOP:4145493 - Vulval varices - non-obstetric OMOP:4145549 - MRSA infection of postoperative wound OMOP:4145670 - Refeeding syndrome OMOP:4145698 - Able to process information OMOP:4145710 - Homozygous Factor V Leiden mutation OMOP:4145717 - Common bile duct calculus OMOP:4145811 - Never been sexually active OMOP:4145856 - Drug dilution characteristic OMOP:4146106 - Surgical implantation cyst of iris OMOP:4146112 - Local conjunctival adhesions OMOP:4146181 - Chronic alcoholic hepatitis OMOP:4146364 - Glomangiomyoma OMOP:4146444 - Human herpesvirus 8 OMOP:4146461 - Closed fracture of distal fibula OMOP:4146509 - Skrjabinema ovis OMOP:4146550 - Housing/planning inspector OMOP:4146724 - Specific spelling disorder OMOP:4146735 - Poisoning by ether OMOP:4146838 - Parainfluenza virus laryngotracheobronchitis OMOP:4146839 - Frozen blood thawing and processing OMOP:4146840 - Cavernous sinus syndrome OMOP:4146898 - Electronics fitter (radio, television and radar equipment) OMOP:4147007 - Open dislocation atlanto-occipital joint OMOP:4147013 - Closed injury of urinary bladder OMOP:4147062 - Blood group antibody Kelly OMOP:4147162 - Metastatic malignant neoplasm to respiratory and digestive systems OMOP:4147213 - Proliferation OMOP:4147223 - Rupture of ventricle due to acute myocardial infarction OMOP:4147250 - Arts therapy services OMOP:4147276 - Hematoma of rectus sheath OMOP:4147317 - Cutaneous mastocytosis, adult form OMOP:4147326 - Sore throat OMOP:4147389 - Treponema OMOP:4147430 - Adams-Oliver syndrome OMOP:4147514 - Jatropha integerrima OMOP:4147600 - Megaloblastic anemia due to pancreatic insufficiency OMOP:4147660 - Postural kyphosis OMOP:4147754 - Blinking OMOP:4147963 - Immunization status screening OMOP:4148136 - Atrophia cutis senilis OMOP:4148167 - Weak C phenotype OMOP:4148236 - Pteridium esculentum OMOP:4148254 - Multilobular portal cirrhosis OMOP:4148279 - Iron measurement, liver tissue OMOP:4148288 - Poisoning by nitroglycerin OMOP:4148292 - Clear cell adenocarcinoma OMOP:4148368 - Chronic dermatitis OMOP:4148420 - Medical problems at work OMOP:4148453 - Etheostoma atripinne OMOP:4148461 - Sweat gland cyst OMOP:4148477 - Absent body position sense OMOP:4148551 - Parula warbler OMOP:4148625 - Adhesion of abdominal wall OMOP:4148659 - Community-based dietetics service OMOP:4148675 - Orthodontics service OMOP:4148759 - Astyanax mexicanus OMOP:4148775 - Arterial bruit OMOP:4148848 - Incomitant heterophoria OMOP:4148876 - Stasis dermatitis OMOP:4148905 - Mitral chordae rupture OMOP:4148923 - Amount of trapped gas, box FRC, measurement OMOP:4148938 - Chronic hypertrophic pyloric gastropathy OMOP:4149083 - Xeneretmus latifrons OMOP:4149253 - Cedecea davisae OMOP:4149277 - Secondary eosinophilia OMOP:4149378 - Shared care - consultant and GP OMOP:4149395 - Mild to moderate birth asphyxia - Apgar score 4-7 at 1 minute OMOP:4149419 - Staphylococcus aureus OMOP:4149426 - Leucaena poisoning OMOP:4149438 - Misgurnus anguillicaudatus OMOP:4149471 - Benign neoplasm of canthus OMOP:4149487 - Gunshot wound, entrance, close shot OMOP:4149516 - Simian enterovirus OMOP:4149553 - Closed dislocation C2/C3 OMOP:4149828 - Metal dust OMOP:4149844 - Tongue carcinoma OMOP:4149900 - Elaeophora OMOP:4150014 - Thiamine and niacin deficiency OMOP:4150051 - Diverticulum OMOP:4150052 - Impingement sign OMOP:4150355 - Salmonella Bessi OMOP:4150360 - Cynodon poisoning OMOP:4150446 - Tooth present OMOP:4150465 - Traumatic blister of neck OMOP:4150472 - Traumatic blister of buttock OMOP:4150476 - Traumatic blister of buttock, infected OMOP:4150486 - Traumatic blister of hip, infected OMOP:4150507 - Rear-fanged snake OMOP:4150515 - Consultation for laboratory medicine OMOP:4150830 - Bulinus (Bulinus) senegalensis OMOP:4150998 - Corneal graft vascularization OMOP:4151070 - Unable to catch OMOP:4151210 - Thermal injury of peripheral nerve OMOP:4151224 - Injury of ciliary ganglion OMOP:4151397 - Adverse reaction to antirheumatic OMOP:4151403 - Accidental submersion in bath OMOP:4151534 - Cut of pelvic region OMOP:4151542 - Stab wound of face OMOP:4151551 - Sample: direct microscopy: fungus present OMOP:4151562 - Coroner's postmortem report requested OMOP:4151601 - Born in Cuba OMOP:4151657 - Planning to move OMOP:4151675 - Puncture wound of neck OMOP:4151680 - Puncture wound of forearm OMOP:4151704 - Maternal concern OMOP:4151711 - Triple kidney with triple pelvis OMOP:4151766 - Loaded colon OMOP:4151822 - Needle stick injury of throat OMOP:4151851 - Does not reach OMOP:4151911 - Corneal melting disorder OMOP:4151917 - Epilepsy control good OMOP:4152142 - Able to catch OMOP:4152220 - Born in Libya OMOP:4152232 - Born in Papua New Guinea OMOP:4152341 - Papular eruption OMOP:4152379 - Main spoken language Tamil OMOP:4152387 - FH myocardial infarction male first degree age unknown OMOP:4152465 - Animal bite of chest OMOP:4152481 - Crush injury of eye region OMOP:4152486 - Candida inconspicua OMOP:4152488 - Impairment of registration OMOP:4152617 - Tactile memory OMOP:4152619 - Laceration of prostate OMOP:4152620 - Visual memory for faces OMOP:4152625 - Laceration of fallopian tube OMOP:4152640 - False memories OMOP:4152651 - Equipment monitoring OMOP:4152654 - Ancylostoma japonica OMOP:4152667 - Foreign body accident - eye OMOP:4152744 - Disseminated hemorrhage OMOP:4152776 - Dirofilaria striata OMOP:4152815 - Insect bite of mouth OMOP:4152836 - Goes blue OMOP:4152853 - Functional nasolacrimal duct obstruction OMOP:4152911 - Asthma causes daytime symptoms most days OMOP:4152929 - Insect bite of genitalia OMOP:4152949 - Wood splinter in hip OMOP:4152954 - Fly bite OMOP:4152967 - Laceration of perineum OMOP:4152980 - Serum lactate measurement OMOP:4152982 - Serum vitamin D measurement OMOP:4153049 - Collaborating in initiating patient controlled analgesia initiation OMOP:4153065 - Pain management education OMOP:4153066 - Laceration of shin OMOP:4153077 - Cut of back OMOP:4153103 - Visceral gout OMOP:4153227 - Cut of upper limb OMOP:4153557 - Animal bite of ear region OMOP:4153568 - Infected umbilical granuloma OMOP:4153649 - Cystic trichoblastoma OMOP:4153651 - Eosinophilic myositis OMOP:4153666 - Bone remodeling OMOP:4153721 - Needle stick injury of perineum OMOP:4153824 - Needle stick injury of lower leg OMOP:4153828 - Needle stick injury of dorsum of foot OMOP:4153837 - Human bite of forehead OMOP:4153853 - Dog bite of head and neck OMOP:4153890 - Malignant melanoma of trunk OMOP:4153904 - Gaseous element OMOP:4153969 - Animal bite of toe OMOP:4153985 - Ability to remember own age OMOP:4153987 - Ability to remember sounds OMOP:4154065 - Born in Luxembourg OMOP:4154144 - Does push and pull a large wheeled toy forwards OMOP:4154147 - Aegyptianella OMOP:4154261 - Status of venous (large vessel) invasion by tumor OMOP:4154263 - Tumor configuration OMOP:4154291 - Passive movements to the IP joints OMOP:4154314 - Finding of arrangement of fetus OMOP:4154342 - Granulocyte percent differential count OMOP:4154400 - Autopsied body OMOP:4154426 - Animal bite of upper arm OMOP:4154477 - Traumatic blister of wrist OMOP:4154559 - Patient death or serious disability associated with a medication error OMOP:4154579 - Injury of thoracic cavity OMOP:4154596 - Perineal fistula OMOP:4154771 - Chest movement unequal OMOP:4154874 - Coenurus glomeratus OMOP:4154899 - Does not move foot OMOP:4154902 - Sorbic acid OMOP:4154909 - Abnormal radiologic density OMOP:4154948 - Cardiovascular examination finding OMOP:4155033 - Laceration of lip OMOP:4155034 - Laceration of forearm OMOP:4155042 - Laceration of great toe OMOP:4155317 - Pellet wound of great toe OMOP:4155349 - Dog bite of head OMOP:4155475 - Dog bite of groin OMOP:4155647 - Anesthetic agent monitoring OMOP:4155797 - Heberden node OMOP:4155893 - Intra-abdominal movement OMOP:4156047 - Endoscopy finding OMOP:4156127 - Skin pigmentation OMOP:4156150 - Accidental nalbuphine poisoning OMOP:4156427 - Dynamic right ventricular outflow tract obstruction OMOP:4156453 - Accidental desflurane poisoning OMOP:4156456 - Accidental oxybuprocaine poisoning OMOP:4156505 - Cross-standing OMOP:4156768 - Accidental fentanyl poisoning OMOP:4156774 - Accidental felbinac poisoning OMOP:4156923 - Intentional meprobamate poisoning OMOP:4157042 - Intentional loxapine poisoning OMOP:4157159 - Torsion of the root of the mesentery OMOP:4157343 - Accidental griseofulvin poisoning OMOP:4157345 - Serous nipple discharge OMOP:4157377 - Eating disorders inventory OMOP:4157448 - Carcinoma of male breast OMOP:4157457 - Malignant neoplasm of skin of trunk OMOP:4157560 - Tests OMOP:4157677 - Small tumor OMOP:4157684 - Optic foramen projection OMOP:4157706 - Inclined standing in water away from rail OMOP:4157801 - Intentional desflurane poisoning OMOP:4157833 - Daffodil family OMOP:4157970 - Senna poisoning OMOP:4158113 - Accidental halothane poisoning OMOP:4158141 - Intentional dacarbazine poisoning OMOP:4158277 - Accidental doxorubicin poisoning OMOP:4158321 - Partially accommodative esotropia OMOP:4158416 - Infection caused by Penicillium griseofulvum OMOP:4158463 - Intentional oxytetracycline poisoning OMOP:4158464 - Intentional tetracycline poisoning OMOP:4158561 - Infection caused by Mycobacterium africanum OMOP:4158586 - Intentional cycloserine poisoning OMOP:4158706 - Intentional insulin poisoning OMOP:4158754 - Serial sevens test OMOP:4158832 - Preoperative education including family and support persons OMOP:4158883 - Wechsler intelligence verbal assessment OMOP:4159009 - Intentional succinimide poisoning OMOP:4159170 - Intentional zolpidem poisoning OMOP:4159173 - Intentional methyprylone poisoning OMOP:4159189 - Ketazolam poisoning OMOP:4159507 - Dextropropoxyphene poisoning OMOP:4159513 - Spigelian hernia OMOP:4159666 - Accidental phenindione poisoning OMOP:4159677 - Accidental quinidine poisoning OMOP:4159737 - Paraplegic cerebral palsy OMOP:4159739 - Arthritis of knee OMOP:4159779 - Accidental tetrabenazine poisoning OMOP:4159865 - Disease condition finding OMOP:4159915 - Accidental colchicine poisoning OMOP:4160056 - Hypoplasia of optic disc OMOP:4160096 - Accidental quinine poisoning OMOP:4160169 - Motor nerve conduction block - patchy OMOP:4160345 - Neoplasm of eye proper OMOP:4160422 - Erwinia toletana OMOP:4160479 - Porphyrinopathy OMOP:4160515 - Intentional vancomycin poisoning OMOP:4160529 - Cefaclor poisoning OMOP:4160568 - Streptomyces albidoflavus OMOP:4160642 - Infection caused by Mycobacterium gordonae OMOP:4160650 - Infection caused by Aspergillus sydowi OMOP:4160669 - Intentional rifampin poisoning OMOP:4160778 - Infection caused by Mycobacterium thermoresistibile OMOP:4160788 - Abnormally small cardiac chamber OMOP:4160807 - Accidental pirenzepine poisoning OMOP:4160823 - Accidental magnesium sulfate poisoning OMOP:4160850 - Halomonas boliviensis OMOP:4160855 - Pseudoalteromonas OMOP:4160966 - Accidental treosulfan poisoning OMOP:4161012 - Low grade histologic differentiation OMOP:4161014 - Date of admission OMOP:4161081 - Accidental aclarubicin poisoning OMOP:4161084 - Epirubicin poisoning OMOP:4161101 - Intentional trimethoprim poisoning OMOP:4161122 - Clostridium methoxybenzovorans OMOP:4161149 - Monodermal teratoma OMOP:4161224 - Accidental ceftazidime poisoning OMOP:4161276 - Egg white specific immunoglobulin G OMOP:4161277 - Thyroid hormone antibody OMOP:4161317 - Partially skeletonized body OMOP:4161426 - Right anterior oblique projection OMOP:4161456 - Recurrent angina following placement of coronary artery stent OMOP:4161489 - Sex hormone poisoning OMOP:4161515 - Accelerated rejection of cardiac transplant OMOP:4161539 - Lymphoma confined to mucosa AND/OR submucosa OMOP:4161599 - Sensation of floating OMOP:4161817 - Charcot-Marie-Tooth disease, type II OMOP:4161887 - Intentional flurazepam poisoning OMOP:4161952 - Borrelia burgdorferi nucleic acid assay OMOP:4162008 - Intentional risperidone poisoning OMOP:4162021 - Thioridazine poisoning OMOP:4162067 - Propionispora vibrioides OMOP:4162072 - Clavibacter michiganensis subspecies insidiosus OMOP:4162094 - Retinal thickening OMOP:4162253 - Primary malignant neoplasm of breast OMOP:4162304 - Cladosporium devriesii OMOP:4162338 - Halorubrum xinjiangense OMOP:4162346 - Methanocaldococcus fervens OMOP:4162376 - Medication error OMOP:4162406 - Salmonella group O:4 OMOP:4162434 - Infection caused by Mycobacterium tuberculosis OMOP:4162479 - Intentional pyrimethamine poisoning OMOP:4162504 - Phylum Deferribacteres OMOP:4162514 - Halorhodospira halochloris OMOP:4162600 - Intentional tobramycin poisoning OMOP:4162601 - Netilmicin poisoning OMOP:4162611 - Accidental ampicillin poisoning OMOP:4162626 - Intentional cefaclor poisoning OMOP:4162681 - Familial type 3 hyperlipoproteinemia OMOP:4162756 - Accidental ethambutol poisoning OMOP:4162820 - Salmonella IIIb 60:(k):z53 OMOP:4162890 - Thiamine preparation adverse reaction OMOP:4162892 - Sodium cellulose phosphate adverse reaction OMOP:4162897 - Ciprofibrate adverse reaction OMOP:4162918 - Gluconacetobacter sacchari OMOP:4162997 - Carcinoma of esophagus OMOP:4163034 - Chlorthalidone adverse reaction OMOP:4163229 - Phenylurea compound toxicity OMOP:4163266 - Facioscapulohumeral muscular dystrophy OMOP:4163376 - Cynodon aethiopicus OMOP:4163510 - Accidental aminocaproic acid poisoning OMOP:4163522 - Culex annulirostris OMOP:4163552 - Transitional cell tumor of borderline malignancy OMOP:4163712 - Pulmonary vein D-wave velocity time integral OMOP:4163720 - Tangential projection OMOP:4163894 - Lost to follow-up OMOP:4163978 - Indirect inhibitory potential OMOP:4164002 - Tumor invades iris OMOP:4164003 - Inflammation of ampulla of Vater OMOP:4164063 - Calcium exchange resin OMOP:4164088 - Apophysitis OMOP:4164092 - Acute cerebrovascular insufficiency OMOP:4164104 - Clomiphene adverse reaction OMOP:4164126 - Acute hyponatremia OMOP:4164189 - Para-location OMOP:4164195 - Transthoracic projection OMOP:4164248 - Guar gum adverse reaction OMOP:4164260 - Piperazine estrone sulfate adverse reaction OMOP:4164262 - Fosfestrol adverse reaction OMOP:4164263 - Desmopressin adverse reaction OMOP:4164338 - Vascularization of tumor tissue OMOP:4164386 - Oxytocin adverse reaction OMOP:4164409 - Intravenous nutrition (fats) adverse reaction OMOP:4164462 - pT category, maxillary sinus OMOP:4164554 - Enoximone adverse reaction OMOP:4164575 - Salmonella Butare OMOP:4164621 - Squamous cell carcinoma, nonkeratinizing, mixed differentiated and undifferentiated OMOP:4164627 - Allergen specific immunoglobulin A OMOP:4164638 - Visual agnosia present OMOP:4164678 - Betahistine adverse reaction OMOP:4164684 - Allergy to pethidine analog OMOP:4164709 - Furnaceman (metal reheating) OMOP:4164730 - Vasopressin deficiency OMOP:4164893 - Blood group antibody Rils OMOP:4164930 - Open wound of groin with complication OMOP:4164995 - Lincoln rehabilitation assessment OMOP:4165212 - Béclard's hernia OMOP:4165308 - Rappaport disability rating scale OMOP:4165330 - Digitoxin adverse reaction OMOP:4165356 - Yarn dyer OMOP:4165434 - Physical condition, moderate psychological component OMOP:4165514 - Blood group antibody Woit OMOP:4165570 - Fungal infection of brain OMOP:4165579 - Ruptured hemorrhagic cyst OMOP:4165688 - Harsh breath sounds OMOP:4165762 - Left side-lying with 45 degree turn onto face OMOP:4165768 - Position with tilt OMOP:4166088 - Closed traumatic subluxation, distal interphalangeal joint of finger OMOP:4166102 - Patient consent given for repeat dispensing information transfer OMOP:4166253 - Nosocomial transmission OMOP:4166268 - Bisphosphonates declined OMOP:4166357 - Salmonella Overvecht OMOP:4166581 - Rhynchosporium OMOP:4166634 - Intentional morphine overdose OMOP:4166701 - Manic bipolar I disorder in remission OMOP:4166857 - Rubinstein-Taybi syndrome OMOP:4166948 - Allergy to histamine H1 receptor antagonist OMOP:4167005 - Herpes simplex virus intranuclear inclusion body OMOP:4167014 - Cynodon dactylon poisoning OMOP:4167207 - Nocardiopsis alba OMOP:4167336 - Symptomatic sexual masochism OMOP:4167364 - Sickle cell-hemoglobin D disease with crisis OMOP:4167377 - Perioperative care consistent with individualized perioperative care plan OMOP:4167628 - Mexiletine adverse reaction OMOP:4167669 - Respiratory crackles OMOP:4167729 - Phoma minutella OMOP:4167811 - Salmonella Narashino OMOP:4167927 - Submeatal urethral stricture OMOP:4168065 - Perforating wound of eyelid OMOP:4168286 - Anemia due to starvation OMOP:4168293 - Coarse hair OMOP:4168416 - Aclarubicin overdose OMOP:4168445 - Miscarriage with postoperative shock OMOP:4168452 - Scolecobasidium humicola OMOP:4168682 - Strange and inexplicable behavior OMOP:4169098 - Specimen satisfactory for diagnosis OMOP:4169136 - Verbalizes routine for medication administration OMOP:4169240 - Bullosis diabeticorum OMOP:4169260 - Asceticism OMOP:4169439 - Renal bruit OMOP:4169445 - Lentiglobus OMOP:4169571 - Senecio poisoning OMOP:4169597 - Polymorphic amyloid degeneration of cornea OMOP:4169631 - Loading machinery accident in water transport OMOP:4169670 - Mistress taken OMOP:4169809 - Pyloric mass OMOP:4169878 - Tranylcypromine overdose OMOP:4169949 - Jump from burning structure OMOP:4170042 - Blood group antigen Ritter OMOP:4170059 - Trypanosoma vivax OMOP:4170092 - Nuclear lens fragment in anterior chamber OMOP:4170119 - Mechanical complication of suprapubic catheter OMOP:4170127 - Perianal dermatitis OMOP:4170172 - Intentional meprobamate overdose OMOP:4170253 - Baltimore oriole OMOP:4170255 - Urinary bladder function OMOP:4170297 - Sniffles OMOP:4170466 - Carcinoma in situ tongue base - dorsal surface OMOP:4170525 - Boselaphus tragocamelus OMOP:4170687 - Heroin overdose OMOP:4170918 - Transport delay OMOP:4170991 - Overdose of histamine H2-receptor antagonists OMOP:4171022 - Rieger syndrome OMOP:4171036 - Immature cervix OMOP:4171119 - Hemorrhagic pulmonary edema OMOP:4171154 - Accidental isoflurane overdose OMOP:4171344 - Adenocarcinoma in situ in villous adenoma OMOP:4171447 - Looks after someone OMOP:4171549 - Nodular goiter OMOP:4171582 - Giving up work OMOP:4171835 - Congenital atresia of cardiac vein OMOP:4171836 - Leptosphaeria senegalensis OMOP:4171975 - Congenital malrotation OMOP:4172008 - Cyclic thrombocytopenia OMOP:4172009 - HIV infection with infectious mononucleosis-like syndrome OMOP:4172049 - Ornithonyssus bursa OMOP:4172057 - Knee reflex absent OMOP:4172089 - Intentional flucytosine overdose OMOP:4172097 - Mefloquine overdose OMOP:4172131 - Bovine astrovirus OMOP:4172352 - Difficulty hearing high frequency sounds OMOP:4172397 - Accidental X-ray contrast media overdose OMOP:4172475 - Diplostomum phoxini OMOP:4172524 - Ventilation tube blocked OMOP:4172651 - Castellaniella denitrificans OMOP:4172664 - Assumes new role OMOP:4172695 - Lover taken OMOP:4172822 - Cardiac arrest due to cardiac disorder OMOP:4172827 - Equine adenovirus 1 OMOP:4172863 - Fetal dysrhythmia OMOP:4172870 - Gastritis of newborn OMOP:4172942 - Infection by Cysticercus fasciolaris OMOP:4173000 - Perinatal intracranial laceration OMOP:4173001 - Perinatal tentorial laceration OMOP:4173030 - Tooth plaque disclosure OMOP:4173066 - Accidental citalopram overdose OMOP:4173116 - Fracture of middle fossa OMOP:4173169 - Hydrops fetalis OMOP:4173172 - Transitory ileus of prematurity OMOP:4173174 - Chylous ascites of newborn OMOP:4173241 - Lordotic proteinuria OMOP:4173318 - Sexual value system confusion OMOP:4173319 - Alcaligenes faecalis subsp. parafaecalis OMOP:4173583 - Gray jay OMOP:4173634 - Linognathus OMOP:4173666 - Belching symptom OMOP:4173692 - Accidental chloramphenicol overdose OMOP:4173697 - Accidental ethambutol overdose OMOP:4173766 - Income insufficient to buy necessities OMOP:4173807 - Foreign body in thumb OMOP:4173833 - Intentional overdose by metformin OMOP:4173837 - Oral contraceptive overdose OMOP:4173850 - Ferrous sulfate overdose OMOP:4173852 - Iodide overdose OMOP:4173906 - Clotting factor II assay OMOP:4174036 - Infection by Basidiobolus OMOP:4174108 - Abscess of rectovesical pouch OMOP:4174160 - Intentional mitobronitol overdose OMOP:4174170 - Accidental ifosfamide overdose OMOP:4174253 - Ulcer of prostate OMOP:4174297 - Chloramphenicol-induced neutropenia OMOP:4174309 - Congenital bacterial pneumonia OMOP:4174364 - Latrodectus curacaviensis OMOP:4174384 - Uncinaria lucasi OMOP:4174406 - Infection of soft tissue of cervical spine OMOP:4174538 - Fails to recognize stages of grief OMOP:4174576 - Squamous cell hyperplasia of vulva OMOP:4174667 - Douglas fir OMOP:4174681 - First degree uterine prolapse OMOP:4174882 - Speech and language therapy education, guidance, and counseling OMOP:4174946 - Intentional salbutamol overdose OMOP:4174968 - Healed perforation of ear drum OMOP:4175005 - Bacteroides polypragmatus OMOP:4175092 - Accidental fenbufen overdose OMOP:4175095 - Intentional flurbiprofen overdose OMOP:4175129 - Infestation by Hippoboscidae OMOP:4175152 - Fibroid myocarditis OMOP:4175254 - Intentional aluminum hydroxide overdose OMOP:4175288 - Reading OMOP:4175331 - Congenital hemolytic anemia OMOP:4175341 - Linoleum maker OMOP:4175351 - Acute nonsuppurative osteitis of jaw OMOP:4175384 - Catholic religion OMOP:4175404 - Inhalational anesthetic overdose OMOP:4175438 - Cryptosporidium wrairi OMOP:4175477 - No income OMOP:4175533 - Scores OMOP:4175537 - Unsatisfactory CTG tracing OMOP:4175582 - Congenital abnormality of vein OMOP:4175597 - Vitreous liquefaction OMOP:4175635 - Non dependent drug abuse OMOP:4175658 - Californium radioisotope OMOP:4175779 - Panic disorder with agoraphobia, mild agoraphobic avoidance AND moderate panic attacks OMOP:4175786 - Recurrent painful ophthalmoplegic neuropathy OMOP:4175820 - n-1-Naphthyl-phthalamic acid OMOP:4175872 - Plexiform ameloblastoma OMOP:4175945 - Zolpidem overdose OMOP:4175950 - alpha-L-Iduronidase measurement, leukocytes OMOP:4176015 - Hypothyroidism in pregnancy OMOP:4176060 - Accidental butabarbitone overdose OMOP:4176079 - Accidental overdose by temazepam OMOP:4176120 - Inhalant dependence OMOP:4176125 - Urinalysis, acetoacetic acid-diacetic acid measurement OMOP:4176149 - Family history of malignant neoplasm of trachea OMOP:4176220 - Intentional prochlorperazine overdose OMOP:4176228 - Accidental selegiline overdose OMOP:4176268 - Failed attempted termination of pregnancy with pelvic peritonitis OMOP:4176269 - Emergency room admission OMOP:4176274 - Senile degeneration OMOP:4176422 - Fracture, intra-articular OMOP:4176442 - Be Ar 35646 virus OMOP:4176472 - Target heart rate OMOP:4176512 - Intentional chloroquine overdose OMOP:4176523 - Kanamycin overdose OMOP:4176576 - Calocera cornea OMOP:4176602 - Atherosclerotic stenosis of brachiocephalic artery OMOP:4176824 - Oxymetholone overdose OMOP:4176825 - Intentional methandriol overdose OMOP:4176829 - Accidental estrogen overdose OMOP:4176874 - Infantile melanodontia OMOP:4176903 - Aspiration into main bronchus OMOP:4176915 - Partial obstruction of airway caused by foreign body OMOP:4176937 - Hypolipoproteinemia OMOP:4176976 - Estrogen antagonist overdose OMOP:4176994 - Accidental nortriptyline overdose OMOP:4177036 - Pigment deposition OMOP:4177068 - Pseudomonas lurida OMOP:4177101 - Malignant tumor of floor of mouth OMOP:4177132 - Piracetam overdose OMOP:4177163 - Clavispora lusitaniae OMOP:4177173 - Dicentra spectabilis OMOP:4177199 - Disseminated cytomegalovirus infection OMOP:4177206 - Tubulointerstitial nephritis OMOP:4177230 - Malignant tumor of urethra OMOP:4177336 - Calcium-45 OMOP:4177351 - Infestation by beetle OMOP:4177707 - New left ventricular wall motion abnormality compared to prior study OMOP:4177769 - Accidental allopurinol overdose OMOP:4177774 - Papaverine overdose OMOP:4178099 - Intentional doxycycline overdose OMOP:4178131 - Skink OMOP:4178149 - Trypanosomal chancre OMOP:4178258 - Digoxin overdose OMOP:4178387 - Accidental urokinase overdose OMOP:4178434 - Blister of anus without infection OMOP:4178485 - Palpitations with regular rhythm OMOP:4178574 - Trichophyton mariatii OMOP:4178626 - Disorder of umbilical cord OMOP:4178772 - Invasive fungal sinusitis OMOP:4178801 - Pain relief by antacid OMOP:4178858 - Intentional caffeine overdose OMOP:4178859 - Acquired storage pool deficiency (platelets) OMOP:4178865 - Intentional nicotine overdose OMOP:4178891 - Nonvenomous insect bite of buttock with infection OMOP:4178926 - Arthropathy of lumbar facet joint OMOP:4178975 - Malignant neoplasm of cauda equina OMOP:4178976 - Malignant tumor of thyroid gland OMOP:4178979 - Malignant tumor of neck OMOP:4178997 - Gamolenic acid overdose OMOP:4179138 - Intentional erythromycin overdose OMOP:4179153 - Cervical spine laxity OMOP:4179294 - Skeletal muscle non-tender OMOP:4179295 - Gowers sign absent OMOP:4179379 - Exertional hypertension OMOP:4179439 - Active range of cervical spine flexion OMOP:4179505 - Squatina dumerili OMOP:4179537 - Open undisplaced fracture of nasal bone OMOP:4179539 - Ulcer of genital labium OMOP:4179611 - Accidental progestogen overdose OMOP:4179625 - Subglottic edema OMOP:4179642 - Ixodes drakenbergensis OMOP:4179670 - Chronic respiratory insufficiency OMOP:4179725 - Yersinia enterocolitica serogroup O:48 OMOP:4179890 - Intentional dipyridamole overdose OMOP:4179909 - Profunda femoris artery thrombosis OMOP:4180082 - Abnormal gallbladder function OMOP:4180086 - Congenital constriction of pylorus OMOP:4180143 - Chitinophaga sancti OMOP:4180278 - Diverticulosis of sigmoid colon OMOP:4180296 - Mahayana Buddhist, follower of religion OMOP:4180514 - Cephradine overdose OMOP:4180679 - Intentional nandrolone overdose OMOP:4180688 - Accidental thyroxin overdose OMOP:4180820 - Intentional bendroflumethiazide overdose OMOP:4180823 - Bumetanide overdose OMOP:4180869 - Notification of physician OMOP:4180887 - Abscess of seminal vesicle OMOP:4180906 - Malignant tumor of orbit OMOP:4180949 - Deformity of lumbar spine OMOP:4180961 - Active range of lumbar spine right lateral flexion OMOP:4181153 - Amidostomum acutum OMOP:4181156 - Patellar instability OMOP:4181296 - Segmentation of retinal blood vessel OMOP:4181346 - Malignant tumor of mastoid air cells OMOP:4181420 - Volume excess, disturbed Starling forces OMOP:4181422 - Curvularia OMOP:4181451 - Anoxia caused by high altitude OMOP:4181453 - Kashin-Beck disease of spine OMOP:4181455 - Diarrhea caused by drug OMOP:4181609 - Aquiflexum balticum OMOP:4181664 - Clinical history/examination observable OMOP:4181740 - Notropis venustus OMOP:4181816 - Primary walking reaction - finding OMOP:4181900 - Left sacrolateral position OMOP:4182032 - Finding of appearance of skeletal muscle OMOP:4182034 - Tenderness at muscle insertion OMOP:4182043 - Dysdiadochokinesis present OMOP:4182046 - Flexing motor response to command OMOP:4182165 - Finding of spinal region OMOP:4182260 - Ectopic tooth OMOP:4182332 - Unclassified 3-methylglutaconic aciduria OMOP:4182431 - Foreign body in forearm OMOP:4182522 - Wrist joint unstable OMOP:4182560 - Raillietina loeweni OMOP:4182586 - Periungual wart OMOP:4182590 - Ectromelia OMOP:4182629 - Maxillofacial prosthesis function - finding OMOP:4182693 - Centrolophus medusophagus OMOP:4182705 - Salmonella Nessziona OMOP:4182740 - Simulium callidum OMOP:4182803 - Decreased passive range of hip flexion OMOP:4182864 - Avitellina chalmersi OMOP:4182989 - Pharyngeal stage of deglutition OMOP:4183021 - Multiple sulfatase deficiency OMOP:4183040 - Posterior uveitis OMOP:4183059 - Tinea barbae caused by Microsporum canis OMOP:4183094 - Pietist religion OMOP:4183225 - Normal joint shape OMOP:4183228 - No active range of cervical spine flexion OMOP:4183256 - Increased active range of thoracic spine right lateral flexion OMOP:4183373 - Pain on movement of thoracic spine OMOP:4183464 - Haemonchus dinniki OMOP:4183477 - G1: Nuclei round, uniform, approximately 10 µ; nucleoli inconspicuous or absent OMOP:4183569 - Crotalaria dura poisoning OMOP:4183699 - Postoperative death OMOP:4183890 - Normal weight OMOP:4183894 - Fetal souffle OMOP:4183990 - Etheostoma kennicotti OMOP:4184085 - Thumb joint effusion OMOP:4184145 - Vibrio vulnificus OMOP:4184158 - Hypochlorhydria OMOP:4184202 - Blood group antigen Ull OMOP:4184235 - Past pointing absent OMOP:4184250 - Rotational deformity of bone OMOP:4184342 - Salmonella Thompson OMOP:4184411 - Passive range of thoracic spine right lateral flexion OMOP:4184438 - Sedative, hypnotic AND/OR anxiolytic intoxication delirium OMOP:4184443 - Lymphocyte antigen CD45RB OMOP:4184574 - Decreased passive range of wrist adduction OMOP:4184584 - Peritoneal cyst OMOP:4184757 - Problem of visual accommodation OMOP:4184889 - No passive range of hip extension OMOP:4184915 - Acute hydrops of gallbladder OMOP:4184989 - Azospirillum brasilense OMOP:4185016 - Foreign body in skin of chest OMOP:4185031 - Wrist joint inflamed OMOP:4185041 - Finger joint hypermobility OMOP:4185170 - Hypermobility of subtalar joint OMOP:4185224 - Uterus biforis OMOP:4185423 - Chronic osteoarthritis OMOP:4185492 - Decreased active range of lumbar spine left rotation OMOP:4185538 - Soft coal OMOP:4185547 - Cutaneous sarcoidosis OMOP:4185607 - Embolism OMOP:4185729 - Eimeria illinoisensis OMOP:4185801 - Tenderness of elbow joint OMOP:4185833 - Acute hyperkalemia OMOP:4185958 - Increased active range of finger abduction OMOP:4185963 - Increased active range of thoracic spine left lateral flexion OMOP:4186151 - Head compression test positive OMOP:4186161 - Hypertrophy of upper limb OMOP:4186245 - Mature (peripheral) T-cell neoplasm OMOP:4186280 - Gold-193 OMOP:4186314 - Long tubular intestinal duplication OMOP:4186414 - Nitrobacter vulgaris OMOP:4186463 - Exocrine pancreatic insufficiency OMOP:4186554 - Methylophilales OMOP:4186736 - Brachybacterium rhamnosum OMOP:4186901 - CyA poly level OMOP:4186926 - Blood group antibody Lee OMOP:4187242 - Nycticebus coucang OMOP:4187503 - Linognathus stenopsis OMOP:4187604 - Providing care according to standard OMOP:4187611 - Infection caused by Penicillium bacillosporum OMOP:4187637 - Acetobacter indonesiensis OMOP:4187659 - Leg length inequality OMOP:4187663 - Factor XI deficiency, type III OMOP:4187689 - Axon function OMOP:4187692 - Rhodococcus marinonascens OMOP:4187729 - Infection caused by Aspergillus terricola OMOP:4187733 - Infection caused by Mycobacterium conspicuum OMOP:4187751 - Piry virus disease OMOP:4187799 - Necator OMOP:4187907 - Facultative anaerobic bacteria OMOP:4188154 - Hemorrhagic mucosa of duodenum OMOP:4188292 - Uterus acollis OMOP:4188410 - Hypochoeris OMOP:4188455 - Blood group antibody Tm OMOP:4188465 - Ring chromosome 1 syndrome OMOP:4188480 - Congenital rubella pneumonitis OMOP:4188574 - Textiloma OMOP:4188624 - Orunga virus disease OMOP:4188639 - Definite thrombus OMOP:4188692 - Wautersia OMOP:4188702 - Yogurt specific IgE antibody measurement OMOP:4188806 - Wickerhamiella versatilis OMOP:4188889 - Pepsin specific IgE antibody measurement OMOP:4188978 - Class Actinobacteria OMOP:4189039 - Infection by Trichuris trichiura OMOP:4189197 - Granulomatous prostatitis OMOP:4189215 - Genus Zaglossus OMOP:4189246 - Genus Varecia OMOP:4189329 - Macrococcus brunensis OMOP:4189332 - Main spoken language Finnish OMOP:4189348 - Trypanosoma caprae OMOP:4189359 - Neonatal hemochromatosis OMOP:4189472 - Giemsa stain OMOP:4189529 - Obstruction due to foreign body accidentally left in operative wound AND/OR body cavity during a procedure OMOP:4189591 - Pyloric ulcer OMOP:4189640 - Neoplasm of hematopoietic cell type OMOP:4189654 - Normal Serum test findings OMOP:4189666 - Oblate cornea OMOP:4189667 - Ocular myasthenia with strabismus OMOP:4189675 - Nutritional desexing syndrome OMOP:4189701 - Genus Coleura OMOP:4189874 - Genus Lobodon OMOP:4189953 - Pleurophomopsis lignicola OMOP:4190006 - Sweet potato specific IgE antibody measurement OMOP:4190009 - Nasal and facial grimacing associated with speaking OMOP:4190074 - Peritumoral lymphocytic response finding OMOP:4190248 - Fastidious Gram Negative Rods OMOP:4190521 - Kussmaul's respiration OMOP:4190591 - Genus Mandrillus OMOP:4190642 - Plasma cell myeloma/plasmacytoma OMOP:4190712 - Mixed sensory-motor polyneuropathy OMOP:4190744 - Primary congenital glaucoma OMOP:4190752 - Pseudomonas fluorescens biovar B OMOP:4191138 - Berlin beetle specific IgE antibody measurement OMOP:4191142 - Finding of precordial pulsation OMOP:4191262 - Genus Paracrocidura OMOP:4191504 - Genus Harpionycteris OMOP:4192127 - Psychoactive substance withdrawal OMOP:4192271 - Postneonatal death OMOP:4192396 - Sardinella aurita OMOP:4192937 - Plasma troponin T measurement OMOP:4192940 - Phenylketonuria screening test OMOP:4193010 - Heart failure annual review OMOP:4193054 - Ruptured suprarenal aortic aneurysm OMOP:4193166 - Bacterial gastrointestinal infectious disease OMOP:4193175 - Fungal cardiovascular infection OMOP:4193280 - Mental health support groups staff facilitated - 1-2 contacts/week OMOP:4193285 - Psychological therapies - <1 contact/month OMOP:4193318 - Infective pharyngitis OMOP:4193357 - Blood group antibody Mitch OMOP:4193514 - HNSHA due to decreased adenosine deaminase activity OMOP:4193518 - Nonfunctioning cystic duct OMOP:4193789 - Technetium-97m OMOP:4193990 - Infection of digestive system OMOP:4194012 - Angiography technique OMOP:4194088 - Genus Plerotes OMOP:4194103 - Genus Chalinolobus OMOP:4194113 - Miscarriage with laceration of urinary bladder OMOP:4194134 - Rio Bravo virus group OMOP:4194135 - Bunyavirus serogroup Bwamba OMOP:4194269 - Hystrix cristata OMOP:4194270 - Genus Trichys OMOP:4194375 - Septic infarct OMOP:4194390 - Dilatation of esophagus OMOP:4194451 - Uterine cervix visualized OMOP:4194529 - Alpha-mannosidase measurement, fibroblasts OMOP:4194595 - Child HC = 75th centile OMOP:4194597 - Dislocation of hand joint OMOP:4194618 - Coronary artery atheroma OMOP:4194767 - Serum OMOP:4194913 - Dichloropropene OMOP:4195049 - Autosomal dominant cystoid macular edema OMOP:4195118 - Inferior vena cava syndrome OMOP:4195154 - Spastic tetraplegia with rigidity syndrome OMOP:4195197 - Plasma tyrosine measurement OMOP:4195311 - Quilonia OMOP:4195364 - Echinostoma melis OMOP:4195502 - Uveitic glaucoma OMOP:4195507 - Endometriosis of uterosacral ligament OMOP:4195557 - Malayan tree shrew OMOP:4195558 - Deposition of iron and silica OMOP:4195614 - Exclamation point hair OMOP:4195622 - Malignant endocarditis OMOP:4195627 - Chilean plantcutter OMOP:4195692 - Blood group antibody Lea OMOP:4195715 - Single home living OMOP:4195735 - Capparis OMOP:4195770 - Idiopathic polyarthritis OMOP:4195792 - Rhodococcus globerulus OMOP:4196048 - HLA-B40 antigen OMOP:4196093 - Gangrenous ergotism OMOP:4196113 - Attacks of floppiness OMOP:4196159 - Desulfovibrio dechloracetivorans OMOP:4196182 - Tadorna OMOP:4196252 - Cyclic oculomotor paralysis OMOP:4196316 - Desulfobacterium OMOP:4196384 - Allergic headache OMOP:4196431 - Recurrent cyst of breast OMOP:4196450 - Propionivibrio limicola OMOP:4196456 - Methanoculleus submarinus OMOP:4196489 - Augusticeps-type venom OMOP:4196670 - Fetal blood loss from vasa previa OMOP:4196884 - Halogeometricum OMOP:4196893 - Catellatospora OMOP:4196908 - Trypanosoma brucei rhodesiense OMOP:4197051 - Kozakia OMOP:4197074 - Extravasation of lymph OMOP:4197083 - Notoedres muris OMOP:4197271 - Disease caused by Rubivirus OMOP:4197324 - Pre-pregnancy folic acid education OMOP:4197334 - Methanosarcina siciliae OMOP:4197356 - Dethiosulfovibrio marinus OMOP:4197363 - Desulforegula OMOP:4197449 - Maximal gastric acid secretory capacity OMOP:4197496 - Leucobacter komagatae OMOP:4197539 - Chenopodium album poisoning OMOP:4197618 - Kutzneria kofuensis OMOP:4197693 - Bowiea volubilis OMOP:4197714 - Suspected prostate cancer OMOP:4197739 - Born in Albania OMOP:4197899 - Blood group antigen McKenney OMOP:4197944 - Kori bustard OMOP:4198071 - Poisoning by diiodohydroxyquin OMOP:4198086 - Diffuse spasm OMOP:4198095 - Chorioptes OMOP:4198164 - Halorhodospira neutriphila OMOP:4198167 - Caloranaerobacter azorensis OMOP:4198170 - Holospora undulata OMOP:4198209 - Exercise proteinuria OMOP:4198224 - Boreogadus saida OMOP:4198236 - Salmonella Glasgow OMOP:4198295 - Sudan stain OMOP:4198358 - Nocardia transvalensis OMOP:4198385 - Round calculus OMOP:4198435 - Local recurrence of malignant tumor of bone OMOP:4198488 - Sorangium cellulosum OMOP:4198492 - Shoulder joint unstable OMOP:4198730 - Serum alanine measurement OMOP:4198758 - Infection of total knee joint prosthesis OMOP:4198812 - No passive range of finger extension OMOP:4198911 - Methylocaldum gracile OMOP:4198982 - Panicum coloratum OMOP:4198994 - Statokinetic reflex of Magnus and de Kleijn OMOP:4199038 - Chronic central serous retinopathy with diffuse retinal pigment epithelial detachment OMOP:4199050 - Gluconobacter cerinus OMOP:4199070 - Halorubrum lacusprofundi OMOP:4199080 - Prosthecochloris vibrioformis OMOP:4199105 - Does get on to toilet OMOP:4199120 - Difficulty managing steps and stairs OMOP:4199214 - Chromatium okenii OMOP:4199549 - Able to mobilize OMOP:4199683 - Halomonas muralis OMOP:4199688 - Thermoplasmata OMOP:4199773 - Congenital atresia of glottis OMOP:4199863 - Ability to get out of a chair OMOP:4199987 - Erythrobacter longus OMOP:4200005 - Hyphomonas johnsonii OMOP:4200006 - Porphyrobacter neustonensis OMOP:4200013 - Lysobacter enzymogenes cookii OMOP:4200019 - Necrosis of bronchus OMOP:4200043 - Lesion of plica semilunaris OMOP:4200046 - Finding of size of pupil OMOP:4200140 - Catellatospora citrea methionotrophica OMOP:4200146 - Porphyrobacter tepidarius OMOP:4200306 - Family history of attention deficit hyperactivity disorder, predominantly inattentive type OMOP:4200325 - Zenker fixative OMOP:4200329 - Natrinema pellirubrum OMOP:4200371 - Does not get on and off furniture OMOP:4200399 - Zollinger-Ellison syndrome OMOP:4200413 - Oil of celery OMOP:4200471 - Dethiosulfovibrio russensis OMOP:4200484 - Mesonia algae OMOP:4200496 - Does not roll over in bed OMOP:4200497 - Unable to move up and down bed OMOP:4200638 - Herbidospora cretacea OMOP:4200642 - Burning sensation of ear OMOP:4200662 - Tuberculosis of heart OMOP:4200680 - Bockhart impetigo OMOP:4200904 - Methanotorris formicicus OMOP:4200918 - Hydrogenimonas thermophila OMOP:4200921 - Desulfobacter pvibrioformis OMOP:4200959 - Able to get on a bed OMOP:4200983 - Salmonella Tarshyne OMOP:4200995 - Macaca radiata OMOP:4201207 - Methanobrevibacter acididurans OMOP:4201220 - Clostridium saccharoperbutylacetonicum OMOP:4201288 - Platelet secretory disorder OMOP:4201423 - Wilson-Mikity syndrome OMOP:4201424 - Lythrypnus spilus OMOP:4201427 - Cutis verticis gyrata OMOP:4201519 - Selenihalanaerobacter OMOP:4201542 - Empty nest syndrome OMOP:4201627 - Aseptic meningitis due to human immunodeficiency virus infection OMOP:4201703 - Change in facial features OMOP:4201807 - Catellibacterium nectariphilum OMOP:4201808 - Cryomorpha OMOP:4201935 - Suspected upper gastrointestinal cancer OMOP:4201966 - Natroniella acetigena OMOP:4201969 - Geobacter chapellei OMOP:4202006 - Security services occupation OMOP:4202077 - Born in Bahamas OMOP:4202085 - Born in Congo OMOP:4202111 - Prochlorococcus marinus subspecies marinus OMOP:4202303 - Halomonas variabilis OMOP:4202317 - Abscess of big toe OMOP:4202322 - Amputated big toe OMOP:4202356 - Progesterone effect present OMOP:4202545 - Itching of pigmented skin lesion OMOP:4202553 - Suspected skin cancer OMOP:4202556 - Mass of parotid gland OMOP:4202670 - Serranus atrobranchus OMOP:4202726 - Streptomyces vinaceusdrappus OMOP:4202737 - Agrobacterium larrymoorei OMOP:4202767 - Gas processor OMOP:4202838 - Sales supervisor (wholesale trade) OMOP:4202851 - Hyposexuality state OMOP:4202914 - Desulfomicrobium apsheronum OMOP:4202928 - Kineosporia rhizophila OMOP:4203126 - Clothes maker OMOP:4203138 - Chrysomya rufifacies OMOP:4203227 - Pseudobutyrivibrio OMOP:4203254 - Pottery decorator OMOP:4203353 - Granulocytosis OMOP:4203410 - Seat belt exemption status OMOP:4203411 - Seat belt exemption examination status OMOP:4203519 - Peptoniphilus asaccharolyticus OMOP:4203534 - Empidonax minimus OMOP:4203720 - Machine tool setter OMOP:4203844 - Streptomyces clavuligerus OMOP:4203860 - Marinitoga OMOP:4203887 - Meeting and conference status OMOP:4203915 - Classical maple syrup urine disease OMOP:4203998 - Teredinibacter OMOP:4204280 - Halochromatium salexigens OMOP:4204295 - Mesorhizobium ciceri OMOP:4204365 - Polymorphous light eruption, papular type OMOP:4204370 - Salmonella Praha OMOP:4204396 - Charleyhorse OMOP:4204437 - Mesorhizobium huakuii OMOP:4204456 - Ensifer arboris OMOP:4204466 - Colwellia OMOP:4204488 - Reeler OMOP:4204505 - Steel worker OMOP:4204509 - Fixer - steel OMOP:4204639 - Lighterman OMOP:4204667 - Referral to ophthalmologist OMOP:4204669 - Referral to pediatric surgeon OMOP:4204694 - Myasthenia gravis, juvenile form OMOP:4204741 - Streptomyces fluorescens OMOP:4204749 - Streptomyces finlayi OMOP:4204941 - Shipwright OMOP:4205057 - Eremococcus coleocola OMOP:4205216 - Desulfatibacillum aliphaticivorans OMOP:4205293 - Eimeria anseris OMOP:4205297 - Moxostoma cervinum OMOP:4205341 - Propionispira arboris OMOP:4205393 - Lives in furnished rented flat OMOP:4205400 - Crush - wound OMOP:4205423 - 2p partial trisomy syndrome OMOP:4205437 - Submammary abscess associated with childbirth OMOP:4205441 - Isolated diffuse granulomatous myocarditis OMOP:4205488 - Measurement of hydromorphone in urine OMOP:4205637 - Vulcanisaeta OMOP:4205779 - Peritoneal dialysis therapy discontinued OMOP:4205828 - Processing accuracy OMOP:4205841 - Cognitive behavioral language therapy OMOP:4205919 - Silicibacter OMOP:4205934 - Hereditary protein S deficiency OMOP:4205946 - Halanaerobium salsuginis OMOP:4205948 - Heliobacillus mobilis OMOP:4205967 - Therapy to improve articulation placement OMOP:4206019 - Plasmodium hylobati OMOP:4206088 - Genus Mucispirillum OMOP:4206115 - Glomerulopathy due to diabetes mellitus OMOP:4206126 - Infection of big toe OMOP:4206238 - Determination of pattern of resistance to antiviral agent not done OMOP:4206372 - Mother does not smoke OMOP:4206690 - Streptomyces vastus OMOP:4206696 - Bacteremia caused by Salmonella OMOP:4206701 - Streptomyces crystallinus OMOP:4206729 - Facilitation of speech OMOP:4206732 - Syllabic speech exercises OMOP:4206769 - Anglican Church OMOP:4206794 - Heterophile antibody titer after absorption with beef cells and guinea pig kidney OMOP:4206846 - Readiness to undergo procedure OMOP:4206891 - Trichophyton schoenleinii OMOP:4206902 - Bufotenine OMOP:4206909 - Cyst of broad ligament OMOP:4207022 - Non-arthropod-borne virus OMOP:4207052 - Congenital subaortic stenosis of tunnel type OMOP:4207075 - Heterophil antibody OMOP:4207143 - Unable to attend school due to illness OMOP:4207149 - Sphingomonas faeni OMOP:4207181 - Genus Toxocara larva OMOP:4207201 - Arthroderma grubyi OMOP:4207219 - Pressure of speech OMOP:4207373 - Connochaetes gnou OMOP:4207509 - Normal carotid arterial pulse OMOP:4207606 - Complication of artificial skin graft and decellularized allodermis OMOP:4207629 - Extravasation of urine from kidney OMOP:4207679 - Procurement of patient informed consent, investigational study OMOP:4207753 - Thermoplasma volcanium OMOP:4207761 - Skermanella parooensis OMOP:4207784 - Voice hygiene procedures OMOP:4207808 - Infestation by Diptera OMOP:4207842 - Salmonella Saarbruecken OMOP:4208095 - Congenital anomaly of testis OMOP:4208175 - Surface area of ulcer OMOP:4208191 - Sporichthyaceae OMOP:4208220 - Prone on a Relton Hall frame OMOP:4208368 - Rigidity of thinking OMOP:4208385 - Deep cold injury OMOP:4208391 - Blood group antigen Binge OMOP:4208484 - Hanen program of language development OMOP:4208616 - Subtercola OMOP:4208625 - Ability to adapt after personal crisis OMOP:4208749 - Saccharococcus thermophilus OMOP:4208765 - Abrasion of skin of lower back OMOP:4208824 - Hereditary cerebral amyloid angiopathy, Dutch type OMOP:4208842 - Ground substance OMOP:4208913 - Binge eating disorder OMOP:4208933 - Thermithiobacillus OMOP:4208940 - Copper measurement, plasma OMOP:4208980 - Cellulitis of umbilicus OMOP:4209069 - Sulfurospirillum deleyianum OMOP:4209088 - Varicose vein of lower limb with phlebitis OMOP:4209206 - Dispensing - action OMOP:4209306 - Hypothermia-sweating syndrome OMOP:4209418 - Amplitude range exercises OMOP:4209439 - Lammergeier OMOP:4209440 - Cheyletiella yasguri OMOP:4209495 - Shuttleworthia satelles OMOP:4209538 - Advanced retinal disease due to diabetes mellitus OMOP:4209552 - Via cranial bone OMOP:4209688 - Scouring product OMOP:4209691 - Shoe waterproofer OMOP:4209695 - Blacking OMOP:4209843 - Disorder of thoracic aorta OMOP:4210129 - Quiescent proliferative retinopathy due to diabetes mellitus OMOP:4210159 - Salmonella Ipeko OMOP:4210272 - Episodic memory OMOP:4210307 - Collateral circulation OMOP:4210409 - Voice protection approach OMOP:4210556 - Osteoporotic collapse of lumbar vertebra OMOP:4210885 - Warehouse porter OMOP:4211010 - Secluded pupil OMOP:4211231 - Panic disorder without agoraphobia OMOP:4211355 - At increased risk for surgical fire OMOP:4211388 - Closed fracture of orbit OMOP:4211540 - Theileria tarandi OMOP:4211640 - Chadwick's sign OMOP:4211649 - Cidofovir-induced anterior uveitis OMOP:4211821 - Haemophilus infection OMOP:4212068 - Eimeria subepithelialis OMOP:4212077 - Mogibacterium OMOP:4212107 - Salmonella II 1,9,12:z29:e,n,x OMOP:4212110 - Failure of exfoliation of primary tooth OMOP:4212200 - Mental health monitoring second letter OMOP:4212239 - Holacanthus bermudensis OMOP:4212240 - Gymnocladus dioica OMOP:4212243 - Regulus goodfellowi OMOP:4212263 - Flap-footed lizard OMOP:4212450 - Eubacteriales OMOP:4212464 - Paracoccus thiocyanatus OMOP:4212588 - Strabismus due to orbital blowout fracture OMOP:4212711 - Rupture of tendon OMOP:4212819 - Antimicrobial activity OMOP:4213009 - Genus Pteropus OMOP:4213032 - Genus Rhogeessa OMOP:4213108 - Notropis lutipinnis OMOP:4213115 - Indoor soccer OMOP:4213364 - Tropheryma whipplei OMOP:4213371 - Referral for hematuria OMOP:4213372 - California encephalitis virus infection neuroinvasive disease OMOP:4213382 - Selective estrogen receptor modulator contraindicated OMOP:4213449 - Brow presentation OMOP:4213454 - Cinnabar OMOP:4213460 - Leptospirosis immune phase OMOP:4213537 - Cardiovascular disease annual review OMOP:4213680 - Subfamily Platacanthomyinae OMOP:4213785 - Referral to education service OMOP:4214114 - Family Abrocomidae OMOP:4214305 - Anterior translated sacrum OMOP:4214410 - Hispanic, black OMOP:4214441 - Familial C3B inhibitor deficiency syndrome OMOP:4214461 - Acute erosion of duodenum OMOP:4214524 - Chronic benign lymphocytic meningitis OMOP:4214576 - Significance values OMOP:4214668 - Neisseria subflava biovar perflava OMOP:4214673 - Aspergillus multiplicatus OMOP:4214704 - Forensic psychiatry OMOP:4214709 - Examination (heading) OMOP:4214795 - Klebsiella granulomatis OMOP:4214808 - Referral to epidural anesthesia service OMOP:4214946 - Trichonympha corbula OMOP:4215003 - Myasthenic crisis OMOP:4215078 - Somatic dysfunction of ilium OMOP:4215121 - Clinical genetics OMOP:4215140 - Acute coronary syndrome OMOP:4215217 - Traumatic or non-traumatic rupture of tendon OMOP:4215250 - Lower limb spasticity OMOP:4215266 - Medical specialty OMOP:4215361 - Sporotrichum pruinosum OMOP:4215362 - Trichoderma harzianum OMOP:4215463 - Aflatoxin M OMOP:4215521 - Powassan encephalitis virus infection OMOP:4215559 - Diabetic monitoring not required OMOP:4215733 - Primary hypomagnesemia OMOP:4215748 - Lathyrus odoratus OMOP:4215822 - Cellulitis of submandibular region OMOP:4215827 - Pseudeurotium bakeri OMOP:4215891 - Cephenemyia trompe OMOP:4215941 - Hypostasis OMOP:4216103 - Carcinomatous myopathic syndrome OMOP:4216118 - Paracoccus denitrificans OMOP:4216153 - General medicine OMOP:4216179 - Procedure started OMOP:4216233 - Clinostomus elongatus OMOP:4216242 - Salmonella Belem OMOP:4216256 - Poisoning by methandriol OMOP:4216311 - Phospholipid antibody screening test OMOP:4216329 - No drug side effect reported OMOP:4216349 - Gambusia rhizophorae OMOP:4216354 - Psittacinepox virus OMOP:4216363 - Tag OMOP:4216389 - Corynebacterium tenuis OMOP:4216484 - Visual perceptual weakness OMOP:4216506 - Pasteurella dagmatis OMOP:4216598 - Lipogranuloma OMOP:4216697 - Lymphocyte antigen CD22 OMOP:4216730 - Congenital contracted pelvis OMOP:4216760 - Bone marrow granulocytic hypoplasia OMOP:4216852 - Chronic allergic otitis media OMOP:4216862 - Postoperative vomiting OMOP:4217039 - African horse sickness virus OMOP:4217054 - Retinal vasculitis due to systemic lupus erythematosus OMOP:4217083 - Malignant teratoma of undescended testis OMOP:4217201 - Blood group antigen ENKT OMOP:4217228 - Creeping myiasis OMOP:4217235 - Acidimicrobiales OMOP:4217261 - Child health 7 months review OMOP:4217294 - Congenital depression in skull OMOP:4217342 - Wilson's pronator sign OMOP:4217375 - Ajellomycetaceae OMOP:4217430 - Manganese isotope OMOP:4217614 - Pedal-vehicle driver OMOP:4217661 - Interface dermatitis, vacuolar type OMOP:4217795 - Lidneria poisoning OMOP:4217811 - Mixed dust OMOP:4217834 - Technetium (99m-Tc) lidofenin OMOP:4217850 - Surgical proximal margin is closest uninvolved margin to malignant neoplasm OMOP:4217909 - Salmonella IIIb 60:r:z OMOP:4217941 - Gram-negative bacterium OMOP:4217969 - Oropouche virus disease OMOP:4217973 - Mesonephroma, benign OMOP:4217999 - Closed traumatic subluxation, proximal interphalangeal joint of digit of hand OMOP:4218093 - Ring chromosome 4 syndrome OMOP:4218252 - Dermacentor parumapertus OMOP:4218253 - Chest pain on exertion OMOP:4218281 - Traction detachment with vitreoretinal organization OMOP:4218336 - Localized keratoacanthoma OMOP:4218405 - Etheostoma smithi OMOP:4218409 - Paraclostridium bifermentans OMOP:4218425 - Chinemys reevesi OMOP:4218470 - Poisoning by tripelennamine OMOP:4218606 - Symphurus plagiusa OMOP:4218647 - Blister of axilla with infection OMOP:4218659 - Tonsillitis caused by Gram negative bacteria OMOP:4218686 - Perioperative death OMOP:4218761 - Nautichthys oculofasciatus OMOP:4218794 - Hereditary elliptocytosis due to beta spectrin defect in self-association OMOP:4218854 - Blood group antigen Pr-2 OMOP:4218965 - Babesia venatorum OMOP:4218966 - Balamuthia OMOP:4218991 - Subluxation of radial head OMOP:4219025 - Salmonella Quentin OMOP:4219057 - Blink reflex finding OMOP:4219071 - Bryozoichthys marjorius OMOP:4219093 - Gonyautoxin OMOP:4219095 - Fast violet B salt stain OMOP:4219227 - Hypersecretion of ovarian androgens OMOP:4219228 - Cable driller (oil and gas wells) OMOP:4219234 - Chewing tobacco OMOP:4219300 - Genus Bromovirus OMOP:4219328 - Infection by Rhizopus OMOP:4219359 - G-6-PD class IV variant anemia OMOP:4219370 - Hyperostosis interna frontalis OMOP:4219407 - Somatic dysfunction of sphenobasilar synchondrosis OMOP:4219465 - Salmonella Uccle OMOP:4219489 - Chlorodimethyl phenoxy ethanol OMOP:4219534 - Cryptococcal endophthalmitis OMOP:4219580 - Regional anesthesia morbidity OMOP:4219636 - Cyathostomum labiatum OMOP:4219642 - Construction carpenter OMOP:4219705 - Referral for home tube feeding instruction OMOP:4219762 - 5-Hydroxyindoleacetic acid measurement, quantitative, urine OMOP:4219765 - Leydig cell failure in adult OMOP:4219785 - Acquired nonhypertrophic constriction of pylorus OMOP:4219835 - Congenital hereditary endothelial dystrophy OMOP:4219867 - Hamartoma of skin OMOP:4219901 - Golden oriole OMOP:4219924 - Geopelia cuneata cuneata - diamond dove OMOP:4220013 - Padding of pressure points OMOP:4220157 - Anatomic motion barrier OMOP:4220185 - Craniopharyngioma OMOP:4220283 - Buttiauxella gaviniae OMOP:4220327 - Stereotypic movement disorder with self-injurious behavior OMOP:4220496 - Salmonella IIIb 61:i:z35 OMOP:4220512 - Eimeria pavonina OMOP:4220619 - Flexibacter OMOP:4220674 - Raccoonpox virus OMOP:4220843 - Extrahepatic obstructive biliary disease OMOP:4220923 - Nocardia africana OMOP:4221055 - Finegoldia magna OMOP:4221082 - Grimaces OMOP:4221124 - Eupatorium perfoliatum OMOP:4221247 - Salmonella Marienthal OMOP:4221277 - Complement factor Bb OMOP:4221287 - Previous pregnancies 10 OMOP:4221348 - Genus Tegenaria OMOP:4221379 - Increased stratum corneum adhesiveness OMOP:4221392 - Crossed leg raising sign OMOP:4221463 - Phylum Priapula OMOP:4221477 - X pattern strabismus OMOP:4221529 - Acute mastitis OMOP:4221620 - Cardiac polyp OMOP:4221622 - Prionotus scitulus OMOP:4221661 - Encephalitis caused by Langat virus OMOP:4221677 - Heredofamilial systemic amyloidosis affecting skin OMOP:4221680 - Mixed vascular malformation OMOP:4221830 - Acute-on-chronic vesicular eczema of feet OMOP:4221922 - Suborder Rhizophysaliae OMOP:4221950 - Alpha-lactalbumin specific immunoglobulin G OMOP:4222000 - Fossaria modicella OMOP:4222025 - Haemophilus paraphrohaemolyticus OMOP:4222227 - Spizella arborea OMOP:4222268 - Basal cell carcinoma of helix of ear OMOP:4222386 - Regina septemvittata OMOP:4222414 - Non-pitting edema OMOP:4222421 - Tinea capitis caused by Microsporum nanum OMOP:4222428 - Tinea corporis caused by Trichophyton yaoundei OMOP:4222599 - Primary acid taste disorder OMOP:4222748 - Immunologic urticaria OMOP:4222931 - Salmonella Gombe OMOP:4223007 - Caluromysiops irrupta OMOP:4223204 - Sequelae of meningitis OMOP:4223229 - Retrocecal hernia OMOP:4223288 - Poisoning due to bite of bark scorpion OMOP:4223289 - Order Helioporacea OMOP:4223303 - Gangrene due to type 1 diabetes mellitus OMOP:4223367 - Salmonella Usumbura OMOP:4223468 - Salmonella IIIb, group O:38 OMOP:4223507 - Notropis lutrensis OMOP:4223600 - Nerodia fasciata OMOP:4223649 - Salmonella IIIb 40:k:z:z57 OMOP:4223676 - Salmonella Leatherhead OMOP:4223678 - Chronic adhesive pachymeningitis OMOP:4223679 - Douglas virus OMOP:4223751 - Divide OMOP:4223797 - Hyperplasia of tonsils AND adenoids OMOP:4223828 - Eimeria alabamensis OMOP:4223947 - Viral hepatitis, type A OMOP:4224006 - Congenital absence of skull bone OMOP:4224167 - Lipoid dermatoarthritis OMOP:4224330 - Subcostal recession OMOP:4224457 - Salmonella IIIb 35:r:z35 OMOP:4224567 - Genus Sarcops OMOP:4224615 - No Chlamydia trachomatis OMOP:4224637 - Salsola tuberculatiformis OMOP:4224659 - Oil of lemon grass OMOP:4224764 - Tissue integrity status OMOP:4224781 - Knowledge level: treatment regimen OMOP:4224785 - Gleason grade score 6 out of 10 OMOP:4224789 - Everglades virus disease OMOP:4224821 - Noturus albater OMOP:4224869 - Consultation for pain OMOP:4224890 - Knowledge level: labor and delivery OMOP:4224910 - Sensory function status OMOP:4224958 - Zenopsis conchifera OMOP:4225027 - Malaise with AIDS (acquired immunodeficiency syndrome) OMOP:4225104 - Fungal gene OMOP:4225168 - Call OMOP:4225183 - Hanseniaspora OMOP:4225366 - Ultraviolet recall reaction due to cytotoxic therapy OMOP:4225373 - Salmonella IIIb 47:l,v:z53 OMOP:4225651 - Class Anthozoa OMOP:4225672 - Synophrya OMOP:4225697 - Unsupported standing position OMOP:4225805 - Periodic hyperlysinemia OMOP:4225857 - Swallowing status: esophageal phase OMOP:4225900 - Tracing of carotid pulse with ECG lead OMOP:4225959 - Subfoveal hemorrhage OMOP:4225967 - Pattern standard deviation OMOP:4226053 - Tritanopia OMOP:4226229 - Order Pennatulacea OMOP:4226362 - Genus Dixa OMOP:4226393 - Tumor invades subfascial structure OMOP:4226508 - Genus Physalia OMOP:4226510 - Order Cycadales OMOP:4226542 - Congenital anomaly of macula OMOP:4226552 - Knowledge level: disease process OMOP:4226640 - Class Remipedia OMOP:4226671 - Comfort level OMOP:4226674 - Caregiver physical health status OMOP:4226686 - Client satisfaction: physical care OMOP:4226832 - Matricaria OMOP:4226938 - Finding of pulse taking by auscultation OMOP:4227001 - Fundulus luciae OMOP:4227088 - Drug-induced hypoplasia of bone marrow OMOP:4227090 - Abscess of connective tissue OMOP:4227592 - Tool and die maker OMOP:4227594 - Acne vulgaris OMOP:4227666 - Mycobacterium nebraskense OMOP:4227722 - Multiple and complex disability OMOP:4227872 - Salmonella IIIa 17:z4,z23,z32:- OMOP:4227878 - Salmonella II 18:z4,z24:- OMOP:4227917 - Congenital absence of spermatic cord OMOP:4227955 - Lymphoma staging symptom status B OMOP:4227984 - Awakening OMOP:4228003 - Salmonella IIIa 35:z29:- OMOP:4228005 - Salmonella IIIa 35:z4,z32:- OMOP:4228022 - Salmonella IIIa 42:z4,z23:- OMOP:4228167 - Salmonella group O:50 OMOP:4228171 - Salmonella IIIb 50:i:z OMOP:4228203 - Malignant tumor, fusiform cell type OMOP:4228218 - Dissociative paralysis OMOP:4228258 - Family Trichodectidae OMOP:4228316 - Infantile streptococcal infection OMOP:4228442 - Organic foreign body OMOP:4228443 - Ketoacidotic coma due to type 2 diabetes mellitus OMOP:4228478 - Tropidophis semicinctus OMOP:4228531 - Bacterial growth present OMOP:4228750 - Anterior capsule covering intraocular lens 360 degrees OMOP:4228787 - Intergroup rhabdomyosarcoma study post-surgical clinical group IB: localized tumor, infiltrating beyond site of origin, completely resected OMOP:4228796 - National Wilms Tumor Study Group Stage I OMOP:4229066 - Rock hyrax OMOP:4229075 - Cercopithecus petaurista OMOP:4229218 - Pseudonocardia spinosispora OMOP:4229291 - Passive intestinal electrolyte transport OMOP:4229347 - Streptomyces violaceolatus OMOP:4229392 - Giddiness OMOP:4229397 - Oryzaephilus surinamensis OMOP:4229427 - Biofeedback, electrocardiogram OMOP:4229506 - Streptomyces lincolnensis OMOP:4229569 - Nauphoeta cinerea OMOP:4229602 - Fibroblast growth factor OMOP:4229675 - Sphaerotilus OMOP:4229690 - Vitellibacter OMOP:4229730 - Social involvement behavior OMOP:4229737 - Health belief OMOP:4229745 - Sebastes ovalis OMOP:4229746 - Eremobates pallipes OMOP:4229867 - Caregiver patient relationship OMOP:4229971 - Syntrophus OMOP:4230120 - Streptomyces thermospinosisporus OMOP:4230162 - Medication declined OMOP:4230172 - Blood vessel permeability OMOP:4230196 - Pericolitis OMOP:4230198 - Blood group antigen Evelyn OMOP:4230261 - Thermosipho atlanticus OMOP:4230281 - Thermobifida OMOP:4230383 - Candidal perionyxis OMOP:4230388 - Impetigo caused by Staphylococcus aureus OMOP:4230461 - Provisional shigella 3065-93 OMOP:4230557 - Substance categorized by hazard characteristics OMOP:4230566 - Family history of human immunodeficiency virus infection OMOP:4230643 - Chromosome break OMOP:4230737 - Salmonella II, group O:30 OMOP:4230740 - Salmonella IIIa 35:z4,z23:- OMOP:4230764 - Salmonella VI, group O:41 OMOP:4230807 - Eosinophilic gastroenteropathy with collagen vascular disease OMOP:4230855 - Streptomyces cyaneus OMOP:4230864 - Streptomyces paradoxus OMOP:4231018 - Filtration - action OMOP:4231023 - Salegentibacter mishustinae OMOP:4231034 - Spiroplasma helicoides OMOP:4231043 - Streptomyces angustmyceticus OMOP:4231097 - Enterohemorrhagic Escherichia coli, serotype O128:nonmotile OMOP:4231098 - Enterohemorrhagic Escherichia coli, serotype O128:H45 OMOP:4231122 - Cotyledon panniculata OMOP:4231127 - Axis III diagnosis OMOP:4231134 - Onchocerca gibsoni OMOP:4231212 - Sulfobacillus OMOP:4231303 - Stimulus OMOP:4231376 - Bacillus anthracis spore antigen OMOP:4231502 - Streptomyces showdoensis OMOP:4231576 - Calamus penna OMOP:4231711 - Aquagenic urticaria OMOP:4231791 - Thermosipho africanus OMOP:4231903 - Amniotic fluid analysis for hemolytic disease of the newborn OMOP:4231955 - Peyote Religion OMOP:4232082 - Tessaracoccus OMOP:4232154 - Congenital displacement of stomach OMOP:4232383 - Streptomyces flavovirens OMOP:4232451 - Salmonella IV, group O:50 OMOP:4232469 - Haemophilus parahaemolyticus OMOP:4232585 - Slowed saccades OMOP:4232632 - Premature infant diet: vitamin E at 10 days and iron at 3 weeks OMOP:4232633 - Pontamine sky blue 5BX stain OMOP:4232690 - Infiltrate of cornea OMOP:4232697 - Persistent atrial fibrillation OMOP:4232798 - Mastocytoma OMOP:4232799 - Blood group antigen Mackin OMOP:4232858 - Streptomyces niveiscabiei OMOP:4232887 - Ability to administer non-parenteral medication OMOP:4232889 - Supported living discharge readiness OMOP:4232968 - Congenital ovarian dysplasia OMOP:4233098 - Crenichthys nevadae OMOP:4233158 - Streptomyces glaucosporus OMOP:4233220 - Sebastes reedi OMOP:4233232 - Xiphoidalgia syndrome OMOP:4233462 - Patient medical record not available OMOP:4233530 - Interrupted breathing OMOP:4233588 - Solirubrobacteraceae OMOP:4233609 - Congenital kyphoscoliosis OMOP:4233646 - Dissociative neurological symptom disorder with dysphonia OMOP:4233651 - Gobiesox eugrammus OMOP:4233663 - Iron isotope OMOP:4233679 - Lymphocyte antigen CD72 OMOP:4233724 - Posttraumatic seizure OMOP:4233830 - Monostotic fibrous dysplasia OMOP:4233832 - Pila angelica OMOP:4233911 - Temporarily unable to perform work activities due to medical condition OMOP:4234019 - Use of oral contraceptive status at conception OMOP:4234127 - Charcot's arthropathy OMOP:4234304 - Measurement of short and intermediate acting barbiturate OMOP:4234337 - Escherichia coli serogroup O83 OMOP:4234526 - Knowledge level: breastfeeding OMOP:4234630 - Enhanced elimination procedure OMOP:4234638 - Doctorate degree achieved OMOP:4234650 - Personal wellbeing status OMOP:4234769 - Fecal incontinence due to anorectal disorder OMOP:4234882 - Congo floor maggot disease OMOP:4234913 - Specimen received OMOP:4235048 - Simkania OMOP:4235061 - Pseudomonas lutea OMOP:4235125 - Verbrycke's syndrome OMOP:4235210 - Rarobacteraceae OMOP:4235274 - Protopine OMOP:4235291 - Volcanic eruption OMOP:4235306 - Repeated concussion OMOP:4235563 - Human immunodeficiency virus enzyme-linked immunosorbent assay test positive OMOP:4235568 - Environmental infestation of rodents OMOP:4235712 - Trauma therapy: child OMOP:4235720 - Urinary continence status OMOP:4235779 - Strain of neck muscle OMOP:4235903 - Retraction nystagmus OMOP:4236021 - Avoidant disorder of adolescence OMOP:4236026 - Home care by visiting nurse OMOP:4236073 - Obstetric action OMOP:4236083 - Thermobifida alba OMOP:4236086 - Thioalkalivibrio paradoxus OMOP:4236155 - Ring-necked pheasant virus OMOP:4236157 - Rice black streaked dwarf virus OMOP:4236186 - Demodex caprae OMOP:4236244 - Deformation of breast OMOP:4236248 - Moderate hereditary factor IX deficiency disease without inhibitor OMOP:4236253 - Thiocystis violacea OMOP:4236323 - Etheostoma zoniferum OMOP:4236329 - Trachyscorpia cristulata OMOP:4236424 - Streptomyces cinereospinus OMOP:4236442 - Amylase clearance OMOP:4236721 - Bronchial hemorrhage OMOP:4237132 - Genetic independent segregation OMOP:4237143 - Diadochokinesia OMOP:4237169 - Abscess of pleural cavity OMOP:4237280 - Moderate dysplasia OMOP:4237326 - Purulent amniotic fluid OMOP:4237468 - Breastfeeding support education OMOP:4237810 - Ostertagia lyrata OMOP:4237822 - Stercoral ulcer of anus OMOP:4237866 - Pupil shape OMOP:4237868 - Crystalline lens observable OMOP:4237872 - Retinal vessel feature OMOP:4238020 - Aedes taeniorhynchus OMOP:4238453 - Lymph node observable OMOP:4238549 - Sylvilagus OMOP:4238639 - Reflex observable OMOP:4238686 - Trigeminal nerve motor disorder OMOP:4238741 - Caulophyllum OMOP:4238750 - Cantharellus cibarius OMOP:4238777 - Retina/choroid observable OMOP:4238783 - Ear / auditory observable OMOP:4238803 - Cardiac dullness to percussion OMOP:4238835 - Congenital obstruction of large intestine OMOP:4238994 - Plasminogen assay OMOP:4239153 - Salmonella Carnac OMOP:4239157 - Blood group antibody Kowanski OMOP:4239378 - Tobacco stripper (hand) OMOP:4239428 - Characteristic of perceptual performance OMOP:4239438 - Details of drug misuse behavior OMOP:4239507 - Hyperaldosteronism with nodular hyperplasia of adrenal cortex OMOP:4239576 - Appearance of iris OMOP:4239602 - Cardiovascular shunt feature OMOP:4239660 - Familial hemorrhagic diathesis OMOP:4239682 - Chronic phototoxic dermatitis OMOP:4239707 - Congenital absence of centrum of sacral vertebra OMOP:4239744 - Feature of body posture OMOP:4239749 - Grief and dying observables OMOP:4239757 - Psychotic symptom OMOP:4239763 - General characteristic of eye OMOP:4239765 - Appearance of pupil OMOP:4239812 - Sedative, hypnotic AND/OR anxiolytic-induced sleep disorder OMOP:4239830 - Nurse and patient conference OMOP:4239866 - Benign neoplasm of body of stomach OMOP:4239873 - Benign neoplasm of ciliary body OMOP:4239874 - Benign neoplasm of common bile duct OMOP:4239877 - Benign neoplasm of ectopic male breast tissue OMOP:4240042 - Benign neoplasm of popliteal lymph nodes OMOP:4240067 - DCIS nuclear pleomorphism, grade 1: monotonous nuclei, 1.5 - 2.0 RBC diameters, with finely dispersed chromatin and only occasional nucleoli OMOP:4240096 - Country dweller OMOP:4240301 - Bancroftian elephantiasis OMOP:4240452 - Adenoviral bronchopneumonia OMOP:4240472 - Methyl red test OMOP:4240481 - Haemophilus influenzae meningitis OMOP:4240545 - Congenital absence of hyoid bone OMOP:4240597 - Ichthyosarcotoxin OMOP:4240603 - Sorghum halepense poisoning OMOP:4240610 - Crotalaria eremaea OMOP:4240644 - Congenital absence of thoracic vertebra OMOP:4240649 - Azorean disease OMOP:4240651 - Azorean disease, type II OMOP:4240733 - Syphilis of mitral valve OMOP:4240785 - Abnormal communication between pericardial sac and peritoneal cavity OMOP:4240833 - Apogon binotatus OMOP:4240838 - HLA-DPw4 antigen OMOP:4240892 - Congenital absence of supraoccipital bone OMOP:4240899 - Allergic rhinitis caused by weed pollen OMOP:4241013 - Benign neoplasm of blood vessel of pelvis OMOP:4241018 - Benign neoplasm of bone of skull OMOP:4241275 - Heavy metal screen on gastric fluid OMOP:4241353 - Vibrio salmonicida OMOP:4241519 - Congenital absence of palatine bone OMOP:4241541 - Benign neoplasm of blood vessel of trunk OMOP:4241707 - Dipetalonema reconditum OMOP:4241720 - Infection by Oesophagostomum stephanostomum OMOP:4241764 - Carcinoma in situ of anterior wall of nasopharynx OMOP:4241917 - Carcinoma in situ of thyroid gland OMOP:4241987 - Rice transitory yellowing virus OMOP:4242033 - Carcinoma in situ of vas deferens OMOP:4242136 - Genus Rhinoestrus OMOP:4242179 - Congenital abnormal shape of nasal bone OMOP:4242188 - Congenital absence of mitral valve OMOP:4242206 - Benign neoplasm of bronchus of left lower lobe OMOP:4242212 - Blood group antigen A.M. OMOP:4242221 - Rumination disorder OMOP:4242230 - Periodontal cyst OMOP:4242234 - Yawning OMOP:4242245 - Relaxation of sphincter of Oddi OMOP:4242285 - Plant isoquinoline alkaloid OMOP:4242343 - Benign neoplasm of glomus jugulare OMOP:4242344 - Benign neoplasm of greater curvature of stomach OMOP:4242345 - Benign neoplasm of hypoglossal nerve OMOP:4242365 - Benign neoplasm of muscle of perineum OMOP:4242367 - Benign neoplasm of nasal bone OMOP:4242368 - Benign neoplasm of neck OMOP:4242502 - Benign neoplasm of preauricular lymph nodes OMOP:4242515 - Benign neoplasm of skin of elbow OMOP:4242714 - Neon isotope OMOP:4242739 - Lithoglyphopsis aperta OMOP:4242821 - Benign neoplasm of rectovaginal septum OMOP:4242980 - Benign neoplasm of trunk OMOP:4243128 - Carcinoma in situ of hypopharyngeal aspect of interarytenoid fold OMOP:4243153 - Panic disorder with agoraphobia, severe agoraphobic avoidance AND panic attacks in full remission OMOP:4243172 - Congenital abnormal curvature OMOP:4243215 - Distal muscular dystrophy OMOP:4243269 - Carcinoma in situ of nipple of female breast OMOP:4243346 - Hellebrin OMOP:4243357 - Chronic appendicitis OMOP:4243452 - Nontraumatic hematoma of corpus cavernosum OMOP:4243570 - Benign neoplasm of phalanx of hand OMOP:4243616 - Salmonella Ursenbach OMOP:4243625 - Diffuse glomerulosclerosis of kidney due to diabetes mellitus OMOP:4243627 - Congregationalist Church OMOP:4243652 - Secondary dentin OMOP:4243666 - Localized gingival recession OMOP:4243725 - Benign neoplasm of vallecula OMOP:4243727 - Benign neoplasm of ventral surface of tongue OMOP:4243757 - Kyphoscoliotic pelvis OMOP:4243769 - Mitochondrial-lipid-glycogen storage myopathy OMOP:4243777 - Peprilus alepidotus OMOP:4243872 - Carcinoma in situ of craniopharyngeal duct OMOP:4243873 - Carcinoma in situ of ectopic male breast tissue OMOP:4243876 - Carcinoma in situ of fallopian tube OMOP:4243946 - Bryonia cretica s.s. dioica OMOP:4243965 - Carya glabra OMOP:4244054 - Lead-200 OMOP:4244168 - Malignant melanoma of skin of finger OMOP:4244206 - Senecio OMOP:4244220 - Rhabdovirus of entamoeba OMOP:4244266 - Adult gender identity disorder, sexually attracted to males OMOP:4244396 - Mastadenovirus OMOP:4244437 - Rheumatic mitral AND aortic valve regurgitation OMOP:4244478 - Incomplete ossification of presphenoid bone OMOP:4244509 - Carcinoma in situ of major salivary gland OMOP:4244520 - Babesia ovata OMOP:4244569 - Acute respiratory alkalosis OMOP:4244590 - Moju virus OMOP:4244639 - Carcinoma in situ of pharynx OMOP:4244714 - Salmonella Broughton OMOP:4244717 - Paragonimus ringeri OMOP:4244808 - Congenital abnormal shape of ischium OMOP:4244879 - Dengue virus, type 1 OMOP:4244945 - Congenital anomaly of caudal vertebra OMOP:4244947 - Congenital anomaly of lacrimal bone OMOP:4244951 - Congenital anomaly of sternebra OMOP:4244955 - Congenital bilobed gallbladder OMOP:4244956 - Congenital blepharophimosis OMOP:4245104 - Combined valvular-subvalvular pulmonic stenosis OMOP:4245123 - Lesion size cannot be determined OMOP:4245137 - Leukocyte poor blood preparation, nylon filter OMOP:4245265 - Popeye sign OMOP:4245272 - Bilateral visual field constriction OMOP:4245349 - Congenital dilatation of inferior vena cava OMOP:4245439 - Congenital hypertrophy of adrenal gland OMOP:4245492 - Abnormal airflow OMOP:4245602 - Cacatua goffini OMOP:4245618 - Atrial septal defect with endocardial cushion defect, partial type OMOP:4245636 - Congenital hypoplasia of aortic arch OMOP:4245878 - Furuncle OMOP:4246032 - Primary malignant neoplasm of chest wall OMOP:4246042 - Primary malignant neoplasm of glossopharyngeal nerve OMOP:4246074 - Home care of patient OMOP:4246180 - Staphylococcus epidermidis OMOP:4246195 - Paramyoclonus multiplex OMOP:4246246 - Primary malignant neoplasm of trochlear nerve OMOP:4246598 - Misery and unhappiness reaction of childhood OMOP:4246664 - Nanukayami OMOP:4246683 - Mammography assessment (Category 2) - Benign finding OMOP:4246786 - Lack of ossification of carpal bone OMOP:4246844 - Herpes simplex IgG level OMOP:4246939 - Congenital malposition of metatarsal bone OMOP:4246975 - Thrombolysis therapy not indicated OMOP:4246992 - Panic disorder with agoraphobia, severe agoraphobic avoidance AND severe panic attacks OMOP:4247063 - Congenital thickening of clavicle OMOP:4247109 - Renal disorder education OMOP:4247354 - Primary malignant neoplasm of skin of temporal region OMOP:4247361 - Primary malignant neoplasm of third cuneiform bone of foot OMOP:4247373 - Type of polyp from which malignant neoplasm originated OMOP:4247393 - Blood group antigen Vr OMOP:4247457 - Scrophularia aquatica OMOP:4247583 - Dental root sensitivity OMOP:4247670 - FIGO VM stage V OMOP:4247708 - Lack of ossification of basioccipital bone OMOP:4247713 - Malignant melanoma of skin of knee OMOP:4247836 - Primary malignant neoplasm of major salivary gland OMOP:4247914 - Monomorium pharaonis OMOP:4247926 - Abrasion and/or friction burn of nose with infection OMOP:4248221 - Resin isocyanate specific immunoglobulin E OMOP:4248235 - EPEC, serotype O119:H6 OMOP:4248268 - Airframe fitter-assembler OMOP:4248368 - Genus Sapovirus OMOP:4248425 - Irreversible coma OMOP:4248807 - Healthcare associated bacterial pneumonia OMOP:4249260 - Invasive Group B beta-hemolytic streptococcal disease OMOP:4249441 - Ball valve obstruction OMOP:4249537 - Alkaline phosphatase stain OMOP:4249573 - Compression of optic nerve OMOP:4249744 - Manganese-54 OMOP:4250009 - Born by breech delivery OMOP:4250021 - Graft failure due to acute tubular necrosis OMOP:4250023 - Severe major depression with psychotic features OMOP:4250178 - Chronic ulcer of penis OMOP:4250291 - Hennebert's syndrome OMOP:4250606 - Felt hood former OMOP:4250613 - At increased risk for perioperative injury OMOP:4250626 - Congenital absence of germinal epithelium of testes OMOP:4250902 - Alaria marcianae OMOP:4251025 - Congenital hepatomegaly OMOP:4251051 - Dilated cardiomyopathy due to malignancy OMOP:4251320 - Tabanus abactor OMOP:4251327 - Double outlet left ventricle OMOP:4251451 - Murine pneumotropic virus OMOP:4251631 - Hereditary coproporphyria OMOP:4251751 - Mobility/transfers education, guidance, and counseling OMOP:4251921 - Focal onset aware autonomic epileptic seizure OMOP:4251936 - Compensatory regeneration OMOP:4252270 - Carmine stain OMOP:4252370 - Public health dentistry OMOP:4252385 - Coronary artery bypass graft occlusion OMOP:4252539 - Healthcare associated pulmonary aspergillosis OMOP:4252580 - Leminorella grimontii OMOP:42527122 - Pressure Respiratory system airway --on ventilator OMOP:42527229 - Can pronounce irrevocability [NIH Toolbox] OMOP:42527251 - Can pronounce feed [NIH Toolbox] OMOP:42527322 - Can pronounce side [NIH Toolbox] OMOP:42527449 - Can pronounce malapropism [NIH Toolbox] OMOP:42527463 - Can pronounce supercilious [NIH Toolbox] OMOP:42527484 - Can pronounce rock [NIH Toolbox] OMOP:42527564 - Can pronounce conscious [NIH Toolbox] OMOP:42527687 - Can pronounce try [NIH Toolbox] OMOP:42527690 - Can pronounce utopian [NIH Toolbox] OMOP:42527696 - Can pronounce z [NIH Toolbox] OMOP:42527876 - ESBL by cefepime to cefepime-clavulanate IC ratio [Presence] by ARD gradient strip OMOP:42528373 - Can pronounce fly [NIH Toolbox] OMOP:42528552 - Picture Vocabulary Test - English - scale score age adjusted [NIH Toolbox] OMOP:42528563 - Able to point to the letter b [NIH Toolbox] OMOP:4252862 - Enterostomy infection OMOP:42528627 - TRBV27 gene segment/TRBV gene segments.total in Blood OMOP:42528757 - Wheat native (nTri a) 19+20+21 IgE Ab [Units/volume] in Serum OMOP:42528758 - Dicarboxyhexenoylcarnitine (C6:1-DC)/Creatinine [Molar ratio] in Urine OMOP:42528768 - FDA package insert REMS medication guide OMOP:42528818 - Summed rest score for 17 segment model Myocardium SPECT OMOP:42528914 - Reason for splenectomy OMOP:42528963 - Sexual abuse--before 18 years old [ACE] OMOP:42528967 - Domestic violence--before 18 years old [ACE] OMOP:42529040 - t(9;22)(q34.1;q11)(ABL1,BCR) fusion transcript [Presence] in Bone marrow by Molecular genetics method OMOP:42529126 - Dense fine speckled 70 protein IgG Ab [Presence] in Serum or Plasma by Line blot OMOP:42529129 - Glial nuclear type 1 IgG Ab [Presence] in Serum or Plasma by Line blot OMOP:42529217 - Hepatitis B virus core IgG+IgM Ab [Presence] in Serum or Plasma by Immunoassay OMOP:42529272 - Lifestyle behaviors impacting physical or mental well-being [PCAM] OMOP:42529328 - Able to hold position for 50 seconds - trial 2 [NIH Toolbox] --eyes open and on foam surface OMOP:42529357 - Number of 10 foot marks [NIH Toolbox] --2M post trial start OMOP:42529599 - SUMO-activating enzyme subunit 2 Ab [Units/volume] in Serum by Line blot OMOP:4253022 - Aerococcus christensenii OMOP:4253225 - Lepomis symmetricus OMOP:4253226 - Ovine herpesvirus 2 OMOP:42534823 - Arthritis of left wrist caused by bacteria OMOP:42534870 - Foreign body granuloma of soft tissue of left foot OMOP:42534896 - Bone cyst of left tibia OMOP:42534901 - Osteomyelitis of right shoulder OMOP:42534937 - Candidiasis of vagina in pregnancy OMOP:42534969 - Injury of right ankle OMOP:42534978 - Brachial neuritis of left upper limb OMOP:42534986 - Bilateral inversion of nipple OMOP:42535099 - Left cervical root neuropathy OMOP:42535114 - Cerebrovascular accident due to thrombus of left middle cerebral artery OMOP:4253513 - Non-lipoid histiocytosis OMOP:42535141 - Congenital trigger finger of right hand OMOP:4253519 - Flourensia cernua OMOP:42535219 - Bilateral entrapment of ulnar nerves at elbow OMOP:4253524 - Admission certification approved OMOP:42535335 - Stenosis of left subclavian artery OMOP:42535448 - Right foot neuritis OMOP:42535670 - Carrier of chromosome disorder OMOP:42535676 - Hemiplegia of nondominant side as sequela of ischemic cerebrovascular accident OMOP:42535683 - Acquired deformity of abdominal wall OMOP:42535719 - Injury of intrinsic muscle of thumb OMOP:42535732 - Derangement of meniscus of knee joint due to and following old injury of knee OMOP:42535747 - Midline diastema of teeth OMOP:42535748 - Advenella faeciporci OMOP:42535772 - Rothia terrae OMOP:42536015 - Thymidylate synthase inhibitor OMOP:42536034 - Hepatitis C virus protein NS5A inhibitor OMOP:42536097 - 4-aminobutyrate - 2-oxoglutarate transaminase inhibitor OMOP:42536114 - Beta adrenergic receptor agonist OMOP:4253622 - Postoperative infectious endophthalmitis OMOP:42536225 - Non-specific protein-tyrosine kinase inhibitor OMOP:42536274 - Salmon OMOP:4253630 - Goal OMOP:42536306 - Plum OMOP:42536332 - Elongated left ramus of mandible OMOP:42536333 - Basil OMOP:42536337 - Occlusion of right pontine artery OMOP:42536543 - Contact urticaria caused by food OMOP:42536569 - Perinatal disorder of integument OMOP:42536592 - Human immunodeficiency virus World Health Organization 2007 stage 2 co-occurrent with tuberculosis OMOP:42536602 - Adult-onset immunodeficiency OMOP:42536621 - Parasitic infection causing granuloma of cerebrum OMOP:42536674 - Adhesions due to endometriosis OMOP:42536715 - Fracture of metaphysis of proximal tibia OMOP:42536730 - Neonatal intestinal perforation co-occurrent and due to intestinal atresia OMOP:42536738 - Diverticulum and hemorrhage of large intestine OMOP:42536743 - Primary malignant neuroendocrine neoplasm of pancreas OMOP:42536749 - Traumatic subluxation of spine due to birth trauma OMOP:42536811 - Puncture wound of hand without foreign body OMOP:42536814 - Traumatic rupture of collateral ligament of wrist OMOP:42536828 - Laceration of hip without foreign body OMOP:42536836 - Avulsion of ligament with bony fragment of lateral malleolus OMOP:42536837 - Fracture of lateral malleolus at syndesmosis OMOP:42536848 - Multiple injuries of lower leg OMOP:42536866 - Traumatic dislocation of interphalangeal joint of lesser toe OMOP:42536878 - Multiple injuries of foot OMOP:42536921 - Exanthem caused by Chlamydophila psittaci OMOP:42536969 - Toxigenic Clostridium difficile OMOP:42537102 - Penicillium simplicissimum OMOP:42537144 - Injury of both visual cortices OMOP:42537493 - Recurrent cholesteatoma of mastoid cavity OMOP:42537537 - Recurrent skin infection OMOP:42537640 - Post-procedural false aortic aneurysm OMOP:42537657 - Interstitial lung disease due to systemic disease OMOP:42537687 - Anemia due to metabolic disorder OMOP:42537693 - Autosomal dominant hereditary spastic paraplegia OMOP:42537713 - Injury of fascia of abdomen OMOP:42537741 - Transplant present OMOP:42537749 - Chronic visceral pain OMOP:42537780 - Infection of large intestine OMOP:4253801 - Motor cortical function OMOP:42538010 - Coriolopsis OMOP:42538157 - Incomplete spinal cord injury OMOP:42538170 - Infant of patient deceased OMOP:42538171 - Child of patient deceased OMOP:42538218 - Obstructed recurrent left femoral hernia with gangrene OMOP:42538441 - Epinephrine induced coagulation technique OMOP:42538545 - Fetal intrauterine intestinal perforation with congenital atresia of intestinal tract OMOP:42538569 - Recurrent instability of joint OMOP:42538594 - Sexual dysfunction caused by stimulant OMOP:42538595 - Mood disorder with manic symptoms caused by hallucinogen OMOP:42538661 - Disruption of iris OMOP:42538710 - Superficial partial thickness burn of lower limb OMOP:42538732 - Psychotic disorder with hallucinations caused by synthetic cathinone OMOP:42538792 - Chronic musculoskeletal pain due to persistent inflammation OMOP:42538798 - Chronic peripheral neuropathic pain OMOP:42538828 - Occlusion of right posterior cerebral artery by embolus OMOP:42538944 - Family history of heritable malignancy OMOP:42538952 - Difficulty swallowing pills OMOP:42539054 - Shock co-occurrent and due to anaphylaxis caused by serum OMOP:42539073 - Gas OMOP:42539090 - Interstitial lung disease with systemic vasculitis OMOP:42539154 - Deep partial thickness burn of face OMOP:42539163 - Traumatic scar of eyelid OMOP:42539165 - Monoplegia of left upper limb OMOP:42539205 - Tendinitis of left quadriceps tendon OMOP:42539213 - Chondrocalcinosis of right ankle OMOP:42539219 - Subcoracoid impingement of right shoulder region OMOP:42539252 - Neurogenic thoracic outlet syndrome of left brachial plexus OMOP:42539268 - Transition from acute care to hospice OMOP:42539322 - Rhizobium rhizoryzae OMOP:42539359 - Irritant contact dermatitis caused by emollient substance OMOP:42539372 - Sepsis caused by Klebsiella pneumoniae OMOP:42539467 - Spacing of anterior maxillary teeth OMOP:42539573 - Traumatic rupture of radiocarpal ligament OMOP:42539582 - Acquired absence of genital organ OMOP:42539687 - Interstitial lung disease due to granulomatous disease OMOP:42539736 - Lop ear deformity OMOP:42539769 - Inhale OMOP:4254089 - Blood group antigen Xga OMOP:4254197 - Meconium stained liquor - grade II OMOP:4254214 - Vaccination status OMOP:4254349 - Occupational deafness OMOP:4254514 - 1,3-beta-D-glucan detection OMOP:4254776 - Clinical manifestation of carnosinase deficiency OMOP:4255271 - Porcine inhibitor activity OMOP:4256128 - Intestinal botulism OMOP:4256228 - Respiratory failure OMOP:4256368 - Medication set-up surveillance OMOP:4257045 - Infantile psychosis OMOP:4257838 - Stress control education OMOP:4258202 - Dicarboxylic amino acid OMOP:4258411 - Mechanical repair - action OMOP:4258479 - Adult care OMOP:4259004 - Congenital hypoplasia of umbilical artery OMOP:4259283 - Salmonella Trotha OMOP:4259285 - Strongylus asini OMOP:4259289 - Eimeria wyomingensis OMOP:4259343 - Ear wax removal education OMOP:4259424 - Streptomyces catenulae OMOP:4259504 - Iritis with ulcerative colitis OMOP:4259700 - Xylophilus ampelinus OMOP:4260204 - Biphasic disease OMOP:4260213 - International neuroblastoma pathology classification cannot be determined OMOP:4260328 - Tumor invades bone OMOP:4260337 - Family Aerococcaceae OMOP:4260384 - Anomaly of chromosome pair 6 OMOP:4260398 - Minimal change disease OMOP:4260547 - Bone matrix OMOP:4260663 - Bard-Pic syndrome OMOP:4260689 - Anemia due to multiple mechanisms OMOP:4260896 - Cerebrospinal fluid Tau protein measurement OMOP:4261174 - Ulvibacter litoralis OMOP:4261386 - Triodontophorus serratus OMOP:4261656 - Magnesium measurement, urine OMOP:4261784 - Ulceration of colon OMOP:4261837 - Oxine benzoate OMOP:4261923 - Oseltamivir resistant virus present OMOP:4261959 - Pithecellobium bigeminum OMOP:4261968 - Isovolume pressure-flow curve OMOP:4262001 - Special diet education OMOP:4262079 - Difficulty lip reading OMOP:4262089 - Rarobacter faecitabidus OMOP:4262109 - Macrophage inhibitory factor OMOP:4262242 - Fracture of eight OR more ribs OMOP:4262265 - Abrasion and/or friction burn of abdominal wall without infection OMOP:4262274 - Aponomma auriginans OMOP:4262303 - Monitoring features OMOP:4262394 - Hemoglobin E trait OMOP:4262573 - Caprine arthritis-encephalitis virus OMOP:4262598 - Organ present in surgical specimen OMOP:4262747 - Tumor pigmentation OMOP:4262940 - Mycotoxin OMOP:4262943 - Persistent hyaloid artery OMOP:4262973 - Oil of myrtle OMOP:4263058 - Oxidation fermentation test OMOP:4263087 - Hypertrophy of thymus OMOP:4263120 - Burning feet OMOP:4263289 - Stage IVb: Hematogenous or lymphatic dissemination (thymus gland) OMOP:4263322 - Crotalaria verrucosa OMOP:4263348 - Congenital absence of pelvis and lower limb OMOP:4263373 - Thalidomide embryopathy syndrome OMOP:4263546 - Focal atelectasis OMOP:4263571 - Hunger contractions type I OMOP:4263587 - Unkempt appearance OMOP:4263688 - Impaired glucose tolerance associated with drugs OMOP:4263690 - Metal sprayer OMOP:4263692 - Carbuncle of anus OMOP:4263700 - Egernia cunninghami OMOP:4263835 - Hippopotamus amphibius OMOP:4263862 - Trichuris globulosa OMOP:4263868 - Use of pulley apparatus OMOP:4263896 - Sprain of ligament of cricothyroid joint OMOP:4263900 - Low immunologic affinity OMOP:4263956 - Pionus OMOP:4263976 - Gluconobacter OMOP:4263980 - Tumor location after sectioning OMOP:4264037 - Abscess cavity OMOP:4264050 - Sinking OMOP:4264210 - Insensible fluid loss OMOP:4264252 - Gallbladder feature OMOP:4264259 - Micturition feature OMOP:4264294 - Haemonchus contortus OMOP:4264312 - Rabbit syncytium virus OMOP:4264421 - Characteristic of second stage of labor OMOP:4264435 - Contact lens external optical zone OMOP:4264449 - Post-transplant lymphoproliferative disorder, polymorphic OMOP:4264492 - Salmonella II 30:b:z6 OMOP:4264505 - Sludge OMOP:4264617 - Foot-drop OMOP:4264621 - Salmonella Onarimon OMOP:4264633 - REU gene OMOP:4264635 - Human rhinovirus 114 OMOP:4264806 - Drug-induced malabsorption OMOP:4264807 - Movement of foot OMOP:4264836 - Pain / sensation observable OMOP:4264893 - Grand Arbaud virus OMOP:4265059 - Hyperplastic polyp OMOP:4265064 - Infection by Thysaniezia OMOP:4265122 - Finding related to ability to skip on alternate feet OMOP:4265180 - Infection by Hypodereum OMOP:4265315 - Allomonas OMOP:4265347 - Pallidonigroluysian degeneration OMOP:4265424 - Status of non-invasive (desmoplastic) ovarian tumor omental implants OMOP:4265433 - Visual impairment OMOP:4265534 - Transposition of pulmonary veins OMOP:4265619 - Notropis gibbsi OMOP:4265742 - Molluscum contagiosum blepharoconjunctivitis OMOP:4265769 - Postoperative subphrenic abscess OMOP:4265772 - Alaria arisaemoides OMOP:4265861 - Asthma trigger finding OMOP:4265915 - HNSHA due to diphosphoglycerate mutase deficiency OMOP:4266009 - Ability to smell OMOP:4266010 - Ability to sense position and movement OMOP:4266048 - Infection by Strongylus OMOP:4266158 - Finding related to ability to turn pages OMOP:4266160 - Finding related to ability to undo clothes fastenings OMOP:4266201 - Benign neoplasm with pilar differentiation OMOP:4266235 - Hotel receptionist OMOP:4266241 - Electric chorea OMOP:4266295 - Finding related to ability to use bedpan OMOP:4266300 - Finding related to ability to remove prosthesis OMOP:4266314 - Finding related to ability to empty bath OMOP:4266446 - Finding related to ability to clean room OMOP:4266511 - Mannosidosis, type I OMOP:4266691 - Krypton-87 OMOP:4266815 - Sniffing position OMOP:4266841 - Silver-110 OMOP:4267235 - Two glass urine test, first glass appearance finding OMOP:4267420 - Bartonella OMOP:4267507 - Clonorchis sinensis OMOP:4267550 - Vascular neoplasm of skin OMOP:4267664 - Urea level - finding OMOP:4267736 - Uranium-237 OMOP:4268094 - Finding related to ability to use automatic language OMOP:4268100 - Finding related to ability to use different forms of conversation OMOP:4268108 - Finding related to ability to manage steps OMOP:4268110 - Finding related to ability to use escalator OMOP:4268175 - Leucine-induced hypoglycemia OMOP:4268249 - Finding related to ability to use potty OMOP:4268284 - Asthma trigger OMOP:4268392 - Finding related to ability to connect and disconnect domestic appliances OMOP:4268414 - Cold agglutinins level : adult cells OMOP:4268416 - Serum total T3 level OMOP:4268427 - No previous immunizations OMOP:4268455 - Normal ossification OMOP:4268456 - Cnemidophorus OMOP:4268472 - Hypothyroidism due to scleroderma OMOP:4268608 - Cholestanol storage disease OMOP:4268684 - Passive character OMOP:4268825 - Memory: own age - finding OMOP:4268841 - Company when drinking - finding OMOP:4268880 - Euryblepharon OMOP:42689542 - Place of occurrence of injury is garden pond in home environment OMOP:42689596 - Detained in hospital under Section 136 of the Mental Health Act 1983 (England and Wales) OMOP:42689641 - Able to show empathy OMOP:42689711 - Injury whilst playing American football OMOP:42689726 - Injury whilst playing Gaelic football OMOP:42689761 - Injury whilst playing hurling OMOP:42689771 - Injury whilst trampolining OMOP:42689774 - Injury whilst engaged in martial arts activity OMOP:42689783 - Injury whilst engaged in social activity outside the home OMOP:42689818 - Injury whilst driving motor vehicle on public highway OMOP:42689824 - Injury whilst cheerleading OMOP:42689831 - Difficulty sequencing events OMOP:42689837 - Difficulty transferring to vehicle with supervision OMOP:42689853 - Does not stop use of energy OMOP:42689856 - Does not understand generalised pain OMOP:42689874 - Does sit down onto bed OMOP:42689876 - Does stop use of energy OMOP:42689881 - Does understand pain in body part OMOP:42689903 - Difficulty being optimistic OMOP:4268991 - Finding of position of pupil light reflex OMOP:42689916 - Difficulty engaging in life roles OMOP:42689933 - Difficulty identifying life roles OMOP:42689944 - Difficulty managing incontinence products OMOP:42689966 - Difficulty participating in playground activities OMOP:42689973 - Difficulty recognising generalised pain OMOP:42690020 - Difficulty writing for lessons OMOP:42690117 - Does not set personal goals OMOP:42690185 - Does feel confident OMOP:42690223 - Does participate in school activities OMOP:42690225 - Does plan OMOP:4269024 - Diabetic peripheral neuropathy screening OMOP:42690289 - Unable to be hopeful for future OMOP:42690312 - Unable to get out of bed without assistance OMOP:42690324 - Unable to make decisions OMOP:42690332 - Unable to manage internal steps OMOP:42690343 - Unable to mobilise over uneven ground OMOP:42690390 - Unable to tolerate toileting routine OMOP:42690400 - Unable to use debit card OMOP:4269061 - Flowerpecker OMOP:42690610 - Difficulty identifying risky behaviours OMOP:42690713 - Difficulty using communication device OMOP:42690723 - Difficulty getting into bed without assistance OMOP:42690725 - Difficulty managing own physical health needs OMOP:42690735 - Does not manage generalised pain OMOP:42690742 - Does not remember people OMOP:4269145 - Livestock worker (general) OMOP:4269227 - Parieto-occipital aphasia OMOP:4269316 - Lampetra minima OMOP:4269452 - Neonatal condition - finding OMOP:4269496 - Cerebrospinal fluid formation OMOP:4269511 - Ulcerated atheromatous plaque OMOP:4269579 - Finding of receipt of benefit status OMOP:4269755 - Agglutinating antibody OMOP:4269770 - Salmonella Drogana OMOP:4269784 - Stewart-Treves syndrome OMOP:4269872 - Kimura's disease OMOP:4269979 - Finding related to ability to remember current year OMOP:4270221 - Abrasion and/or friction burn of lip without infection OMOP:4270291 - Feature of abdominal appearance OMOP:4270300 - Elbow joint temperature OMOP:4270334 - Endocarditis with infective aneurysm OMOP:4270348 - Latent learning OMOP:4270487 - Cynanchum vincetoxicum OMOP:4270499 - Syphacia citelli OMOP:4270574 - Size of hand - finding OMOP:4270608 - Dermatosis caused by parasitic mammalian mite OMOP:4270621 - Blood group antibody Fya OMOP:4270722 - Phototoxic reaction to topically applied medicament OMOP:4270743 - Non-immunological contact urticaria OMOP:4270779 - Amandava subflava OMOP:4270832 - Finding related to ability to run down a slope OMOP:4270870 - Eosinophilic spongiosis (prebullous pemphigoid) OMOP:4270930 - Loom fixer OMOP:4270969 - Finding related to ability to alternate between sitting and standing OMOP:42709746 - Swelling of upper limb OMOP:42709764 - Malignant melanoma of skin of lower leg OMOP:42709843 - Deformity of lower limb OMOP:42709877 - Wound edge diffuse OMOP:42709908 - Riga-Fede disease OMOP:42709921 - Hemorrhage into subdural space of neuraxis OMOP:42709922 - Hematoma of subdural space of neuraxis OMOP:42709999 - Congenital anomaly of blood vessel of lower limb OMOP:4271035 - Sanguinicola occidentalis OMOP:4271121 - Finding related to ability to produce voiceless sounds OMOP:4271268 - Finding related to ability to put lid on container OMOP:4271311 - Hereditary insensitivity to pain with anhidrosis OMOP:4271439 - Infection by Strongyloides canis OMOP:4271446 - Toothed whale OMOP:4271449 - Blue nevus OMOP:4271637 - Range of shoulder internal rotation - finding OMOP:4271642 - Anal reflex finding OMOP:4271657 - Measure of fetal movement OMOP:4271689 - Blood group antigen Bxa OMOP:4271754 - Measure of dialysis OMOP:4271783 - Finding related to ability to take drink to mouth OMOP:4271913 - Finding related to ability to clear mouth of residue OMOP:4272071 - Finding related to ability to grip OMOP:4272090 - Mixed nerve conduction pattern - finding OMOP:4272095 - Finding related to ability to perform breathing functions OMOP:4272481 - Ginkgo OMOP:4272635 - Galphimia OMOP:4272772 - Oxalis pes-caprae OMOP:4273006 - Finding related to ability to write check OMOP:4273029 - Mycoplasma dispar OMOP:4273073 - Infestation by Pulex irritans OMOP:4273103 - Osteogenesis imperfecta with blue sclerae AND normal teeth OMOP:4273160 - Presence of communal areas in accommodation - finding OMOP:4273221 - Kangaroo OMOP:4273258 - Leishmania mexicana pifanoi OMOP:4273300 - Golden-rumped tinkerbird OMOP:4273303 - Mean cell volume - finding OMOP:4273682 - Oculocutaneous albinism OMOP:4273868 - Blood group antibody Schor OMOP:4273879 - Fast blue RR salt stain OMOP:4273957 - Finding related to ability to mobilize using wheelchair OMOP:4274028 - Vipera lebetina OMOP:4274401 - Finding related to ability to use educational facilities OMOP:4274411 - Volume of sputum - finding OMOP:4274418 - Right occipitoposterior position OMOP:4274423 - Finding related to care and support circumstances and networks OMOP:4274491 - Acute gastrojejunal ulcer with hemorrhage OMOP:4274651 - Vitamin B12 deficiency (non anemic) OMOP:4274950 - Infection by Bunostomum trigonocephalum OMOP:4275180 - Turbidity of fluid - finding OMOP:4275348 - Urine microscopy: leukocytes - lymphs present OMOP:4275367 - Interpretations of behavior finding OMOP:4275487 - Finding related to behavior accompanying sex OMOP:4275520 - Eye measurements - finding OMOP:4275561 - Pleuronichthys ritteri OMOP:4275567 - Poisoning by phenobarbital OMOP:4275737 - Gongylonema incerta OMOP:4275899 - Urticaria OMOP:4275905 - Apetemon OMOP:4276182 - Amygdalolith OMOP:4276345 - Macrophage activating factor OMOP:4276408 - Red blood cell maturation age - finding OMOP:4276411 - Finding related to ability to recognize familiar people OMOP:4276647 - Rectovaginal fistula OMOP:4276803 - Filaroides osleri OMOP:4277092 - Diverticulitis of urinary bladder OMOP:4277268 - Cuban pygmy frog OMOP:4277457 - Rhacochilus toxotes OMOP:4277514 - Blister of nose without infection OMOP:4277529 - Passive range of wrist supination - finding OMOP:4277661 - Extensor plantar response finding OMOP:4278074 - Fetal aminopterin syndrome OMOP:4278082 - Supranuclear paralysis OMOP:4278215 - Perivascular degeneration OMOP:4278218 - Actinomadura pelletieri OMOP:4278593 - Active range of lumbar spine right lateral flexion - finding OMOP:4278666 - Bayonet hair OMOP:4278673 - Abscess of flank OMOP:4278816 - Alpha zero thalassemia OMOP:4278841 - Hyperplasia of pancreatic islet beta cell OMOP:4278846 - Polymorphous light eruption, plaque type OMOP:4278987 - Koro OMOP:4279002 - Neorickettsia elokominica OMOP:4279229 - Finding of secondary sexual hair growth OMOP:4279311 - Physical medicine neuromuscular training OMOP:4279380 - False knot of umbilical cord OMOP:4279446 - Myrichthys maculosus OMOP:4279681 - Hepatosplenomegaly OMOP:4279756 - Mycobacterium szulgai OMOP:4280079 - Fetal trimethadione syndrome OMOP:4280222 - Capnocytophaga gingivalis OMOP:4280292 - Range of wrist adduction - finding OMOP:4280519 - Salmonella II 42:m,t:(e,n,x,z15) OMOP:4280642 - Ixodes cookei OMOP:4280643 - Scomberomorus regalis OMOP:4280800 - Pseudohypertrophy OMOP:4280896 - Atypical hyperplasia of breast OMOP:4280964 - Raja kincaidi OMOP:4281023 - Malignant tumor involving vulva by direct extension from uterine cervix OMOP:4281227 - Regent bowerbird OMOP:4281228 - Congenital hyperplasia of muscle OMOP:4281387 - Regional ventilation differences due to unequal compliance OMOP:4281518 - Substernal goiter OMOP:4281548 - Antimony-115 OMOP:4281692 - Identity disorder OMOP:4281829 - Cartilage resorption OMOP:4281833 - Liasis childreni OMOP:4281847 - Etheostoma virgatum OMOP:4281921 - Fistula of mastoid OMOP:4282159 - Cryptosporidial gastroenteritis OMOP:4282301 - Todd's paresis OMOP:4282461 - Icelinus fimbriatus OMOP:4282750 - Navicular disease OMOP:4282771 - Glucagonoma, malignant OMOP:4283215 - Common bull snake OMOP:4283239 - Increased collateral circulation OMOP:4283382 - Besnoitia sauriana OMOP:4283685 - Neisseria polysaccharea OMOP:4283806 - Blood streaked sputum OMOP:4283943 - Musculoskeletal immobility OMOP:4283959 - Electronics fitter (industrial equipment) OMOP:4284028 - Placenta previa OMOP:4284257 - Eosinophilic gastroenteropathy with predominant muscle layer disease OMOP:4284259 - Opalina OMOP:4284699 - Tissue removed at necropsy OMOP:4284705 - Tracheal tug OMOP:4284978 - Sarcoptes scabiei var. suis OMOP:4285286 - Binocular vision observable OMOP:4285573 - Disability evaluation disability 15 percent OMOP:4285723 - Cystathionine gamma-lyase deficiency OMOP:4285726 - Salmonella Legon OMOP:4285741 - Zalophus califonianus OMOP:4285744 - Painful urinary bladder spasm OMOP:4286022 - Anti DNA histone antibody OMOP:4286031 - Zinc poisoning OMOP:4286048 - Contact dermatitis of eyelid OMOP:4286200 - Gonocephalus OMOP:4286364 - Salmonella Togo OMOP:4286483 - Amniotic fluid lecithin/sphingomyelin ratio OMOP:4286497 - Centriacinar emphysema OMOP:42868310 - 2-Dechloroethylifosfamide [Mass/time] in 24 hour Urine --3 days post dose ifosfamide OMOP:42868512 - Candida tropicalis DNA [Presence] in Blood by NAA with probe detection OMOP:42868514 - Candida krusei DNA [Presence] in Blood by NAA with probe detection OMOP:42868580 - FDA product label Establishment de-registration OMOP:4286875 - Contact lens diameter OMOP:42868775 - I feel tired in the past 7 days [FACIT] OMOP:42868782 - I worry about the effect of stress on my illness in the past 7 days [FACIT] OMOP:42868860 - I have discomfort or pain when I eat in the past 7 days [FACIT] OMOP:42868930 - Swelling keeps me from wearing clothes or shoes I want to wear in the past 7 days [FACIT] OMOP:42868980 - Functional Assessment of Cancer Therapy for patients with cancer of the cervix questionnaire - version 4 (FACT-Cx) [FACIT] OMOP:42869003 - Functional Assessment of Cancer Therapy - Bladder Symptom Index Questionnaire - 7 items (FBlSI) [FACIT] OMOP:42869022 - National Comprehensive Cancer Network - Lung Symptom Index Questionnaire - 17 items (NCCN-FACT - FLSI-17) [FACIT] OMOP:42869103 - Functional Assessment of Cancer Therapy for patients with neurotoxicity questionnaire - 12 items - version 4 (FACT-GOG-NTX 12) [FACIT] OMOP:42869121 - I have trouble remembering things in the past 7 days [FACIT] OMOP:42869145 - The amount I eat is sufficient to meet my needs in the past 7 days [FACIT] OMOP:42869155 - Stomach pain interferes with my daily functioning in the past 7 days [FACIT] OMOP:42869234 - I have had trouble recalling the name of an object while talking to someone in the past 7 days [FACIT] OMOP:42869280 - My partner worries about me when my blood counts are low in the past 7 days [FACIT] OMOP:42869292 - Functional Assessment of Cancer Therapy for patients with thrombocytopenia questionnaire -18 items - version 4 (FACT-Th18) [FACIT] OMOP:42869355 - Additional concerns - FACT-GOG-NTX [FACIT] OMOP:42869485 - Personnel Nine-digit postal code OMOP:42869555 - Reason medication not prescribed [Reported] OMOP:42869572 - I worry about dying or losing control since I took my last screen [M3] OMOP:42869608 - Oxygen saturation [Pure mass fraction] in Blood OMOP:42869699 - Michigan Alcoholism Screening Test [MAST] OMOP:42869709 - Ages and Stages Questionnaires [ASQ] OMOP:42869729 - VR-36 Role emotion (RE) score - oblique method OMOP:42869811 - Hepatitis B vaccination received OMOP:42869847 - Hip Dysfunction and Osteoarthritis Outcome Score [HOOS] OMOP:42869882 - Total score - Ages and Stages Questionnaires 4 months [ASQ] OMOP:42869895 - Interdialytic time [ESRD] OMOP:42869918 - How short of breath did you get preparing meals in the past 7 days [FACIT] OMOP:42869940 - How short of breath did you get carrying something weighing less than 5 lbs, about 2 kg, like a houseplant, from one room to another in the past 7 days [FACIT] OMOP:42869958 - I have swelling in parts of my body in the past 7 days [FACIT] OMOP:42870000 - Compared to what you expected, how do you rate the effectiveness of the treatment so far [FACIT] OMOP:42870003 - Do you feel you received the treatment that was right for you [FACIT] OMOP:42870020 - Comprehensive care [FACIT] OMOP:42870038 - Nurses [FACIT] OMOP:42870111 - I get ill easily in the past 7 days [FACIT] OMOP:42870115 - The cancer-tumor experience makes me a stronger person in the past 7 days [FACIT] OMOP:42870149 - The cancer-tumor experience makes my child a stronger person in the past 7 days [FACIT] OMOP:42870195 - My child eats as much as s-he wants in the past 7 days [FACIT] OMOP:42870206 - Social - family well-being - FAACT-parent_adoles [FACIT] OMOP:42870367 - CMS - history of present illness panel OMOP:42870397 - Was erythropoiesis-stimulating agent prescribed [ESRD] OMOP:42870410 - Antibiotic administered Medication OMOP:42870436 - Manager Dialysis facility [ESRD] OMOP:42870452 - Opening time Dialysis facility [ESRD] OMOP:42870545 - FBN1 gene mutation analysis limited to known familial mutations in Blood or Tissue by Molecular genetics method OMOP:42870563 - Bacterial vaginosis score in Vaginal fluid Qualitative by NAA with probe detection OMOP:4287097 - Wind scorpion OMOP:42872416 - Non-allergic rhinitis OMOP:42872455 - Ornithinibacillus californiensis OMOP:42872606 - Bundibugyo ebolavirus OMOP:42872623 - Ljungan virus OMOP:42872722 - Severe major depression OMOP:42872852 - Responds to pain OMOP:42872915 - ALK positive large B-cell lymphoma OMOP:42872947 - Myeloid/lymphoid neoplasm with FGFR1 rearrangement OMOP:42873055 - Coarctation of infrarenal abdominal aorta OMOP:42873163 - Hypertension complicating pregnancy, childbirth and the puerperium, antepartum OMOP:4287539 - Triazine compound toxicity OMOP:4287551 - Body composition OMOP:4287634 - Non-invasive (epithelial) ovarian tumor omental implants absent OMOP:4287870 - Salmonella Cremieu OMOP:4288156 - Ozena OMOP:4288230 - Tumor invades diaphragm OMOP:4288542 - Developmental test of visual perception OMOP:4288677 - Acute and chronic colitis OMOP:4288734 - Bronchiolar disease OMOP:4288868 - Nonobstructive cardiomyopathy OMOP:4288877 - Red tears OMOP:4289102 - Malignant tumor involving uterine corpus by direct extension from uterine cervix OMOP:4289304 - Hypochloremic alkalosis OMOP:4289462 - Euparyphium melis OMOP:4289476 - Beaded hair OMOP:4289592 - Myliobatis goodei OMOP:4289744 - Adenoiditis OMOP:4290067 - Simulium ochraceum OMOP:4290077 - Dermatophilosis caused by Dermatophilus congolensis OMOP:4290253 - Dactyloscopus tridigitatus OMOP:4290254 - Pancreatic colipase deficiency OMOP:4290325 - Bovicola limbata OMOP:4290440 - Salmonella Uno OMOP:4290728 - Acute effect of ultraviolet radiation on normal skin OMOP:4290821 - Common silver birch specific IgG antibody measurement OMOP:4290829 - Acquired plantar keratoderma OMOP:4290833 - Traumatic blister of lower limb OMOP:4290840 - In situ neoplasm of vulva OMOP:4290849 - Internal jugular phlebectasia OMOP:4290850 - Hamartoma of apocrine sweat gland apparatus OMOP:4290967 - Myopericytoma OMOP:4291003 - Moxostoma robustum OMOP:4291024 - Career frustration OMOP:4291304 - Dermatosis of eyelid OMOP:4291472 - Familial adrenocortical hypoplasia OMOP:4291652 - Magpie tanager OMOP:4291941 - Pleural friction rub OMOP:4292213 - Lichen simplex of vulva OMOP:4292230 - Early onset psoriasis type 1 OMOP:4292362 - Anaphylaxis caused by ingested food OMOP:4292547 - Lipomatosis OMOP:4292674 - Addictive behavior with potential to damage skin OMOP:4293283 - Mycobacterium kansasii infection of skin OMOP:4293286 - Actinomycetoma caused by Nocardia otitidis caviarum OMOP:4293580 - Subungual epidermoid inclusions OMOP:4293715 - Traumatic balanitis OMOP:4294288 - Problem with surgical scar OMOP:4294297 - Primary genetic mixed hyperlipidemia OMOP:4294390 - Trichophyton interdigitale OMOP:4294405 - Centaurium beyrichii OMOP:4294418 - Telangiectasia due to prolonged vasodilatation OMOP:4294430 - Reactive vascular proliferation of skin OMOP:4294442 - Pseudomonas aeruginosa folliculitis OMOP:4294517 - Paspalum dilatatum poisoning OMOP:4294666 - Open dislocation of distal end of tibia OMOP:4294680 - Hippus OMOP:4294964 - Discrimination inhibition on test performance OMOP:4295030 - Not yet sitting OMOP:4295158 - Plans for deliberate self harm without intent OMOP:4295176 - Sutton's ulcer (vulval aphthosis) OMOP:4295273 - Photogravure etcher OMOP:4295304 - Lupus erythematosus-associated anetoderma OMOP:4295319 - Idiopathic scrotal calcinosis OMOP:4295322 - Nail dystrophy due to nail picking OMOP:4295369 - Chronic perimetritis OMOP:4295443 - Brachymetacarpia OMOP:4295480 - Arsenic-induced skin pigmentation OMOP:4295484 - Poly Y syndrome OMOP:4295602 - BIDS brittle hair-impaired intellect-decreased fertility-short stature syndrome OMOP:4295614 - Plane basal cell papilloma OMOP:4295651 - Lymphoma stage finding OMOP:4296041 - Israel turkey meningoencephalitis virus OMOP:4296188 - Hypermelanosis due to phytophotodermatitis OMOP:4296189 - Solar pruritus OMOP:4296195 - Millipede burn OMOP:4296345 - Constitutionally-determined racial hirsutism OMOP:4296497 - Chronic infective balanitis OMOP:4296513 - Scleroderma-associated necrotizing vasculitis OMOP:4296602 - Peyote OMOP:4296611 - Chronic gastric ulcer without hemorrhage AND without perforation OMOP:4296615 - Toxic effect of acetone OMOP:4296619 - Plant pyrrolizidine alkaloid OMOP:4296652 - Ear, nose and throat microscopy, culture and sensitivities OMOP:4296728 - Polyneuritis OMOP:4296751 - Silvery-cheeked hornbill OMOP:4296795 - Oral fluid therapy education OMOP:4296900 - Purple sunbird OMOP:4297045 - Comminuted chicken meat suspension OMOP:4297141 - Ilarvirus group OMOP:4297159 - Minimal change myopathy OMOP:4297161 - Fistula of cul-de-sac OMOP:4297189 - Malignant melanoma of nail apparatus OMOP:4297202 - Endemic Kaposi sarcoma OMOP:4297339 - Pleomorphic lipoma OMOP:4297340 - Familial multiple lipomata OMOP:4297353 - Leukemic infiltration of skin (chronic T-cell lymphocytic leukemia) OMOP:4297354 - CD-30 negative cutaneous T-cell lymphoma OMOP:4297355 - Aggressive NK-cell leukemia involving skin OMOP:4297371 - Aircraft accident OMOP:4297464 - Pseudohypoaldosteronism OMOP:4297635 - Pleoptic training with continuing medical direction and evaluation OMOP:4297645 - Sea-urchin granuloma OMOP:4297663 - Secondary xanthomatous infiltration of the skin OMOP:4297674 - Basal cell carcinoma - third recurrence OMOP:4297753 - Bathmostomum OMOP:4297799 - Multiple benign melanocytic nevi OMOP:4297817 - Hypomelanosis surrounding melanocytic neoplasm OMOP:4297881 - Pseudomasturbation OMOP:4297982 - Hypertrophy of seminal vesicle OMOP:4297984 - Local infection of wound OMOP:4298026 - Squamous cell carcinoma of skin of face OMOP:4298130 - Mixed eccrine/pilar adnexal carcinoma of skin OMOP:4298140 - Epithelioid hemangioendothelioma OMOP:4298182 - Community health development OMOP:4298261 - Environmental management: community OMOP:4298271 - Impulse control training OMOP:4298385 - Anaphylaxis management OMOP:4298579 - Amazon kingfisher OMOP:4298598 - Atopic dermatitis of face OMOP:4298599 - Infantile atopic dermatitis OMOP:4298610 - Allergic contact gingivostomatitis OMOP:4298736 - Neonatal disorder of subcutaneous fat OMOP:4298849 - Primary perianal herpes simplex infection OMOP:4299004 - Disseminated cutaneous mycosis caused by Penicillium OMOP:4299012 - Skin injury due to animal OMOP:4299131 - Aggressive angiomyxoma OMOP:4299293 - Perforating granuloma annulare OMOP:4299311 - Surgical omental margin uninvolved by malignant neoplasm OMOP:4299332 - Tumor size, dominant nodule, in specimen obtained by prostatic enucleation OMOP:4299409 - Sporadic primary hypertriglyceridemia OMOP:4299422 - Basal cell carcinoma with signet ring change OMOP:4299432 - Discoid eczema of hand OMOP:4299450 - Anaerotignum lactatifermentans OMOP:4299457 - Fibrinolysis OMOP:4299520 - Partialism OMOP:4299521 - Sodium chloride poisoning OMOP:4299657 - Congenital absence of ureter OMOP:4299683 - Dark brown constitutive skin color OMOP:4299701 - Chronic diffuse alopecia OMOP:4299784 - Soybean protein OMOP:4299815 - Oral ulceration due to radiation burn OMOP:4299816 - Melanotic macule of oral mucosa (reactive type) OMOP:4299862 - Pneumonia caused by Histoplasma capsulatum OMOP:4299954 - Feeding problem OMOP:4299957 - Fetal disengagement OMOP:4299966 - Cutaneous lesion resulting from spina bifida OMOP:4299996 - PUVA therapy-associated basal cell carcinoma OMOP:4300102 - Arsenic-induced rain-drop hypomelanosis OMOP:4300116 - Squamous neoplasm of surface epithelium OMOP:4300123 - Hidradenitis suppurativa of vulva OMOP:4300177 - Self-induced disease OMOP:4300184 - Orepsyche angustella entomopoxvirus OMOP:4300188 - Lynchia OMOP:4300191 - Blood group antibody VA OMOP:4300222 - Streptococcal cellulitis of external ear OMOP:4300225 - Anetoderma secondary to syphilis OMOP:4300351 - Caterpillar dermatitis OMOP:4300471 - Intraepidermal squamous carcinoma of forehead OMOP:4300474 - Calliphora vomitoria OMOP:4300523 - Wuchereria OMOP:4300565 - Basal cell carcinoma of temple OMOP:4300595 - Neoplasm of endocrine system OMOP:4300644 - Quadricuspid cardiac valve OMOP:4300694 - Lymphomatoid papulosis with Hodgkin's disease OMOP:4300724 - Pineapple specific immunoglobulin E OMOP:4300795 - Multiple actinic keratoses involving hands OMOP:4300801 - Skin photosubtype IIc (initially always burn, eventual deep tan) OMOP:4300901 - Traumatic splinter hemorrhage OMOP:4300910 - Circumscribed alopecia areata of scalp OMOP:4301138 - Lasiodiplodia theobromae OMOP:4301142 - Lupus erythematosus-associated necrotizing vasculitis OMOP:4301302 - Hypertrophic Darier's disease OMOP:4301361 - Veillonella rodentium OMOP:4301406 - Periungual fibroma in tuberous sclerosis OMOP:4301428 - Spindle cell squamous cell carcinoma OMOP:4301460 - Meals on wheels provision assessment OMOP:4301548 - Breathing exercise education OMOP:4301602 - Thrombotic thrombocytopenic purpura OMOP:4301839 - Conalbumin specific immunoglobulin E OMOP:4301867 - Accessory hepatic duct OMOP:4301868 - Pulse rate OMOP:4301877 - Command hallucination OMOP:4301878 - Gurltia paralysans OMOP:4301949 - Congenital anomaly of the thymus OMOP:4302017 - Accidental death OMOP:43020397 - Hepatitis C virus subtype 1b OMOP:43020402 - Hepatitis C virus subtype 6a OMOP:43020405 - Hepatitis C virus genotype 2 OMOP:43020417 - Codependency OMOP:43020440 - Acquired arteriovenous fistula aneurysm OMOP:43020450 - Child victim of physical abuse OMOP:43020459 - Mechanical breakdown of prosthetic heart valve OMOP:43020542 - Escherichia coli serotype O177:nonmotile OMOP:43020547 - Neoplasm of fetal heart OMOP:43020556 - Flat curve of Spee OMOP:43020594 - Escherichia coli serotype O146:nonmotile OMOP:43020623 - Rupture of pulmonary valve cusp OMOP:43020624 - Disruption of pulmonary valve annulus OMOP:43020641 - Rupture of left atrioventricular (not morphologically mitral) valve papillary muscle OMOP:43020669 - Fatal infantile mitochondrial cardiomyopathy OMOP:43020678 - Escherichia coli serogroup O156 OMOP:43020719 - Escherichia coli serotype O124:H30 OMOP:43020727 - Escherichia coli serotype O119:nonmotile OMOP:43020757 - Escherichia coli serotype O22:H8 OMOP:43020774 - Escherichia coli serotype O42:H25 OMOP:43020776 - Escherichia coli serotype O43:H2 OMOP:43020794 - Fetal pulmonary outflow tract obstruction due to twin to twin transfusion syndrome OMOP:43020802 - Quercus laevis pollen OMOP:43020858 - Escherichia coli serotype O55:H12 OMOP:43020868 - Malrotation of intestine with midgut volvulus OMOP:43020911 - Stenosis of pulmonary great vein as complication of procedure OMOP:43020916 - Congenital subaortic stenosis due to restrictive ventricular septal defect associated with functionally univentricular heart OMOP:43020939 - Abnormal ventriculoarterial connection with usual origin of left coronary artery from aortic sinus to right of nonfacing aortic sinus and usual origin of right coronary artery from aortic sinus to left of nonfacing aortic sinus OMOP:43020959 - Stenosis of fetal aortic valve OMOP:43020961 - Stenosis of fetal right atrioventricular (not morphologically tricuspid) valve OMOP:43020980 - Escherichia coli serotype O111:H8 OMOP:4302099 - Tetanus toxoid specific immunoglobulin E OMOP:43021003 - Escherichia coli serotype O98:nonmotile OMOP:43021034 - Escherichia coli serotype O74:H25 OMOP:43021039 - Escherichia coli serotype O71:nonmotile OMOP:43021040 - Escherichia coli serotype O71:H28 OMOP:43021049 - Infective endocarditis of right atrioventricular (not morphologically tricuspid) valve OMOP:43021050 - Abscess at site of ventricular septal defect OMOP:43021056 - Monochorionic diamniotic twin pregnancy with similar amniotic fluid volumes OMOP:43021181 - Systemic to pulmonary collateral artery from left carotid artery OMOP:4302123 - Taxidea OMOP:43021255 - Mechanical complication of vascular implant OMOP:43021339 - Abscess of wall of truncus arteriosus OMOP:43021388 - Coronary arteriosclerosis excluded OMOP:43021407 - Displacement of musculoskeletal implant OMOP:43021429 - Anomalous common origin of brachiocephalic artery and left common carotid artery OMOP:43021430 - Anomalous origin of left common carotid artery from brachiocephalic artery OMOP:43021440 - Anomalous insertion of arterial ligament OMOP:43021448 - Anomalous origin of arterial ligament from right brachiocephalic artery OMOP:43021458 - Right arterial duct OMOP:43021467 - Anomalous origin of arterial duct from distal descending aorta OMOP:43021473 - Disorder of left atrioventricular (not morphologically mitral) valve prosthesis OMOP:43021491 - Lipid disorder follow up assessment OMOP:43021526 - Burn of eye region with full thickness burn of face OMOP:43021569 - Anomalous separate origins of internal carotid arteries and external carotid arteries from single aortic arch OMOP:43021606 - Acquired abnormality of right femoral vein OMOP:43021636 - Atresia of aortic arch with fibrous cord between left common carotid artery and right common carotid artery OMOP:43021722 - Acquired luminal obstruction of aortic arch between left common carotid artery and right common carotid artery OMOP:43021724 - Abnormality within thorax due to interruption of aortic arch OMOP:43021728 - Fetal pleural effusion OMOP:4302177 - City dweller OMOP:43021801 - Finding of aorta OMOP:43021850 - Sleep related hypoxemia OMOP:43021854 - Malignant hypertensive chronic kidney disease stage 2 OMOP:43021870 - Salter-Harris type IX OMOP:43021899 - Escherichia coli serotype O168:H14 OMOP:43021910 - Parapagus OMOP:43021931 - Occlusion of superior vena cava due to neoplasm OMOP:43022050 - Fetal fluid retention OMOP:4302243 - Environmental risk protection OMOP:4302295 - Crushing injury of testis OMOP:4302400 - Urinary elimination care OMOP:4302537 - Digestive system finding OMOP:4302604 - Pancreatic triacylglycerol lipase deficiency OMOP:4302765 - Endometritis OMOP:4302845 - Pine specific immunoglobulin E OMOP:4302890 - Aerialist OMOP:4302910 - United Church of Christ OMOP:4302960 - Amiodarone-induced corneal epithelial deposit OMOP:4303006 - Ginger specific immunoglobulin E OMOP:4303225 - Mature abnormal placenta OMOP:4303436 - Newborn monitoring OMOP:4303512 - Tubulointerstitial nephritis with uveitis syndrome OMOP:4303527 - Sarocladium OMOP:4303803 - Heartbeat nystagmus OMOP:4303876 - Arctocebus calabarenisi OMOP:4303877 - Genus Nycticebus OMOP:4304337 - Subcutaneous panniculitis-like T-cell lymphoma OMOP:4304351 - Atypical striated muscle cells of uncertain significance OMOP:4304396 - Mulibrey nanism syndrome OMOP:4304401 - Halobacterium noricense OMOP:4304437 - Transfusion transmission OMOP:4304448 - Pityrosporum orbiculare specific immunoglobulin E OMOP:4304458 - Goose feathers specific immunoglobulin E OMOP:4304593 - House dust (Hollister-Stier Labs) specific immunoglobulin E OMOP:4304680 - Artemisia filifolia OMOP:4304697 - Salmonella Marshall OMOP:4304782 - Helarctos malayanus OMOP:4304946 - Near visual acuity Jaeger's types - left eye OMOP:4305005 - Statistical clerk OMOP:4305008 - At increased risk for traumatic injury OMOP:4305226 - Lacrimal sac fistula OMOP:4305344 - Mechanical clitoral stimulation OMOP:4305392 - Moniliella pollinis OMOP:4305404 - Subfamily Aotinae OMOP:4305413 - Thanatophoric dysplasia, type 2 OMOP:4305419 - Brachydactyly syndrome type B OMOP:4305428 - Cole-Carpenter dysplasia OMOP:4305430 - Leishmania tropica complex OMOP:43054890 - Gestational age--at birth [RHEA] OMOP:43054984 - Severity of pain on average over the past 1 month [Reported] OMOP:43055069 - 3-Methylglutarate [Moles/volume] in Cerebral spinal fluid OMOP:43055116 - Androstenedione [Moles/volume] in Saliva (oral fluid) OMOP:43055151 - Myelin Ab [Presence] in Serum or Plasma by Immunofluorescence OMOP:43055281 - RNA polymerase III RP155 IgG Ab [Presence] in Serum or Plasma by Immunoassay OMOP:43055314 - Basophils/Leukocytes [Pure number fraction] in Synovial fluid by Manual count OMOP:43055370 - Monocytes/Leukocytes [Pure number fraction] in Blood by Automated count OMOP:43055442 - Apixaban [Mass/volume] in Serum or Plasma OMOP:43055448 - Oxazepam [Presence] in Saliva (oral fluid) OMOP:43055507 - Theophylline [Mass/volume] in Serum or Plasma --trough OMOP:43055545 - I didn't believe in my right to live in last week [BSL-23] OMOP:43055559 - t(11;14)(q13.2;q32)(MYEOV,IGH) fusion transcript [Identifier] in Blood or Tissue by FISH Nominal OMOP:43055565 - 7-Hydroxymitragynine [Mass/volume] in Urine by Confirmatory method OMOP:43055605 - Zolpidem/Creatinine [Mass Ratio] in Urine OMOP:4305615 - Electrocardiogram unchanged compared to prior study OMOP:4305661 - Infestation by Acarapis OMOP:4305667 - Bacillus amyloliquefaciens OMOP:4305714 - Marital conflict OMOP:4305962 - Heterakis spumosa OMOP:4306341 - Glaucoma drainage tube touching cornea OMOP:4306396 - Genus Myrmecophaga OMOP:4306449 - Acne estivalis OMOP:4306532 - Genus Nectogale OMOP:4306545 - Genus Micropotomogale OMOP:4306792 - Phoenicopterus ruber chilensis OMOP:4306797 - Spegazzinia OMOP:4306815 - High tear meniscus OMOP:4306829 - Starnoenas OMOP:4306977 - Zonotrichia OMOP:4306983 - Compensated movement at site of pain OMOP:4307136 - Agaricomycetidae OMOP:4307153 - Fulica gigantea OMOP:4307249 - Pluvialis dominica OMOP:4307311 - Mental health support groups staff facilitated - 1-3 contacts/month OMOP:4307373 - Basilar migraine OMOP:4307414 - Acetobacterium fimetarium OMOP:4307419 - Herpes simplex subepithelial infiltrates OMOP:4307456 - Urine salicylate level OMOP:4307574 - Squamous cell carcinoma of chin OMOP:4307805 - Lymphocyte antigen CD37 OMOP:4307966 - Hesperoleucus symmetricus OMOP:4308009 - Petechiae of skin OMOP:4308042 - Genus Callicebus OMOP:4308161 - Acetanaerobacterium elongatum OMOP:4308181 - Acetanaerobacterium OMOP:4308222 - Cephenemyia auribarbis OMOP:4308290 - Culex pipiens molestus OMOP:4308307 - Hippotragus OMOP:4308319 - Extreme drug resistant tuberculosis OMOP:4308394 - Infection and inflammatory reaction due to prosthetic device, implant and graft in urinary system OMOP:4308404 - Skin graft failure OMOP:4308432 - Echeneis neucratoides OMOP:4308458 - Aratinga wagleri OMOP:4308585 - Neonatal osteomyelitis of jaw OMOP:4308586 - Cheilanthes sinnata poisoning OMOP:4308772 - Corynebacterium aquilae OMOP:4308789 - Aegithina OMOP:4308934 - Malignant glioma of brainstem OMOP:4308946 - Hepatic coma due to chronic hepatitis B OMOP:4308954 - Maple leaf sycamore specific immunoglobulin E OMOP:4308961 - Horse chestnut (pollen) specific immunoglobulin E OMOP:4308971 - Tomato specific immunoglobulin E OMOP:4308997 - Prominence of screw OMOP:4309020 - Hyperstimulation of ovaries OMOP:4309063 - Behavior finding OMOP:4309071 - Oleavirus OMOP:4309179 - Latent bone cyst of jaw OMOP:4309186 - Housebuilder (general) OMOP:4309236 - Lasiurus cinereus OMOP:4309317 - Internal prosthetic device causing thrombus OMOP:4309331 - Postoperative cerebrospinal fluid leak OMOP:4309356 - Acute pneumothorax OMOP:4309381 - Otidiphaps OMOP:4309428 - Gadolinium-151 OMOP:4309487 - Crushing injuries of thorax with abdomen, lower back and pelvis with limb(s) OMOP:4309574 - Adenocarcinoma of anus OMOP:4309702 - Fulmarus glacialis OMOP:4309911 - Poorly shaped amputation stump OMOP:4309920 - Air embolism due to surgery OMOP:4309954 - Enanthematous infectious disease OMOP:4310106 - Nocomis platyrhynchus OMOP:4310136 - Zonotrichia leucophrys OMOP:4310146 - Sinistrocardia OMOP:4310279 - Unable to coordinate multiple appointments OMOP:4310286 - Wolf projection OMOP:4310297 - Ivory Coast ebolavirus OMOP:4310304 - Ptilinopus OMOP:4310374 - Local application / packing too cold OMOP:4310402 - Aphonopelma emilia OMOP:4310403 - Latrodectus pallidus OMOP:4310427 - Gymnogyps californianus OMOP:4310476 - Glutamic acid decarboxylase antibody level OMOP:4310632 - Genus Taurotragus OMOP:4310665 - Phlebitis of portal vein OMOP:4310714 - Malignant melanoma of unknown origin OMOP:4310829 - Sebastes fasciatus OMOP:4310836 - Bubulcus OMOP:4310909 - Succinylcholine specific IgE antibody measurement OMOP:4310937 - Solanum triflorum OMOP:4311104 - Gowers sign OMOP:4311136 - Phalaropus OMOP:4311146 - Acetonema OMOP:4311158 - Acute herpes zoster neuropathy OMOP:4311226 - Accidental poisoning by tranquilizers OMOP:4311253 - Lymphocyte antigen CD45RO OMOP:4311383 - Explosion caused by conflagration in travel trailer OMOP:4311413 - Dipylidium compactum OMOP:4311438 - Baculoviridae OMOP:4311457 - Phylloscopus OMOP:4311481 - Primary malignant neoplasm of inguinal region OMOP:4311521 - Accident due to fall from burning travel trailer OMOP:4311621 - Primary malignant neoplasm of soft tissues of shoulder OMOP:4311670 - Perineal laceration involving skin OMOP:4311716 - Seiurus aurocapilla OMOP:4311745 - Environment contains dangerous animal OMOP:4311812 - Mycocentrospora OMOP:4312035 - Membranous ventricular septum defect OMOP:4312169 - Accidental poisoning by bromobenzyl cyanide OMOP:4312185 - Mechanical failure of instrument or apparatus during infusion or transfusion OMOP:4312221 - External duodenal fistula OMOP:4312355 - Black-capped chickadee OMOP:4312438 - Explosion caused by conflagration in boarding house OMOP:4312456 - Supernumerary eye muscle OMOP:4312491 - Blood group antibody Cooper OMOP:4312593 - Secondary fibrositis OMOP:4312600 - Salmonella Paratyphi B OMOP:4312668 - Syrmaticus OMOP:4312687 - Primary malignant neoplasm of skin of scalp OMOP:4312704 - Necrobiosis lipoidica OMOP:4312732 - Profelis aurata OMOP:4312738 - Breslow measurement - depth less than 0.76 mm OMOP:4312832 - Accident involving battery powered mail trucks OMOP:4313121 - Poisoning caused by krait venom OMOP:4313142 - Autonomic pulmonary function OMOP:4313149 - Acquired ichthyosis OMOP:4313156 - Juvenile retinoschisis OMOP:4313313 - Acinetobacter parvus OMOP:4313347 - Pestalotiopsis OMOP:4313353 - Neoplasm of uncertain behavior of accessory sinus OMOP:4313371 - Neoplasm of uncertain behavior of carpal bone OMOP:4313415 - Infection by Micronema OMOP:4313574 - Icelinus quadriseriatus OMOP:4313624 - Difficulty with dressing lower body OMOP:4313640 - Chilomycterus antennatus OMOP:4313656 - Neoplasm of uncertain behavior of parietal pleura OMOP:4313667 - Burning due to contact with molten metal OMOP:4313766 - Malignant melanoma of retina OMOP:4313767 - Chronic peripheral venous hypertension OMOP:4313831 - Sulzberger-Chase phenomenon OMOP:4313841 - Congenital absence of gallbladder OMOP:4313844 - Electronic computer operator OMOP:4313951 - Accident caused by matches OMOP:4314031 - Corynebacterium casei OMOP:4314094 - Butted by animal OMOP:4314098 - Run over by unridden animal OMOP:4314100 - Transport vehicle washed off road by storm OMOP:4314120 - Poikilodermatomyositis OMOP:4314162 - Coracopsis vasa OMOP:4314178 - Bovine adenovirus C OMOP:4314217 - Neoplasm of uncertain behavior of cerebellum OMOP:4314218 - Neoplasm of uncertain behavior of chest wall OMOP:4314240 - Accidental poisoning by mescaline OMOP:4314265 - Hyperemia of eyelid OMOP:4314314 - Malignant mixed tumor of salivary gland OMOP:4314426 - HIV infection with acute lymphadenitis OMOP:4314431 - Congenital absence of appendix OMOP:4314440 - Congenital ectopia of lacrimal punctum OMOP:4314474 - Corythaixoides OMOP:4314567 - Blow fly OMOP:4314568 - Binasal hemianopia OMOP:4314589 - Vocalizes non-reduplicated syllables OMOP:4314647 - Neoplasm of uncertain behavior of esophagus OMOP:4314652 - Foreign object left in body during aspirating needle biopsy OMOP:4314687 - Endolimax gregariniformis OMOP:4314907 - Chronic arterial allograft rejection OMOP:4315106 - Accidental poisoning by indomethacin OMOP:4315156 - Accidental poisoning by opiate antagonists OMOP:4315249 - Accident caused by collapse of machinery OMOP:4315411 - Neoplasm of uncertain behavior of hepatic flexure of colon OMOP:4315528 - Neoplasm of uncertain behavior of muscle of inguinal region OMOP:4315937 - Neoplasm of uncertain behavior of brain stem OMOP:4315942 - Neoplasm of uncertain behavior of cervical esophagus OMOP:4315951 - Neoplasm of uncertain behavior of temporal lobe OMOP:4316052 - Neoplasm of uncertain behavior of ureteric orifice of urinary bladder OMOP:4316195 - Lactobacillus amylovorus OMOP:4316204 - Injection site pigmentation change OMOP:4316213 - Implant site reaction OMOP:4316326 - Accidental poisoning by toxaphene OMOP:4316361 - Red blood cell sequestration in liver OMOP:4316373 - Neonatal lupus erythematosus OMOP:4316495 - Neoplasm of uncertain behavior of inner aspect of lip OMOP:4316500 - Neoplasm of uncertain behavior of lateral wall of oropharynx OMOP:4316511 - Neoplasm of uncertain behavior of muscle of upper limb OMOP:4316735 - Neoplasm of uncertain behavior of temporal bone OMOP:4316739 - Neoplasm of uncertain behavior of transverse colon OMOP:4316743 - Neoplasm of uncertain behavior of ulna OMOP:4316751 - Neoplasm of uncertain behavior of vestibule of nose OMOP:4316993 - Adverse reaction to mephenesin OMOP:4317000 - Neoplasm of uncertain behavior of short bone of upper limb OMOP:4317002 - Neoplasm of uncertain behavior of skin of axilla OMOP:4317129 - Neoplasm of uncertain behavior of third cuneiform bone of foot OMOP:4317541 - Neoplasm of uncertain behavior of intrahepatic bile ducts OMOP:4317552 - Neoplasm of uncertain behavior of lower outer quadrant of female breast OMOP:4317654 - Accidentally struck by projected object OMOP:4317694 - Infestation by Pneumonyssus simicola OMOP:4317817 - Neoplasm of uncertain behavior of soft palate OMOP:4317944 - Adverse reaction to emetine OMOP:4317952 - Radiation retinopathy OMOP:4317962 - Neonatal lymphocytopenia OMOP:4317986 - Positional nystagmus OMOP:4318071 - Adverse reaction to blood plasma OMOP:4318107 - Hereditary dysplasminogenemia OMOP:4318117 - Mycoplasmal pharyngitis OMOP:4318233 - Alpha-aminoadipic acid OMOP:4318373 - Senile ichthyosis OMOP:4318385 - Juvenile GM2 gangliosidosis OMOP:4318544 - Renal tubular disorder OMOP:4318693 - Clouding of corneal stroma OMOP:4318717 - Abnormal jaw movement OMOP:4318864 - Cerebellar degeneration OMOP:4319013 - Trachinotus falcatus OMOP:4319124 - Yttrium-87 OMOP:4319157 - Staphylococcal eye infection OMOP:4319258 - Glossina fuscipes OMOP:4319268 - Catatonic rigidity OMOP:4319312 - Application site pigmentation changes OMOP:4319324 - Polymyalgia OMOP:4319326 - Diaphragmatic paresis OMOP:4319333 - Congenital absence of cranial vault OMOP:4319605 - Inflammation of orbit OMOP:4319770 - Discrete colliquative keratopathy OMOP:4320026 - Effects of exposure to extreme temperature, occupational OMOP:4320129 - Incontinentia pigmenti achromians syndrome OMOP:4320465 - Chronic erythema nodosum OMOP:4320621 - Salmonella Cairns OMOP:4320631 - Depranidotaeniosis OMOP:4320634 - Fracture of base of thumb OMOP:4320782 - Scaphirhynchus platorynchus OMOP:4320784 - Physa parkeri OMOP:4320798 - Cryptacanthodes maculatus OMOP:4320834 - Normal drug tolerance OMOP:4321082 - Paradox frog OMOP:4321133 - Spindle cell sarcoma OMOP:4321146 - Blister of scapular region without infection OMOP:4321226 - Sericulture worker OMOP:4321232 - Streptococcal pleurisy with effusion OMOP:4321242 - Salmonella Gelsenkirchen OMOP:4321254 - Colony forming unit-mixed OMOP:4321550 - Perinatal apneic spells OMOP:4321594 - Wet gangrene OMOP:4321605 - Paraganglioma, malignant OMOP:4321846 - Salmonella Potosi OMOP:4321860 - Major histocompatibility complex OMOP:4321893 - Fracture of neural arch OMOP:4321990 - Bothus ocellatus OMOP:4322043 - Etheostoma punctulatum OMOP:4322058 - Clostridium celatum OMOP:4322086 - Toxic retinopathy OMOP:4322151 - Pholis dolichogaster OMOP:4322195 - Mixed islet cell and exocrine adenocarcinoma OMOP:4322225 - Educational barrier impedes ability to use community resources OMOP:4322387 - Squamous cell carcinoma of lung, TNM stage 3 OMOP:4322404 - Rallus aquaticus OMOP:4322405 - Conjunctival discharge OMOP:4322407 - Stab wound OMOP:4322528 - Abdominal colic OMOP:4322576 - Congregationalist, follower of religion OMOP:432260 - Primary malignant neoplasm of upper third of esophagus OMOP:4322641 - Tungsten-185 OMOP:4322727 - Arsenicicoccus bolidensis OMOP:4322739 - Diverticulitis of sigmoid colon OMOP:432295 - Pernicious anemia OMOP:4322981 - Microsporum equinum OMOP:4323204 - Trichomonal vaginitis in pregnancy OMOP:4323222 - Ethiopian Orthodox Tewahedo, follower of religion OMOP:4323426 - Hemosiderin pigmentation OMOP:4323688 - Cough at rest OMOP:4323698 - Mixed lymphocyte culture assay OMOP:4323718 - Dioscin OMOP:4323825 - Acidemia OMOP:4324114 - Pregnanetriol OMOP:4324152 - Interchromatin granule OMOP:4324184 - Chlorhexidine specific immunoglobulin E OMOP:4324281 - Complete trisomy 22 syndrome OMOP:4324389 - Festuca rubra var. commutata OMOP:432452 - Anemia of prematurity OMOP:4324528 - Clostridioides mangenotii OMOP:432467 - Open fracture of fourth cervical vertebra OMOP:4324891 - New Kadampa Tradition Buddhist, follower of religion OMOP:4325278 - Superbine OMOP:4325279 - Old and recent infarct OMOP:4325451 - Benzidine OMOP:4325705 - Mycobacterium cosmeticum OMOP:4325845 - Metal foreign body in anterior region of neck OMOP:432596 - Immune defect OMOP:4326243 - Renal glucosuria, type A OMOP:4326255 - Abdominal abscess OMOP:432632 - Secondary noninfectious iridocyclitis OMOP:432638 - Brawny scleritis OMOP:4326400 - Crystal identification of synovial fluid OMOP:4326405 - Blood group antigen AnWj OMOP:4326515 - Crack cocaine misuse OMOP:4326596 - Ytterbium isotope OMOP:4326959 - Methylosphaera OMOP:4326983 - Brevibacillus limnophilus OMOP:4326988 - Borrelia turcica OMOP:4326993 - Articular cartilage disorder of knee OMOP:4327043 - Infection by Houttuynia OMOP:4327058 - Postgastrectomy phytobezoar OMOP:4327197 - Infection by Plagiorchis OMOP:4327400 - Mycobacterium visibilis OMOP:432746 - Open fracture of shaft of radius and ulna OMOP:4327595 - Mycobacterium montefiorense OMOP:4327645 - Inspiratory crackles OMOP:4327825 - Theileria parva OMOP:4327863 - Streptococcus pyogenes type emm12 OMOP:4327930 - Acquired arteriovenous fistula of heart OMOP:4327942 - Kobus leche OMOP:4327957 - Polyradiculopathy OMOP:4328101 - Bifidobacterium indicum OMOP:4328143 - Leuconostoc inhae OMOP:4328164 - Flexibacter aurantiacus OMOP:4328231 - Acute and chronic inflammation OMOP:4328232 - Nosema heliothidis OMOP:4328349 - Disturbance of attention OMOP:4328351 - Azocarmine G (GX) stain OMOP:432843 - Primary malignant neoplasm of tail of pancreas OMOP:4328666 - Abscess of medulla of spinal cord caused by Histoplasma OMOP:4328732 - Haematobia stimulans OMOP:4328808 - Mycobacterium parmense OMOP:4329911 - Nocardia araoensis OMOP:433000 - Patellar tendonitis OMOP:4330020 - Bottled propane gas OMOP:4330151 - Cytomegaloviral retinitis OMOP:4330231 - Short stature due to radiation therapy OMOP:4330576 - Training in Braille or Moon OMOP:4330630 - Brevibacterium sanguinis OMOP:4330857 - Setosphaeria rostrata OMOP:433094 - Failure in dosage OMOP:4330995 - 9q partial trisomy syndrome OMOP:4331085 - Fetal hydronephrosis OMOP:4331168 - Obstetrical pulmonary fat embolism OMOP:4331520 - Hylemonella OMOP:4331521 - Latilactobacillus fuchuensis OMOP:4331647 - Desulfovibrio burkinensis OMOP:4331669 - Abscess of tricuspid valve OMOP:4331670 - Infection of bloodstream OMOP:4331730 - HLA-DRw18 antigen OMOP:433180 - Hallucinogen dependence OMOP:4331811 - Schleiferilactobacillus perolens OMOP:4331951 - Halomonas anticariensis OMOP:4332177 - High insoluble fiber food OMOP:433218 - Thrombophlebitis of superficial veins of upper extremities OMOP:4332246 - Aneurysm OMOP:433244 - Tooth loss OMOP:4332523 - Education about infant nutrition at 10-12 months OMOP:433260 - Mother delivered OMOP:4333341 - Referral to prosthodontic service OMOP:4333764 - Lampropedia OMOP:4333984 - Avulsion of eyelid OMOP:433413 - Disease caused by Adenovirus OMOP:4334167 - Gemmobacter OMOP:4334238 - Peripapillary choroidal sclerosis OMOP:4334262 - Esotropia with nystagmus OMOP:4334310 - Nitrosococcus OMOP:433451 - Aggressive unsocial conduct disorder OMOP:433467 - Sleep-wake schedule disorder, delayed phase type OMOP:4334726 - Thermal burn of eyelid OMOP:4334744 - Foreign body in sclera OMOP:4334745 - Ciliary staphyloma OMOP:4334799 - Lentilactobacillus kefiri OMOP:4334801 - Surgical site infection OMOP:433484 - Local orbit deformity associated with bone disorder OMOP:4334955 - Oceanimonas doudoroffii OMOP:4335086 - Muricauda ruestringensis OMOP:4335235 - Family Frankiaceae OMOP:4335747 - Disorder of inner ear OMOP:433578 - Acquired cavovarus deformity of foot OMOP:4335893 - Chemical burn injury to conjunctiva OMOP:4335981 - Idiopathic anterior uveitis OMOP:4335983 - Traumatic hyphema OMOP:4335988 - Bacterial chorioretinitis OMOP:4335994 - Snail-track retinal degeneration OMOP:4336002 - Photocoagulation burn to retina OMOP:4336006 - Progressive rod dystrophy OMOP:4336054 - Family history of cleft palate with cleft lip OMOP:4336069 - Ambystoma OMOP:4336137 - Index myopia OMOP:4336140 - Infective paralysis of accommodation OMOP:4336216 - Salmonella Mkamba OMOP:4336246 - Infestation by Otobius OMOP:4336402 - Lower respiratory fluid OMOP:433652 - Motor vehicle traffic accident involving collision, on highway, between motor vehicle and bridge, motor cyclist injured OMOP:4336526 - Protostrongylus brevispiculum OMOP:433657 - Fall from furniture OMOP:4337316 - Painless pancreatitis OMOP:4337460 - Dilatation of the vestibular aqueduct OMOP:4337516 - Technetium (99-Tc) lidofenin OMOP:433752 - Impulse control disorder OMOP:433759 - Developmental reading disorder OMOP:4337692 - Poisoning by chlorpromazine OMOP:433773 - Chronic inflammation of orbit OMOP:4338035 - Depersonalization-derealization syndrome OMOP:433805 - Abnormal jaw closure OMOP:433837 - Obstetric nipple infection with postnatal complication OMOP:4338371 - Hypsurus caryi OMOP:4338541 - Catharanthus pusilla OMOP:4338665 - Fistularia tabacaria OMOP:4338763 - Conjunctival wound OMOP:4338817 - Abnormal endochondral bone formation OMOP:4338882 - Nonperforating wound of cornea OMOP:4338951 - Cyrnea piliata OMOP:4338977 - Marginal placenta previa with intrapartum hemorrhage OMOP:4339011 - Central retinal vein occlusion - juvenile OMOP:4339017 - X-linked retinitis pigmentosa heterozygote OMOP:4339020 - Retinal pigment epithelial detachment with vascularization OMOP:4339222 - Dysgraphia OMOP:4339308 - Copper (64-Cu) versenate OMOP:4339322 - Rotavirus group D OMOP:4339421 - Erysipelothrix OMOP:4339422 - Istiophorus platypterus OMOP:433943 - Foreign object left in body during heart catheterization OMOP:4339475 - Neurodermatitis of external ear OMOP:433966 - Pinta OMOP:434033 - Chorioretinitis OMOP:4340370 - Acute pseudo-obstruction of small intestine OMOP:4340380 - Hepatitis C carrier OMOP:4340492 - Anastomotic biliary stricture OMOP:4340524 - Duodenal anastomotic leak OMOP:4340932 - Acute intestinal pseudo-obstruction OMOP:4341073 - Drug-induced chronic pancreatitis OMOP:4341078 - Duodenal papillary stenosis OMOP:4341231 - Tracheo-esophageal fistula without atresia of esophagus OMOP:4341250 - Gastric anastomotic leak OMOP:434143 - Anophthalmos OMOP:4341532 - Factory worker OMOP:4341628 - Postprocedural pancreatic steatorrhea OMOP:434166 - Closed fracture of vault of skull with intracranial hemorrhage OMOP:434167 - Cold injury syndrome of newborn OMOP:4341779 - Peritoneal foreign body OMOP:434178 - Open fracture of mandible, coronoid process OMOP:4341793 - Gastric anastomotic stricture OMOP:4341796 - Stomal bleeding OMOP:434223 - Poisoning by psychotropic agent OMOP:434231 - Burn confined to eye and adnexa OMOP:4342647 - Hamartoma of stomach OMOP:4342660 - Small bowel fistula OMOP:4342749 - Chronic radiation proctitis OMOP:4342768 - Mesenteric gangrene OMOP:4342895 - Inferior lumbar hernia OMOP:4342904 - Gastrointestinal anastomotic hemorrhage OMOP:4342905 - Gastric anastomotic hemorrhage OMOP:434311 - Disorder of the urea cycle metabolism OMOP:4343235 - Wound discharge OMOP:4343567 - Percutaneous test for allergy OMOP:4344038 - Postcalcaneal bursitis OMOP:4344042 - Muscular dystrophy with predominantly proximal limb girdle distribution OMOP:4344151 - Rupture of popliteal bursa OMOP:438657 - Antimycobacterial agent adverse reaction OMOP:434416 - Maternal tuberculosis during pregnancy, childbirth and the puerperium OMOP:4344160 - Drug-induced polymyositis OMOP:4344165 - Undifferentiated connective tissue disease OMOP:4344373 - Trichinosis myositis OMOP:4344496 - Calcification of ligament OMOP:4344515 - Soft tissue lesion of lower leg and ankle OMOP:434500 - Closed fracture of neck of femur OMOP:4345227 - Facial erysipelas OMOP:4345329 - Prolapsed cervical intervertebral disc OMOP:4345334 - Limb length discrepancy OMOP:434539 - Adverse reaction to anticoagulant antagonists OMOP:4345566 - Myopathy with cytoplasmic inclusions OMOP:4345692 - Viral food poisoning OMOP:4345706 - Fish tank granuloma OMOP:4345803 - Recurrent anogenital herpes OMOP:434584 - Kaposi's sarcoma (clinical) OMOP:434588 - Primary malignant neoplasm of parotid gland OMOP:434592 - B-cell lymphoma (clinical) OMOP:4345926 - Abdominal angina OMOP:4346194 - Erythrokeratoderma en cocardes OMOP:4346279 - Rhabdomyomatous mesenchymal hamartoma OMOP:434633 - Disorder of autonomic nervous system OMOP:434656 - Vertebral artery syndrome OMOP:4347163 - Ligamentous laxity of elbow region OMOP:4347298 - Adult idiopathic generalized osteoporosis OMOP:4347301 - Osteoporotic vertebral collapse OMOP:4347406 - Disorder of tendon repair OMOP:4347425 - Enterotoxigenic Escherichia coli food poisoning OMOP:4347430 - Clostridial enteric disease OMOP:4347556 - Ulcerated cutaneous rhinosporidiosis OMOP:4347562 - Splenic schistosomal giant cell lymphoma OMOP:434767 - Open Colles' fracture OMOP:4348026 - Trabulsiella guamensis OMOP:434953 - Orbital granuloma OMOP:435076 - Transient neonatal thrombocytopenia OMOP:435181 - Infection by Trypanosoma gambiense OMOP:435205 - Benign neoplasm of oropharynx OMOP:435207 - Nodular lymphoma of lymph nodes of head, face and neck OMOP:4352246 - Pyloric obstruction OMOP:4352768 - Paecilomyces viridis OMOP:43530606 - Sequela of traumatic intracranial hemorrhage OMOP:43530624 - Psychosocial dysfunction due to chronic pain OMOP:43530687 - Dysarthria as late effects of cerebrovascular disease OMOP:43530699 - Sprain of ankle grade I OMOP:43530750 - Bacteremia caused by Gram-negative bacteria OMOP:43530756 - Post-traumatic nerve entrapment OMOP:43530849 - Bowing deformity of lower leg OMOP:43530867 - At low risk for dental caries OMOP:43530875 - Non-allergic hypersensitivity reaction caused by sulfite OMOP:43530908 - Induced termination of pregnancy complicated by damage to pelvic organs and/or tissues OMOP:43530947 - Induced termination of pregnancy complicated by tetanus OMOP:43530949 - Sprain of ankle grade III OMOP:43530970 - Gestational trophoblastic lesion OMOP:43531007 - Pre-existing diabetes mellitus in pregnancy OMOP:43531010 - Pre-existing type 2 diabetes mellitus in pregnancy OMOP:43531016 - Maturity-onset diabetes of the young, type 9 OMOP:43531057 - Finding of upper trunk OMOP:43531130 - Internal disc disruption OMOP:43531230 - Genus Plasmodium trophozoite OMOP:43531256 - Oocyst of Cystoisospora belli OMOP:43531273 - Hymenolepis diminuta larva OMOP:43531284 - Opisthorchis viverrini adult OMOP:43531320 - Microscopic cytologic examination of smear of specimen from liver prepared using Papanicolaou technique OMOP:43531335 - Ascaris lumbricoides adult OMOP:43531340 - Enterobius vermicularis adult OMOP:43531371 - Family Ancylostomatidae adult OMOP:43531419 - Short cervical length in pregnancy OMOP:43531483 - Hemorrhage of pancreatic duct OMOP:43531524 - Lives in apartment without elevator access OMOP:43531527 - Lives in detached house OMOP:43531585 - Central sleep apnea due to periodic breathing OMOP:43531604 - Subacute dyskinesia caused by drug OMOP:43531609 - Sequela of ischemic cerebral infarction OMOP:43531610 - Spasticity as sequela of stroke OMOP:43531625 - Intracranial epidural granuloma OMOP:43531661 - Functional gait abnormality OMOP:43531684 - Escherichia coli serotype O127:H21 OMOP:43531715 - Induced termination of pregnancy complicated by pelvic peritonitis OMOP:43533180 - Mobility: walking & moving around functional limitation, discharge status, at discharge from therapy or to end reporting (Deprecated) OMOP:43533181 - Changing & maintaining body position functional limitation, discharge status, at discharge from therapy or to end reporting (Deprecated) OMOP:43533194 - Elevated or hypertensive blood pressure reading documented, indicated follow-up not documented, reason not given OMOP:43533276 - Mapcp demonstration - community health teams OMOP:43533327 - Other physical or occupational therapy subsequent functional limitation, discharge status, at discharge from therapy or to end reporting (Deprecated) OMOP:438527 - Juvenile osteochondrosis of lower extremity, excluding foot OMOP:43533365 - Functional outcome assessment using a standardized tool is documented within the previous 30 days and a care plan, based on identified deficiencies is documented within two days of the functional outcome assessment OMOP:43533460 - Clindamycin induced platelet IgG Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43533479 - chlordiazePOXIDE induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43533528 - Benztropine induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43533649 - Ceftolozane+Tazobactam [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:43533661 - Premafloxacin [Susceptibility] by Disk diffusion (KB) OMOP:43533782 - Infant was transferred within 24 hours of delivery [US Standard Certificate of Live Birth] OMOP:43533811 - Mobility [NSRAS] OMOP:43533853 - Fall risk assessment OMOP:43533858 - Bacteria.extended spectrum beta lactamase resistance [Identifier] in Anal by Organism specific culture OMOP:43533968 - JWH-200 (synthetic cannabinoid) [Presence] in Blood OMOP:43534068 - Telavancin [Susceptibility] by Minimum inhibitory concentration (MIC) OMOP:43534258 - Venlafaxine induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43534282 - traMADol induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43534497 - ISOtretinoin induced platelet IgG Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43534522 - HYDROcodone induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:43534542 - Furosemide induced platelet IgM Ab [Presence] in Serum or Plasma by Flow cytometry (FC) OMOP:435369 - Fetal distress, in liveborn infant OMOP:4353726 - Cochlear microphonic OMOP:4354083 - Peripheral pulmonary artery disease OMOP:435445 - Accident caused by hunting rifle OMOP:435446 - Late effect of self inflicted injury OMOP:435448 - War injury due to shotgun bullet OMOP:435450 - Complication of injection OMOP:435474 - Primary malignant neoplasm of posterior hypopharyngeal wall OMOP:435487 - Primary malignant neoplasm of posterior mediastinum OMOP:435492 - Nodular lymphoma of intrathoracic lymph nodes OMOP:435510 - Hypocalcemia OMOP:435657 - Dyssomnia OMOP:435660 - Open fracture of symphysis of body of mandible OMOP:435681 - Brain injury with open intracranial wound AND concussion OMOP:435714 - Adverse reaction to hallucinogen OMOP:435774 - Disorder of amino acid metabolism OMOP:435808 - Diffuse secondary choroid atrophy OMOP:435835 - Non-infectious disorder of lymphatics OMOP:435843 - Non-working interference functional occlusion OMOP:435846 - Acute gastrojejunal ulcer with perforation AND obstruction OMOP:435853 - Pulmonary alveolar proteinosis OMOP:435904 - Derangement of anterior horn of medial meniscus OMOP:435992 - Accident caused by lifting machines and appliances OMOP:435998 - Accident caused by prime mover OMOP:436031 - Syphilitic endocarditis OMOP:436043 - Overlapping malignant neoplasm of tongue OMOP:436188 - Furuncle of neck OMOP:436245 - Atypical glandular cells on vaginal Papanicolaou smear OMOP:436308 - Accident caused by air rifle OMOP:436318 - Accidental poisoning by sulfur dioxide OMOP:436384 - Subchronic disorganized schizophrenia with acute exacerbations OMOP:436398 - Glaucoma associated with ocular disorder OMOP:436426 - Malleus mobility reduced OMOP:436582 - Contaminated substance injected or used for vaccination OMOP:436583 - Fall OMOP:436594 - Antimalarial drug adverse reaction OMOP:436601 - Injury due to war operations but occurring after cessation of hostilities OMOP:436604 - Adverse reaction to purine derivative diuretic OMOP:436624 - Late congenital syphilis, latent (+ sero., - C.S.F., 2 years OR more) OMOP:436658 - Vitamin deficiency OMOP:436826 - Closed fracture of shaft of radius OMOP:436954 - Drug abuse OMOP:437090 - Hemolytic disease of fetus OR newborn due to ABO immunization OMOP:437200 - Injury of unknown intent by hunting rifle OMOP:437473 - Toxic effect of caustic alkali OMOP:437529 - Mixed bipolar I disorder in partial remission OMOP:437618 - Incomplete inevitable miscarriage complicated by genital tract and pelvic infection OMOP:437692 - Open fracture of midcervical section of femur OMOP:437732 - Toxic effect of chromium OMOP:437872 - Rupture in Descemet's membrane OMOP:437937 - Grand multipara OMOP:438035 - Machinery accident in water transport OMOP:438155 - Glaucomatous atrophy of optic disc OMOP:438242 - Talipes equinovarus OMOP:438279 - Extradural hemorrhage following injury with open intracranial wound AND loss of consciousness OMOP:438290 - Partial thickness burn of neck OMOP:438310 - Victim, motorcycle rider in vehicular AND/OR traffic accident OMOP:438365 - Phaeohyphomycosis OMOP:438386 - Carcinoma in situ of vulva OMOP:438390 - Benign neoplasm of vulva OMOP:438411 - Endophthalmitis OMOP:438440 - Postmastoidectomy complication OMOP:438666 - Accidental poisoning by oil colors OMOP:438680 - Laryngeal diphtheria OMOP:438688 - Sarcoidosis OMOP:438724 - Subchronic disorganized schizophrenia OMOP:438748 - Paving stone retinal degeneration OMOP:438762 - Chronic lacrimal canaliculitis OMOP:438777 - Papillary muscle disorder OMOP:438791 - Pulmonary congestion and hypostasis OMOP:438929 - Acute reaction to foreign substance accidentally left during a procedure OMOP:439011 - Progressive iris atrophy OMOP:439030 - Degenerative disorder of sclera OMOP:439262 - Single manic episode, severe, with psychosis OMOP:439265 - Sézary's disease of intrathoracic lymph nodes OMOP:439278 - Convergence insufficiency OMOP:439281 - Hodgkin's disease, lymphocytic depletion of spleen OMOP:439395 - Emotional abuse of child OMOP:439407 - Disorder of nasal cavity OMOP:439473 - Accidental drowning or immersion during rescue attempt person OMOP:439478 - Foreign body in ciliary body OMOP:439491 - Accident due to reduction air pressure - ascent from diving OMOP:439502 - Postoperative pain OMOP:439534 - Injury from voluntary parachute descent, without accident to aircraft, occupant of military aircraft injured OMOP:439548 - Injury from machinery on aircraft, without accident to aircraft, crew of commercial aircraft in surface to surface transport injured OMOP:439580 - Burning caused by conflagration in theater OMOP:439630 - Failure of sterile precautions during injection or vaccination OMOP:439745 - Primary malignant neoplasm of salivary gland duct OMOP:439781 - Localized dissociative amnesia OMOP:439836 - Atheromatous embolus of upper limb OMOP:440063 - Benign neoplasm of pancreas, excluding islets of Langerhans OMOP:440091 - Introverted personality disorder OMOP:440287 - Atomic power plant malfunction in watercraft, occupant of small powered boat injured OMOP:440539 - Open fracture of alveolar border of body of mandible OMOP:440546 - Open fracture of distal end of radius OMOP:440550 - Cortex contusion with open intracranial wound AND concussion OMOP:440686 - Residual schizophrenia in remission OMOP:440758 - Posteruptive color change of tooth OMOP:440896 - Railway accident OMOP:440898 - Motor vehicle traffic accident involving collision with another motor vehicle, stopped, motor cyclist injured OMOP:440948 - Disease caused by Ancylostomatoidea OMOP:440996 - Cannabis dependence in remission OMOP:441206 - Analgesic adverse reaction OMOP:441259 - Non-thrombocytopenic purpura OMOP:441264 - Primary thrombocytopenia OMOP:441775 - Tuberculosis of meninges OMOP:441800 - Primary malignant neoplasm of descending colon OMOP:441897 - Chronic duodenal ileus OMOP:442011 - Mechanical complication due to cardiac pacemaker electrode OMOP:442038 - Anaphylactic shock caused by serum OMOP:442130 - Open wound of tongue with complication OMOP:442139 - Primary malignant neoplasm of bronchus OMOP:442274 - Oligomenorrhea OMOP:442295 - Disorder of carbohydrate transport OMOP:442349 - Closed multiple fractures of both lower limbs OMOP:442357 - Trampled by animal being ridden, rider of animal injured OMOP:442425 - Lumbar post-laminectomy syndrome OMOP:442427 - Cervical post-laminectomy syndrome OMOP:442466 - Noncollision motor vehicle traffic accident involving being hit by object thrown into or on motor vehicle while in motion, rider of animal or occupant of animal-drawn vehicle injured OMOP:442487 - Run over by rolling stock - railway employee OMOP:442543 - Monoplegic cerebral palsy OMOP:442574 - Blister of foot with infection OMOP:442593 - Deep third degree burn of scapular region OMOP:442641 - Macrotia OMOP:442652 - Noncollision motor vehicle traffic accident involving fire starting in motor vehicle while in motion, driver of motor vehicle injured OMOP:442723 - Fire on aircraft while in transit, occupant of commercial aircraft in surface to air transport injured OMOP:442730 - Explosion on aircraft while in transit, occupant of commercial aircraft in surface to air transport injured OMOP:442733 - Explosion on aircraft while in transit, occupant of spacecraft injured OMOP:442754 - Convergence excess OMOP:442759 - Gerstmann-Straussler-Scheinker syndrome OMOP:442795 - Deep third degree burn of neck OMOP:442864 - Splinter of elbow, without major open wound, infected OMOP:442877 - Forced land on landing - parachutist injured OMOP:443115 - Closed fracture finger proximal phalanx OMOP:443286 - Uterine contractions problem OMOP:443340 - Neuroleptic adverse reaction OMOP:443341 - Chloral hydrate adverse reaction OMOP:443367 - Antihypertensive adverse reaction OMOP:443371 - Antiarrhythmic drug adverse reaction OMOP:443388 - Malignant tumor of lung OMOP:443395 - Victim of bio-terrorism OMOP:443402 - Complication of puncture procedure OMOP:443416 - Acquired vaginal enterocele OMOP:443441 - Imaging finding OMOP:443517 - Explosion in watercraft, occupant of small unpowered boat injured OMOP:443524 - Mixed urinary incontinence OMOP:443533 - Male epispadias OMOP:443564 - Malignant neoplasm of bone OMOP:443585 - Abrasion and/or friction burn of multiple sites OMOP:443589 - Burn of nasal septum OMOP:443594 - Nonvenomous insect bite of multiple sites with infection OMOP:443607 - Acquired torsion dystonia OMOP:443636 - Explosion in watercraft, water skier injured OMOP:443695 - Fetal death from asphyxia AND/OR anoxia during labor OMOP:443708 - Malignant neoplasm detected by Papanicolaou smear of cervix OMOP:443796 - Infectious peritonitis OMOP:443804 - Nontraffic accident involving being hit by motor-driven snow vehicle, driver of motor vehicle injured OMOP:443814 - Nontraffic accident involving breakage of part of motor-driven snow vehicle, occupant of tram injured OMOP:443860 - Superficial injury of toe with infection OMOP:443861 - Open wound of foot except toes with complication OMOP:443912 - Poisoning by butyrophenone-based tranquilizer OMOP:443948 - Open dislocation of sixth cervical vertebra OMOP:444083 - Syphilitic myocarditis OMOP:444096 - Poisoning due to sting of hornet OMOP:444115 - Disorder of bursa OMOP:444145 - Burned while ship on fire, occupant of small unpowered boat injured OMOP:444403 - Injury of bronchus with open wound into thoracic cavity OMOP:444439 - Nonvenomous insect bite of thigh without infection OMOP:444446 - Gonococcal iridocyclitis OMOP:44515712 - Other specified high cost gastrointestinal drugs OMOP:44517090 - Other specified minimal access to other body cavity OMOP:44782152 - CHEMO ASSESS FOR FATIGUE L4 (Deprecated) OMOP:44782442 - Atrial fibrillation with rapid ventricular response OMOP:44782472 - Matrix stone OMOP:44782482 - Infant hypothyroidism caused by maternal drug OMOP:44782551 - Embolism of middle cerebral artery OMOP:44782555 - Asymmetric mandibular arch form OMOP:44782572 - Subependymal nodular heterotopia OMOP:44782614 - Streptococcus pyogenes type emm104 OMOP:44782629 - Cared for by female head of household OMOP:44782632 - Ataxia-telangiectasia-like disorder OMOP:44782689 - Chronic kidney disease stage 4 due to hypertension OMOP:44782690 - Chronic kidney disease stage 5 due to hypertension OMOP:44782702 - Acquired keratosis pilaris OMOP:44782744 - Acute deep venous thrombosis of tibial vein OMOP:44782778 - Pain disorder with psychological factor OMOP:44782902 - Main spoken language Kalaallisut OMOP:44782913 - Main spoken language Tibetan OMOP:44782921 - Main spoken language Yiddish OMOP:44782927 - Arthropathy associated with cystic fibrosis OMOP:44783016 - Calculus of gallbladder with acute and chronic cholecystitis OMOP:44783021 - Prominent renal pelvis OMOP:44783137 - Perry syndrome OMOP:44783146 - Detachment of line from totally implantable venous access device hub OMOP:44783257 - Inflammatory esophagogastric polyp OMOP:44783278 - Shinella zoogloeoides OMOP:44783319 - Fear of deafness OMOP:44783320 - Itching of ear OMOP:44783340 - Leishmania tropica trophozoite OMOP:44783346 - Shovel-shaped incisor OMOP:44783400 - Dental caries class VI OMOP:44783436 - Barium sulfate embolism OMOP:44783459 - Genus Plasmodium schizont OMOP:44783554 - Bimaxillary retrusion OMOP:44783560 - Enthesophyte OMOP:44783616 - Main spoken language Occitan OMOP:44783643 - Intermittent hypertension OMOP:44783681 - Vertical fracture of tooth without pulp involvement OMOP:44783690 - Mesocephalic face OMOP:44783757 - Alphacoronavirus 1 OMOP:44783791 - Coronary microvascular dysfunction OMOP:44783836 - Vertical maxillary excess OMOP:44783873 - Brown-Vialetto-Van Laere syndrome OMOP:44783874 - Duane-radial ray syndrome OMOP:44783959 - Hyperplasia of salivary gland OMOP:44784151 - Streptococcus agalactiae serotype V/R OMOP:44784163 - Varicocele palpable with Valsalva maneuver only OMOP:44784264 - Consultation for malignant neoplasm disease OMOP:44784273 - Melena of newborn due to swallowed maternal blood OMOP:44784390 - Appendicovesicostomy present OMOP:44784428 - Post diphtheria vaccination fever OMOP:44784474 - Dementia associated with multiple sclerosis OMOP:44784499 - Main spoken language Belarusian OMOP:44784545 - Antepartum hemorrhage due to placenta previa type IV OMOP:44784550 - Preterm spontaneous labor with preterm delivery OMOP:44784588 - Nephropathy due to acquired urinary tract obstruction OMOP:44784605 - Chlorodontia OMOP:44784608 - Posttraumatic meningitis OMOP:44786397 - Documentation of system reason(s) for not prescribing beta-blocker therapy (eg, other reasons attributable to the health care system) (Deprecated) OMOP:44786435 - Chlamydia, gonorrhea, and syphilis not screened, reason not given OMOP:44786481 - Documentation that patient is a current tobacco user OMOP:44786502 - Shared decision-making including discussion of conservative (non-surgical) therapy (e.g., nsaids, analgesics, weight loss, exercise, injections) prior to the procedure, not documented, reason not given OMOP:44786554 - Documentation of negative or managed positive tb screen with further evidence that tb is not active prior to treatment with a biologic immune response modifier (Deprecated) OMOP:44786644 - Exercise aerobic category OMOP:44786679 - Negative history for disease of interest in family member OMOP:44786714 - Medication strength OMOP:44786734 - Ingredients for compounded preparations Medication OMOP:44786756 - Neutrophil gelatinase-associated lipocalin [Mass/volume] in Urine by Rapid immunoassay OMOP:44786836 - I rarely think of quitting this job [NMMDS] OMOP:44786871 - Fondaparinux [Mass/volume] in Serum or Plasma by LC/MS/MS OMOP:44787125 - Reason for unsatisfactory specimen not related to sample quality of dried blood spot OMOP:44787755 - FP70A form requested from family practitioner committee OMOP:44787853 - GP104 signed OMOP:44787874 - Prem2 form requested from Health Board OMOP:44787949 - Complaint procedure under the Mental Health Act 1983 (England and Wales) OMOP:44787954 - Application to a Mental Health Review Tribunal under Section 70 of the Mental Health Act 1983 (England and Wales) OMOP:44787976 - Certification under the Mental Health Act 1983 (England and Wales) OMOP:44787981 - General practitioner maternity claim status OMOP:44787988 - Execution of a will under Section 97 of the Mental Health Act 1983 (England and Wales) OMOP:44788074 - Examination payment claim OMOP:44788121 - Provident association payment claim OMOP:44788178 - HSA1 form status OMOP:44788192 - PULHHEEMS - U OMOP:44788202 - IB113 DLS Incapacity for work form paid OMOP:44788236 - Explanation of daytime services OMOP:44788254 - Signing of non-intrauterine contraceptive device claim OMOP:44788290 - Near patient testing enhanced services administration OMOP:44788393 - Revision status values OMOP:44788454 - Completion of Mental Health Act 1983 (England and Wales) form 12 OMOP:44788470 - Procurator Fiscal report paid for OMOP:44788476 - Patient medical record envelope received from family practitioner committee OMOP:44788480 - GP/PS4 - requested from health board OMOP:44788499 - ANC5/6 to Health Board - end of December OMOP:44788521 - Curator bonis certification unpaid OMOP:44788538 - PULHHEEMS - P8 OMOP:44788614 - Rejection of child health surveillance claim OMOP:44788615 - Completion of emergency treatment claim OMOP:44788653 - Immediate and necessary treatment claim OMOP:44788697 - Referred by drug non-statutory service OMOP:44788746 - Substance misuse management stopped - self withdrawal OMOP:44788982 - Mixed receptive-expressive language delay OMOP:44788993 - Child health 36-54 months assessment OMOP:44789029 - Aldosterone/renin ratio OMOP:44789111 - Beta-mannosidase measurement OMOP:44789221 - Ionised calcium (pH 7.4) measurement OMOP:44789265 - Neural tube defect screening test OMOP:44789281 - Breast lump detected by partner OMOP:44789296 - PULHHEEMS - M1 OMOP:44789317 - Private account paid OMOP:44789485 - Letter sent to consultant OMOP:44789543 - Anticoagulant therapy stopped OMOP:44789581 - No special educational needs OMOP:44789656 - High risk drug monitoring - secondary care OMOP:44789677 - Heroin misuse OMOP:44789680 - Ukrainian as a second language OMOP:44789691 - Clinical chemistry report received OMOP:44789705 - Tigrinya as a second language OMOP:44789775 - Video loaned to patient OMOP:44789847 - FP24A maternity claim signed by patient OMOP:44789923 - High cost reproductive and urinary tract drugs OMOP:44790060 - Glomerular filtration rate calculated by abbreviated Modification of Diet in Renal Disease Study Group calculation adjusted for African American origin OMOP:44790084 - GMS3 claim - arrest dental haemorrhage (Rate A) sent to health authority OMOP:44790091 - GMS3 claim - immunisation (fee A) signed OMOP:44790216 - Breast lump detected by mammogram OMOP:44790325 - Removed from community matron caseload OMOP:44790520 - Portuguese language interpreter needed OMOP:44790594 - Patient transfer to residential home OMOP:44790599 - Patient found on chair or sofa or couch OMOP:44790677 - Threshold assessment grid score: severe OMOP:44790769 - GP/PS2 form status OMOP:44790795 - Joint Royal College Ambulance Liaison Committee guidelines OMOP:44790960 - Excision - incomplete margin OMOP:44790988 - In-house physiotherapy first appointment OMOP:44791001 - Referral to urology special interest general practitioner OMOP:44791030 - Patient involved in major incident associated with radioactive agent OMOP:44791105 - Patient deregistration - health record sent to Health Board OMOP:44791115 - Referred to community specialist palliative care team OMOP:44791117 - Did not attend smoking cessation clinic OMOP:44791137 - FP22 - emigration OMOP:44791465 - Janus kinase 2 V617F mutation analysis OMOP:44791624 - Pedal cycle accident involving collision between pedal cycle and train OMOP:44791712 - Non organic failure to thrive OMOP:44791716 - Legal status under Children Leaving Care Act 2000 OMOP:44791753 - FAST - Fast Alcohol Screening Test OMOP:44791777 - Trial reduction of antihypertensive therapy declined OMOP:44791796 - GMS3 claim - arrest dental haemorrhage (Rate B) signed OMOP:44791819 - Self referral to substance misuse service OMOP:44791833 - Cow whey RAST test OMOP:44791837 - Intermediate laboratory finding OMOP:44791855 - Sickle cell not screened for or screening incomplete OMOP:44791875 - Non-significant homozygote OMOP:44791959 - Did not attend headache special interest general practitioner clinic OMOP:44791970 - ANC2/3 requested from Family Practitioner Committee OMOP:44792134 - Maternally inherited diabetes mellitus OMOP:44792143 - In supported work OMOP:44792185 - Finding of gestational age OMOP:44792225 - Complicated contraception need OMOP:44792231 - Chronic kidney disease stage 3 without proteinuria OMOP:44792382 - Adoption agency has parental responsibility OMOP:44792411 - Provision of information about easy wear clothing OMOP:44792486 - Slovak language interpreter needed OMOP:44792510 - Spirometry reversibility testing not indicated OMOP:44792526 - Breton language interpreter needed OMOP:44792635 - Patient held disease modifying antirheumatic drug therapy record updated OMOP:44792780 - Kidney transplant waiting list patient status OMOP:44792782 - General practice physical activity questionnaire physical activity index: active OMOP:44792904 - Occitan language interpreter needed OMOP:44792959 - Fibrin formation around peritoneal dialysis catheter OMOP:44792977 - Seen in community disease modifying antirheumatic drug monitoring clinic OMOP:44793103 - Healthy lifestyle programme not completed OMOP:44793267 - Analgesic drugs Band 1 OMOP:44793272 - Subfoveal choroidal neovascularisation drugs Band 1 OMOP:44793313 - Sofa surfer - person of no fixed abode OMOP:44793383 - Seen in fast track suspected lung cancer clinic OMOP:44793467 - Newborn blood spot screening programme, medium chain acyl-coenzyme A dehydrogenase deficiency repeat screening with further sample required OMOP:44793523 - Mild chronic fatigue syndrome OMOP:44793706 - Did not attend renal clinic OMOP:44793933 - GPC claim - temporary resident contraceptive sent to Health Board OMOP:44794351 - Patient removal request by general practitioner OMOP:44794796 - Environmental health technician - Royal Army Medical Corps OMOP:44794894 - Royal Air Force musician OMOP:44795673 - Royal Air Force catering clerk OMOP:44796084 - Detained in hospital under Section 38 of the Mental Health Act 1983 (England and Wales) OMOP:44797154 - ANC1 sent to family practitioner committee OMOP:44797396 - Terrain analysis technician - Royal Engineers OMOP:44797444 - Royal Air Force general technician, electrical OMOP:44797511 - Royal Air Force electrical engineering technician, airframes OMOP:44797575 - Mechanical clerk of works - Royal Engineers OMOP:44798178 - Seen by GP (general practitioner) locum OMOP:44798447 - Removal of patient under the Mental Health Act 1983 (England and Wales) OMOP:44798558 - Royal Air Force air traffic controller, terminal OMOP:44799933 - Veterinary technician - Royal Army Veterinary Corps OMOP:44800038 - Perinatal mental health care - <1 contact/month OMOP:44800217 - Combat signaller - Royal Engineers OMOP:44800706 - Gunner surface to air missiles, mobile missile vehicle - Royal Artillery OMOP:44800952 - Commander armoured fighting vehicle - Royal Armoured Corps OMOP:44800953 - Royal Air Force general mechanic, electrical OMOP:44801067 - Does use dosette box OMOP:44801197 - Contraceptive claim OMOP:44801745 - Family history of venous disease OMOP:44801815 - Completion of general practitioner maternity claim OMOP:44801842 - Training/seniority/leave status OMOP:44801863 - Mental Health Act (Scotland) form 3 section 18 procedure OMOP:44802251 - In-house sports injury clinic OMOP:44802629 - Born in Anguilla OMOP:44802793 - Osteoporosis enhanced services administration OMOP:44802965 - Preferred place of care - mental health unit OMOP:44803108 - DS1500 Attendance allowance examination payment claim OMOP:44803116 - PULHHEEMS - P6R OMOP:44803117 - Mental Health Act form 3, section 18 payment claim status OMOP:44803146 - Signing of general practitioner maternity claim by doctor OMOP:44803168 - PULHHEEMS - L2R OMOP:44803263 - Partial postnatal care - three visits OMOP:44803275 - Maternity anaesthetic service claim OMOP:44803344 - Healthy school OMOP:44803376 - Certified severely sight impaired OMOP:44803425 - Road safety OMOP:44803436 - Experiential learning OMOP:44803594 - Psychological determinant OMOP:44803601 - Strategic health authority OMOP:44803789 - Lipid disorder monitoring second letter OMOP:44803811 - Patients' Association OMOP:44803902 - Private transport OMOP:44803948 - Summary health OMOP:44804000 - Confidentiality OMOP:44804010 - General medical OMOP:44804039 - Genetic modification OMOP:44804084 - Paedophile OMOP:44804171 - Referral to Princess Royal Trust carers centre OMOP:44804218 - Household waste OMOP:44804223 - Incidence OMOP:44804230 - Leisure time OMOP:44804293 - Fuel poverty OMOP:44804345 - Pain relieved by lowering leg OMOP:44804400 - GMS4 claim - contraception (non intrauterine contraceptive device) signed OMOP:44804493 - GP22 deregistration - internal transfer within partnership OMOP:44804557 - Lithium therapy record book issued OMOP:44804593 - Lower limb distal segment volume OMOP:44804636 - Insulin sensitivity factor - breakfast OMOP:44804717 - Over 75 health check invitation OMOP:44804720 - Referral to community perinatal mental health team OMOP:44804763 - Did not attend colposcopy clinic OMOP:44804767 - Anomalous false tendon of muscle bands of left ventricle OMOP:44804861 - Post-operative assessment at 6 weeks after secondary care discharge OMOP:44804935 - Bill paid OMOP:44805014 - NHS Sickle Cell and Thalassaemia Screening Programme Middle East family origin OMOP:44805052 - Able to use audiovisual appliance OMOP:44805101 - Repeat dispensing service declined OMOP:44805137 - Farsi as a second language OMOP:44805163 - Does not cool home OMOP:44805269 - Unable to mobilise using mobility scooter OMOP:44805285 - Common assessment framework for children and young people process not initiated OMOP:44805301 - Gynaecology inpatient care OMOP:44805356 - Coeliac disease monitoring invitation third letter OMOP:44805496 - Wears medical alert identification OMOP:44805505 - At high risk of activity intolerance OMOP:44805801 - Proline/creatinine ratio measurement OMOP:44805851 - Referral for epilepsy review OMOP:44805852 - Referral to diabetic clinic OMOP:44805897 - Marburg virus IgG antibody measurement OMOP:44806047 - Maternity service procedure OMOP:44806052 - Referral by housing service OMOP:44806061 - Total homocysteine measurement OMOP:44806084 - Rabbit blood specific IgE antibody measurement OMOP:44806268 - Refractory anaemia with multilineage dysplasia OMOP:44806289 - Rubella virus IgG avidity test OMOP:44806395 - Liaison with medical practitioner OMOP:44806542 - Varicella zoster virus genotype determination by deoxyribonucleic acid analysis OMOP:44806662 - Liaison with mental health nurse OMOP:44806842 - Referral to independent mental health advocate OMOP:44806939 - Chlamydia trachomatis (lymphogranuloma venereum serovar) deoxyribonucleic acid detection OMOP:44807136 - Advice about speech OMOP:44807145 - Liaison with CPN (community psychiatric nurse) OMOP:44807236 - Excepted from osteoarthritis quality indicators - patient unsuitable OMOP:44807258 - Measurement of blood pressure using non-invasive blood pressure monitor OMOP:44807359 - GP/UMS not okayed by Health Board OMOP:44807365 - Teriparatide declined OMOP:44807421 - Temperature of right foot OMOP:44807426 - Nasal neuroretinal rim width of left eye OMOP:44807468 - Right dorsalis pedis pulse triphasic OMOP:44807589 - Right ankle reflex absent OMOP:44807614 - Human immunodeficiency virus type 2 ribonucleic acid measurement by nucleic acid amplification test OMOP:44807619 - Copy of clinical record given to patient OMOP:44807649 - Seen in community treatment room OMOP:44807839 - Provision of written information about progestogen only oral contraception OMOP:44807947 - Community learning disability nursing OMOP:44807962 - Education about risk of malignant neoplasm of breast OMOP:44808299 - Ultrasound diagnostic imaging - specialty OMOP:44808508 - Open intra-articular fracture of distal radius OMOP:44808693 - Education about urinary elimination care OMOP:44808754 - Referral to paediatric orthopaedic service OMOP:44808825 - Referral to IAPT (improving access to psychological therapies) programme declined OMOP:44808886 - Severe sensorineural hearing loss OMOP:44809116 - Referred by hospital outpatient department OMOP:44809173 - Acute renal failure induced by radiographic contrast media OMOP:44809233 - Hepatitis C genotype 1 OMOP:44809234 - Hepatitis C genotype 2 OMOP:44809329 - Right upper limb proximal segment volume OMOP:44809550 - Consent given for injection OMOP:44809569 - Stage 2 hypertension (NICE - National Institute for Health and Clinical Excellence 2011) OMOP:44809671 - Provision of written information about eye care OMOP:44809717 - Sexually transmitted infection in-house follow-up OMOP:44809782 - Referral to neurological rehabilitation service OMOP:44809795 - Missed review appointment letter sent OMOP:44809827 - Uses dispensed monitored dosage system OMOP:44809887 - Meets NICE clinical guideline CG164 familial breast cancer referral criteria for assessment and management in secondary care OMOP:44809912 - Save sample for serum virology OMOP:44809975 - Stercoral perforation of colon OMOP:44810032 - Left triceps reflex absent OMOP:44810085 - GULP Dehydration Risk Screening Tool OMOP:44810091 - Recombinant Bet v 2 birch specific IgE antibody measurement OMOP:44810097 - Herpes zoster vaccination invitation email OMOP:44810100 - Variable upper body strength OMOP:44810224 - Urine methylmalonic acid:creatinine ratio measurement OMOP:44810240 - Substance misuse monitoring annual review OMOP:44810365 - Faecal isocoproporphyrin content measurement OMOP:44810386 - Herpes zoster vaccination given by other health care provider OMOP:44810471 - Organic acidaemia OMOP:44810477 - Completion of newborn blood spot screening card OMOP:44810725 - Did not attend first rotavirus vaccination OMOP:44810758 - School entrant hearing screening incomplete - declined screening OMOP:44810764 - School entrant hearing screening incomplete - behavioural issues OMOP:44810784 - Care home visit OMOP:44810857 - Request for individual funding granted OMOP:44810890 - Advice on risks of harm to mother from maternal medication during pregnancy OMOP:44811049 - Power of left myotome of second sacral nerve OMOP:44811075 - Benign neoplasm of foot and ankle OMOP:44811078 - Timed collection: specimen collection, 20 minutes OMOP:44811155 - Rheumatoid arthritis monitoring telephone invitation OMOP:44811188 - Referral to feeding and swallowing service OMOP:44811206 - Learning disability service OMOP:44811260 - Liverpool care pathway for the dying OMOP:44811297 - In-house alcohol detoxification OMOP:44811306 - Clinical haematology service OMOP:44811378 - Seen by paediatric trainee doctor OMOP:44811387 - Copy of clinical record sent to Department of Work and Pensions OMOP:44811388 - Seen by core psychiatry trainee doctor OMOP:44811420 - Sport and exercise medicine service OMOP:44811423 - Podiatric surgery service OMOP:44811444 - Psychiatric intensive care service OMOP:44811698 - Serum midnight cortisol concentration measurement OMOP:44811709 - Surveillance of Cerebral Palsy in Europe classification - predominant pattern A.1.2 - disorder of migration OMOP:44811824 - Right dorsalis pedis pulse palpable OMOP:44811827 - Left dorsalis pedis pulse impalpable OMOP:44811862 - Midwife episode - specialty OMOP:44811863 - Finding of touch sensation of dermatome OMOP:44811883 - Pin prick sensation of left dermatome of first thoracic nerve absent OMOP:44811900 - Serum U1snRNP (uridine 1 small nuclear ribonucleoprotein) antibody measurement OMOP:44811911 - Poliovirus type 1 nucleic acid detection assay OMOP:44811951 - Touch sensation of right dermatome of first sacral nerve absent OMOP:44811958 - Remote triage and advice service OMOP:44812163 - Serum 9am cortisol concentration measurement OMOP:44812309 - Touch sensation of left dermatome of second sacral nerve reduced OMOP:44812344 - FP74 - laboratory's technical request OMOP:44812368 - Yiddish language interpreter needed OMOP:44812554 - Brief intervention for excessive alcohol consumption declined OMOP:44812646 - GPC claim - temporary resident (more than 15 days) sent to Health Board OMOP:44812663 - French Protestant, follower of religion OMOP:44813051 - PULHHEEMS - L6R OMOP:44813164 - Referral to diabetes education and self management for ongoing and newly diagnosed structured programme declined OMOP:44813197 - PULHHEEMS - Eul8 OMOP:44813270 - Consent given for influenza A subtype H1N1 vaccination OMOP:44813311 - Difficulty preparing snack OMOP:44813440 - Heating appliance unsuitable for living environment OMOP:44813505 - Did not attend walk in centre OMOP:44813527 - NHS mental health nursing home/residential care OMOP:44813663 - Immunisation claim status OMOP:44813771 - Excepted from asthma quality indicators - patient unsuitable OMOP:44813837 - Posterior tibial tendon insufficiency OMOP:44813864 - Has socially isolated carer OMOP:44814072 - Tendon injury associated with fracture dislocation OMOP:44814079 - Systemic inflammatory response syndrome of non-infectious origin with organ failure OMOP:44814123 - Right posterior tibial pulse absent OMOP:44816611 - Other unique product identifier [Type] OMOP:44816613 - Vendor serial number OMOP:44816728 - Transplant type [Anatomy] OMOP:44817092 - Mother's Last menstrual period start date before delivery OMOP:44817115 - 8-Hydroxyamoxapine [Presence] in Urine OMOP:44817143 - Do you have difficulty communicating, reading, or do you have limited proficiency in English [HHS.ACA Section 4302.ONC] OMOP:44817255 - Fatty acids.very long chain C24:0 (Tetracosanoate)/C22:0 (Docosanoate) [Mass Ratio] in Fibroblast OMOP:44817258 - Coenzyme Q cytochrome C reductase (Complex III) [Enzymatic activity/mass] in Tissue OMOP:45757053 - Cyberlindnera fabianii OMOP:45757067 - Fungal sinusitis OMOP:45757070 - Keratopathy medicamentosa OMOP:45757100 - Breast abscess during lactation OMOP:45757155 - Pyemic and septic embolism in childbirth OMOP:45757187 - Infection of nipple associated with lactation OMOP:45757213 - Depressive disorder in mother complicating childbirth OMOP:45757243 - Esophagostomy infection OMOP:45757280 - Dyslipidemia with high density lipoprotein below reference range and triglyceride above reference range due to type 2 diabetes mellitus OMOP:45757308 - Closed fracture of third lumbar vertebra OMOP:45757309 - Closed fracture of fourth lumbar vertebra OMOP:45757380 - Human papillomavirus deoxyribonucleic acid detected, high risk on anal specimen OMOP:45757402 - Female genital mutilation type 1 OMOP:45757477 - Vesicoureteral reflux without reflux nephropathy OMOP:45757522 - Noncompliant neuropathic urinary bladder OMOP:45757535 - Microalbuminuria due to type 1 diabetes mellitus OMOP:45757543 - Hemorrhage of colon due to diverticulosis OMOP:45757562 - Myxotrichum deflexum OMOP:45757578 - Supernumerary deciduous mandibular left second molar tooth OMOP:45757581 - Postoperative ptosis of eyelid OMOP:45757585 - Supernumerary deciduous maxillary left second molar tooth OMOP:45757630 - Supernumerary permanent maxillary left first premolar tooth OMOP:45757648 - Abscess of bone of accessory sinus OMOP:45757679 - Ieri virus OMOP:45757694 - Toxoplasma choroiditis OMOP:45757708 - Low vision right eye, normal vision left eye OMOP:45757725 - Alternating heterophoria OMOP:45757736 - Benign essential microscopic hematuria OMOP:45757752 - Hereditary nephropathy OMOP:45757762 - Postinfective urethral meatal stricture of male OMOP:45757801 - Intracranial hypotension OMOP:45757814 - Increase in hemodialysis dialyzer size OMOP:45763561 - Chronic ankle pain OMOP:45763580 - Upolu virus OMOP:45763758 - Cicatricial entropion of lower eyelid OMOP:45763795 - Mycobacterium seoulense OMOP:45763798 - Mycobacterium bouchedurhonense OMOP:45763799 - Calcaneocuboid osteoarthritis secondary to trauma OMOP:45763801 - Secondary osteoarthritis of subtalar joint OMOP:45763822 - Edema of upper eyelid OMOP:45763874 - Cervical smear - borderline change in endocervical cells OMOP:45763885 - Education about diabetes and driving OMOP:45763891 - Adenocarcinoma of pancreas OMOP:45763893 - Non-steroidal anti-inflammatory drug-induced enteropathy OMOP:45763906 - Osteomyelitis of midfoot OMOP:45763942 - Sensorineural deafness and male infertility OMOP:45763953 - Non-accidental traumatic head injury to child OMOP:45765405 - Ophiostoma OMOP:45765465 - Partington syndrome OMOP:45765486 - Proximal penile hypospadias OMOP:45765496 - Kuskokwim syndrome OMOP:45765500 - Quadruplet birth OMOP:45765565 - Low risk environment for patient discharge OMOP:45765567 - Anxiety about breathlessness OMOP:45765605 - Difficulty eating due to breathlessness OMOP:45765658 - Congenital stenosis of nasal pyriform aperture OMOP:45765965 - Prevotella buccalis or Prevotella veroralis OMOP:45766076 - Acute ST segment elevation myocardial infarction of anterior wall involving right ventricle OMOP:45766110 - Asymptomatic occlusion of anterior cerebral artery OMOP:45766125 - Postprocedural aortic valve stenosis OMOP:45766128 - Familial cerebral saccular aneurysm OMOP:45766147 - Appearance OMOP:45766171 - Venous telangiectases of the lower limb OMOP:45766184 - Noninvoluting congenital hemangioma OMOP:45766213 - Mitral valve regurgitation due to infiltrative disease OMOP:45766254 - Berberine hydrochloride OMOP:45766336 - Patient unsuitable for procedure due to psychological condition OMOP:45766357 - Amorphous urate crystal OMOP:45766388 - Mowat-Wilson syndrome OMOP:45766449 - Gardner fibroma OMOP:45766603 - Acquired angioedema due to C1 inhibitor autoantibody OMOP:45766642 - Delirium due to benzodiazepine withdrawal OMOP:45766728 - Allergic asthma caused by Dermatophagoides farinae OMOP:45766738 - Phonological awareness profile OMOP:45766748 - Referral to primary care service OMOP:45766766 - Closed fracture of fourth metacarpal OMOP:45766786 - Open fracture of base of fourth metacarpal bone OMOP:45766821 - Stress fracture of shaft of femur OMOP:45766895 - Closed fracture of phalanx of little finger OMOP:45766915 - Closed fracture of neck of fourth metacarpal OMOP:45766933 - Liver transplant planned OMOP:45766938 - Frequency of angina OMOP:45766940 - Closed fracture of shoulder OMOP:45766968 - Pathologic fracture of scapula at site of neoplasm OMOP:45767041 - Osteoporotic fracture of proximal femur OMOP:45767057 - At increased risk for environmental injury OMOP:45767092 - Attitude towards dietary regime OMOP:45767112 - Fear of being a burden to others OMOP:45767538 - Pseudarthrobacter scleromae OMOP:45767540 - Human adenovirus 57 OMOP:45767603 - Closed fracture of distal phalanx of lesser toe OMOP:45767635 - Closed fracture of anterior wall of acetabulum OMOP:45768454 - Transfer injury OMOP:45768658 - Endocrine symptom change OMOP:45768731 - Invasive meningococcal disease OMOP:45768754 - Generalized chronic periodontitis OMOP:45768782 - No abnormality detected by assessment of physical health OMOP:45768807 - No hyperkeratosis OMOP:45768842 - Malignant melanoma of sphenoidal sinus OMOP:45768896 - Primary adenoid squamous cell carcinoma of larynx OMOP:45768951 - Primary squamous cell carcinoma of hypopharynx OMOP:45768972 - Stroke impact scale version 3.0 communication score OMOP:45768974 - Non-O1 and non-O139 Vibrio cholerae infection OMOP:45769029 - Primary epithelial-myoepithelial carcinoma of oropharynx OMOP:45769045 - Interleukin 1 receptor alpha chain OMOP:45769145 - Developmental abnormality of cusp of tooth OMOP:45769152 - Bartter syndrome OMOP:45769173 - Enterococcus faecium genotype vanB OMOP:45769242 - Patient denies drug use OMOP:45769376 - Verruciform xanthoma of oral mucous membrane OMOP:45769386 - Chronic pneumonitis of infancy OMOP:45769413 - Genotype determination OMOP:45769454 - Carya illinoinensis tree IgE OMOP:45769520 - Coagulation service OMOP:45769791 - Juvenile papillomatosis of breast OMOP:45769900 - Candida norvegica OMOP:45769945 - Born in South Georgia and the South Sandwich Islands OMOP:45769993 - Born in Åland Islands OMOP:45770086 - Pin prick sensation of left dermatome of first sacral nerve absent OMOP:45770091 - Pin prick sensation of left dermatome of second sacral nerve normal OMOP:45770128 - Touch sensation of left dermatome of fourth lumbar nerve absent OMOP:45770137 - Pin prick sensation of right dermatome of fourth lumbar nerve normal OMOP:45770156 - Pin prick sensation of right dermatome of fifth lumbar nerve absent OMOP:45770210 - Solute carrier family 37 (glucose-6-phosphate transporter) member 4 comprehensive genetic test OMOP:45770265 - Latent tuberculosis screening invitation email OMOP:45770279 - Touch sensation of left dermatome of fourth cervical nerve exaggerated OMOP:45770313 - Pin prick sensation of left dermatome of seventh cervical nerve normal OMOP:45770339 - Touch sensation of left dermatome of seventh cervical nerve reduced OMOP:45770347 - Touch sensation of right dermatome of eighth cervical nerve normal OMOP:45770494 - Royal Navy personnel OMOP:45770531 - Weapons engineer (non-commissioned) - Royal Navy OMOP:45770626 - Calculated fluid maintenance requirement in 24 hours OMOP:45770703 - Multiple long term conditions OMOP:45770789 - Discharged from guardianship under Section 23 of the Mental Health Act 1983 (England and Wales) OMOP:45770824 - Malignant multiple endocrine neoplasia type 2a OMOP:45770839 - Ulcerative mucositis of vulva OMOP:45770879 - Mass of urethra OMOP:45770881 - Moderate nonproliferative retinopathy due to type 2 diabetes mellitus OMOP:45770910 - Supernumerary permanent mandibular left second premolar tooth OMOP:45770914 - Perforation of intraocular lens OMOP:45770921 - Complete androgen insensitivity syndrome OMOP:45770924 - Herpes zoster iritis OMOP:45770994 - Cellular changes consistent with Cytomegalovirus OMOP:45771008 - Aortic aneurysm monitoring OMOP:45771250 - Triplegic cerebral palsy OMOP:45771272 - RAF officer OMOP:45771351 - Congenital anomaly of precerebral vessel OMOP:45771354 - Char syndrome OMOP:45771482 - Childhood nephrotic syndrome OMOP:45772108 - Supernumerary deciduous mandibular right lateral incisor tooth OMOP:45772685 - Closed fracture of hand OMOP:45772689 - Referral to erectile dysfunction clinic declined OMOP:45772903 - Sebaceous nevus OMOP:45772959 - Obstruction of pulmonary vein as complication of procedure OMOP:45773004 - Epstein Barr virus capsid IgA OMOP:45773045 - Paenibacillus humicus OMOP:45773047 - Oscillibacter ruminantium OMOP:45773084 - Refusal of treatment by patient against dental advice OMOP:45773152 - Trichosporon beigelii or Trichosporon cutaneum OMOP:45773179 - Cronobacter dublinensis subspecies lausannensis OMOP:45773223 - History obtained from person with parental responsibility OMOP:45773388 - Aplasia of testicle OMOP:45773535 - Streptococcus lutetiensis or Streptococcus bovis OMOP:45773567 - Sensory neuropathy due to type 1 diabetes mellitus OMOP:45890711 - History of injection drug use (Deprecated) OMOP:45890764 - Patient received follow-up within 30 days after discharge OMOP:46234811 - Licensed nursing personnel [#] by employment position [NMMDS] OMOP:46234918 - HNF1A gene full mutation analysis in Blood or Tissue by Sequencing OMOP:46235126 - dRVVT with 1:1 PNP (LA mix) OMOP:46235154 - Parvovirus B19 DNA [log units/volume] (viral load) in Plasma from Donor by NAA with probe detection OMOP:46235182 - R-R interval.standard deviation (Heart rate variability) by EKG OMOP:46235226 - PROMIS short form - physical function 20a - version 1.0 OMOP:46235271 - Comment on fetal Angelman syndrome risk [Text] in Plasma cell-free+WBC DNA by Dosage of chromosome-specific cfDNA Narrative OMOP:46235275 - Fetal 5p deletion risk [Likelihood] based on Plasma cell-free+WBC DNA by Dosage of chromosome-specific cfDNA Narrative OMOP:46235277 - PROMIS short form - sleep disturbance 6a - version 1.0 OMOP:46235327 - I feel detached from other people [PROMIS] OMOP:46235387 - I feel that people are around me but not with me [PROMIS] OMOP:46235420 - PROMIS short form - social isolation 8a - version 2.0 OMOP:46235476 - Human papilloma virus 18+45 E6+E7 mRNA [Presence] in Cervix by NAA with probe detection OMOP:46235607 - During the past 4 weeks, how much bodily pain have you generally had [COOP] OMOP:46235687 - Total score [HAQ-DI] OMOP:46235760 - Methicillin resistant Staphylococcus aureus [Presence] in Pharynx by Organism specific culture OMOP:46235848 - Age at event onset Family member OMOP:46235973 - Number of productive staff in a reporting period [NMMDS] OMOP:46235974 - Number of new nursing staff by job position in a reporting period [NMMDS] OMOP:46235983 - Nursing staff turnover panel [NMMDS] OMOP:46236009 - Yesterday, how many times the patient eat fruit # OMOP:46236015 - Transferred from of Facility OMOP:46236042 - Morphine [Moles/volume] in Specimen OMOP:46236065 - Triglyceride [Mass/mass] in 24 hour Stool OMOP:46236200 - Can pronounce subtle [AmNART] OMOP:46236216 - Can pronounce virulent [AmNART] OMOP:46236238 - Time to access all patients in a Report Period [NMMDS] OMOP:46236259 - During the past 24 hours, how has pain interfered with your sleep [BPI Short Form] OMOP:46236266 - Transportation summary Document OMOP:46236301 - C9orf72 gene GGGGCC repeats [Entitic number] in Blood or Tissue by Molecular genetics method OMOP:46236309 - HLA-C IgG Ab [Identifier] in Serum or Plasma by Immunoassay OMOP:46236339 - Right ventricular Minor axis at end diastole.parasternal long axis [Length] by US 2D OMOP:46236462 - Do you have someone to bring you to an appointment if you need it [PROMIS] OMOP:46236465 - Could you get a friend or family member to help fix something at home if you need it [PROMIS] OMOP:46236500 - ALPRAZolam cutoff [Mass/volume] in Saliva (oral fluid) for Confirmatory method OMOP:46236509 - Methylenedioxyethylamphetamine cutoff [Mass/volume] in Urine for Confirmatory method OMOP:46236602 - PROMIS short form - emotional support 6a - version 2.0 raw score OMOP:46236676 - PROMIS short form - satisfaction with participation in social roles 4a - version 1.0 raw score OMOP:46236749 - t(12;21)(p13;q22.3)(ETV6,RUNX1) fusion transcript in Blood or Tissue by FISH OMOP:46236752 - t(6;9)(p22;q34)(DEK,NUP214) fusion transcript in Blood or Tissue by FISH OMOP:46236973 - Staphylococcus aureus.vancomycin resistance [Susceptibility] Qualitative OMOP:46236995 - Hospital stay duration OMOP:46237025 - Bacteria identified in Uterus by Culture OMOP:46237050 - Time load level [NMMDS] OMOP:46269725 - Bronchopneumonia caused by Streptococcus pneumoniae OMOP:46269742 - Myocarditis caused by Influenza A virus OMOP:46269748 - Pulp abscess of thumb OMOP:46269778 - Mild persistent asthma controlled OMOP:46269787 - Moderate persistent controlled asthma co-occurrent with allergic rhinitis OMOP:46269835 - Hepatic ascites due to chronic alcoholic hepatitis OMOP:46269851 - Rectal hemorrhage due to chronic ulcerative rectosigmoiditis OMOP:46269863 - Rectal hemorrhage due to inflammatory polyps of colon OMOP:46269864 - Complete edentulism class III due to caries OMOP:46269873 - Complete edentulism class IV due to trauma OMOP:46269877 - Rectal hemorrhage due to Crohn's disease of large intestine OMOP:46269894 - Cardiomyopathy due to diphtheria OMOP:46269897 - Perforation of ileum due to diverticulitis OMOP:46269902 - Perforation of small intestine co-occurrent with hemorrhage due to diverticulitis OMOP:46270001 - Abscess of thumb OMOP:46270013 - Paraspinal abscess OMOP:46270023 - Thrombosis of surgically created arteriovenous fistula OMOP:46270105 - Family history of clubfoot OMOP:46270108 - Uncontrolled pain OMOP:46270159 - Acute ST segment elevation myocardial infarction of anterolateral wall OMOP:46270166 - Periprosthetic fracture of hip OMOP:46270328 - Facial fracture due to fall OMOP:46270333 - Stress fracture of tibia and fibula OMOP:46270334 - ISR (Immune status ratio) OMOP:46270398 - Disorder of respiratory system due to dermatomyositis OMOP:46270406 - Osteonecrosis of femur due to trauma OMOP:46270416 - Chronic tophaceous gout of ankle due to renal impairment OMOP:46270433 - Chronic osteomyelitis of hand with draining sinus OMOP:46270445 - Chronic gout of multiple sites without tophus caused by drug OMOP:46270495 - Infection due to bariatric procedure OMOP:46270502 - Kent Inventory of Developmental Skills OMOP:46270523 - Pediatric pulmonology service OMOP:46270572 - Family history of galactosemia OMOP:46270861 - N-2-hydroxyethyl valine OMOP:46270916 - Diffuse parenchymatous hyperplasia OMOP:46271041 - More Than Words program OMOP:46271107 - Fibroblast growth factor 23 OMOP:46271114 - West Nile virus Ag OMOP:46271185 - Bovine herpesvirus 5 Ag OMOP:46271222 - Streptomyces cheonanensis OMOP:46271235 - Cyclospora Ag OMOP:46271250 - Equine adenovirus Ag OMOP:46271260 - Human metapneumovirus Ag OMOP:46271298 - Neisseria meningitidis Z Ag OMOP:46271305 - Taenia Ag OMOP:46271477 - Fibrinogen antigen OMOP:46271562 - Influenza A virus H11 Ab OMOP:46271569 - Influenza A virus H5 Ab OMOP:46271583 - Leptospira interrogans serovar Ballum Ab OMOP:46271705 - Avian metapneumovirus type B Ab OMOP:46271735 - Vesicular stomatitis virus Ab OMOP:46271791 - Gorgonzola cheese OMOP:46271834 - Finding of condition of completely dentate teeth OMOP:46271970 - Dokdonella koreensis OMOP:46272028 - Acinetobacter lwoffii or Acinetobacter junii OMOP:46272057 - Neuropathy of upper limb due to inflammatory disease OMOP:46272080 - Borrelia burgdorferi 41kD IgG OMOP:46272095 - Chlamydia IgG OMOP:46272216 - Treponema pallidum IgG OMOP:46272280 - Cardiolipin IgM OMOP:46272301 - Entamoeba histolytica IgM OMOP:46272341 - Rickettsia rickettsii IgM OMOP:46272397 - Family education about hygiene OMOP:46272492 - Dissection of artery OMOP:46272529 - Referral to self help service OMOP:46272551 - Green nimitti protein OMOP:46272606 - Monitoring for impaired family coping OMOP:46272656 - Phantom pain following excision of eye OMOP:46272657 - Phantom pain following amputation of lower limb OMOP:46272691 - Labial melanin incontinence OMOP:46272716 - Bougainvillea pollen OMOP:46272737 - Bowen-Conradi syndrome OMOP:46272740 - KBG syndrome OMOP:46272749 - Ulcer of skin of lower extremity OMOP:46272831 - Caveolin 3 related distal myopathy OMOP:46272922 - Thoracoabdominal organ finding OMOP:46272929 - Ability to perform spirometry OMOP:46272976 - Apprehension test of knee positive OMOP:46272983 - Transplantation of kidney regime OMOP:46272985 - Language Steps program OMOP:46273013 - X-linked immunodeficiency with magnesium defect, Epstein-Barr virus infection and neoplasia OMOP:46273186 - Adenoma of descending colon OMOP:46273197 - Malignant neoplasm of short bone of lower limb OMOP:46273219 - Liaising with patient OMOP:46273300 - Spasmodic torticollis due to infection OMOP:46273400 - Intractable complex partial parietal lobe epilepsy OMOP:46273423 - Partial edentulism class 1 OMOP:46273509 - Parasomnia caused by drug OMOP:46273588 - Dermatophagoides farinae protein OMOP:46273645 - Derangement of lateral meniscus due to injury of knee OMOP:46273655 - Chronic gout of wrist without tophus caused by drug OMOP:46273660 - Fontibacillus aquaticus OMOP:46273741 - Paracoccus chinensis OMOP:46273752 - Taenia solium Ag OMOP:46273777 - Mucin-like carcinoma-associated antigen OMOP:46273790 - Leptospira interrogans serovar Celledoni Ab OMOP:46273811 - Severely compromised occlusal scheme OMOP:46273868 - Family history of Prader-Willi syndrome OMOP:46273917 - Advocating for breastfeeding OMOP:46274009 - J5 OMOP:46274058 - Skin ulcer of toe due to diabetes mellitus type 2 OMOP:46274076 - Abuse counseling for offending parent OMOP:46274098 - Influenza A virus subtype H1 antigen OMOP:46284258 - Opioid-induced psychosis OMOP:46284310 - Emotional behavioural difficulties OMOP:46284473 - Cystic fibrosis screening declined, screened outside UK with evidence of result OMOP:46284495 - Sickle cell screening related finding OMOP:46284651 - Isovaleric acidaemia screening, unsuitable sample: expired card used OMOP:46284690 - Sickle cell screening, unsuitable sample: date of birth not accurately matched OMOP:46284731 - ASQ-3 (Ages and Stages Questionnaires Third Edition) 14 month questionnaire - problem solving score OMOP:46284809 - Last weeks of life OMOP:46284847 - Aliskiren contraindicated OMOP:46284850 - Ticagrelor declined OMOP:46284858 - Malignant melanoma stage IA OMOP:46284863 - Malignant melanoma stage IIIB OMOP:46284864 - Malignant melanoma stage IIIC OMOP:46284876 - Dementia care plan agreed OMOP:46284885 - Requires deafblind haptic communication interpreter OMOP:46285518 - Reads Southern Sotho OMOP:46285522 - Reads Tahitian OMOP:46285560 - Marshallese interpreter needed OMOP:46285980 - Lives in Extra Care housing OMOP:46286036 - European Union Scale for Peak Expiratory Flow Rate - Children OMOP:46286363 - Injury following cocaine use OMOP:46286419 - Apixaban contraindicated OMOP:46286443 - Sarcoid vasculitis OMOP:46286495 - Active serving member of the Royal Navy - temporary registration OMOP:46286530 - Current View Contextual Problems - school, work or training OMOP:46286844 - Abdominal aortic aneurysm screening status OMOP:46286887 - Newborn and Infant Physical Examination Screening Programme, testis examination declined OMOP:46286981 - Medium-chain acyl-coenzyme A dehydrogenase deficiency screening declined, screened in UK (as reported by parents) with no evidence of result OMOP:46287002 - Isovaleric acidaemia not screened for or screening incomplete OMOP:46287116 - Reads Oriya OMOP:46287119 - Reads Nuosu OMOP:46287126 - Kanuri interpreter needed OMOP:46287128 - Navajo interpreter needed OMOP:46287191 - Dementia care plan review declined OMOP:46287218 - Limburgan as a second language OMOP:46287245 - Chinese interpreter needed OMOP:46287267 - Injury following heroin use OMOP:506642 - First annual visit by health visitor OMOP:506643 - Discussed with health visitor OMOP:506688 - Personal Wellbeing Score rating - what I do in my life is worthwhile OMOP:507018 - Has authorisation for repeat prescription requests by telephone OMOP:507019 - PARR-30 (Patients at Risk of Re-hospitalisation within 30 days of discharge) algorithm OMOP:507324 - Referral for Early Help Assessment OMOP:507493 - Child Language Impairment TOM (Therapy Outcome Measure) carer wellbeing score OMOP:507518 - Diabetes TOM (Therapy Outcome Measure) carer wellbeing score OMOP:507526 - Dietetic Intervention for Adult Obesity TOM (Therapy Outcome Measure) carer wellbeing score OMOP:586526 - SARS-CoV-2 (COVID-19) RNA [Presence] in Nasopharynx by NAA with probe detection OMOP:600768 - Traumatic blister of gingiva OMOP:600774 - Referral to care management service OMOP:600787 - Musculoskeletal medicine specialty OMOP:600981 - Right lower leg repetitive strain injury OMOP:601002 - Foreign body granuloma of soft tissue of left thigh OMOP:601006 - Foreign body granuloma of soft tissue of right lower leg OMOP:601053 - Transient synovitis of left hand OMOP:601073 - Punctate inner choroidopathy of right eye OMOP:601090 - Leukocoria of left eye OMOP:601118 - Neoplasm of uncertain behavior of left testis OMOP:601129 - Primary malignant neoplasm of skin of right ear OMOP:601134 - Primary malignant neoplasm of peripheral nerves of left lower limb OMOP:601152 - Primary malignant neoplasm of right lower limb OMOP:601159 - Inflammatory dermatosis due to type 1 diabetes mellitus OMOP:601179 - Referral to benefits enrollment assistance program OMOP:601267 - Plusaetis parus OMOP:601299 - Pulex porcinus OMOP:601300 - Pulex sinoculus OMOP:601309 - Trichopsylloides OMOP:601310 - Trichopsylloides oregonensis OMOP:601315 - Referral to home-delivered meals program OMOP:601318 - Referral to Special Supplemental Nutrition Program for Women, Infants and Children OMOP:601332 - Education about garden program OMOP:601334 - Education about medically tailored meals program OMOP:601374 - Aetheca thamba OMOP:601390 - Amphipsylla OMOP:601410 - Ceratophyllus arcuegens OMOP:601413 - Ceratophyllus coahuilensis OMOP:601446 - Starmerella etchellsii OMOP:601465 - Corrodopsylla curvata OMOP:601498 - Dinopsyllus hirsutus OMOP:601505 - Kohlsia felteni OMOP:601549 - Myodopsylla setosa OMOP:601601 - Melanospora OMOP:601613 - Pollock OMOP:601621 - Pain of left knee joint OMOP:601655 - Sorex gaspensis OMOP:601658 - Sorex macrodon OMOP:601660 - Cryptotis parva OMOP:601724 - Kwoniella OMOP:601799 - Education about street outreach program OMOP:601864 - Chronic antibiotic-dependent ileal pouchitis OMOP:601869 - Fear of contracting disease caused by severe acute respiratory syndrome coronavirus 2 OMOP:601888 - Counseling for readiness to implement housing insecurity care plan OMOP:601889 - Counseling for barriers to achieve adequate housing OMOP:601895 - Education about mortgage assistance program OMOP:602008 - Primary adenocarcinoma of neck of pancreas OMOP:602014 - Primary adenocarcinoma of ureteral orifice OMOP:602019 - Primary anaplastic astrocytoma of parietal lobe OMOP:602038 - Congenital pigmented melanocytic nevus of skin of lip OMOP:602056 - Primary leiomyosarcoma of neck OMOP:602065 - Primary liposarcoma of soft tissue of perineum OMOP:602068 - Primary malignant glioma of frontal lobe OMOP:602077 - Neurofibroma of head OMOP:602099 - Primary sarcoma of thorax OMOP:602113 - Primary squamous cell carcinoma of mucous membrane of lip OMOP:602132 - Primary transitional cell carcinoma of anterior wall of urinary bladder OMOP:602143 - Anemia due to chronic kidney disease stage 1 OMOP:602155 - Primary chondrosarcoma of bone of right lower limb OMOP:602164 - Primary squamous cell carcinoma of skin of right upper limb OMOP:602245 - SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) anti-spike IgG detection result positive OMOP:602266 - Presence of direct invasion by primary malignant neoplasm of colon to blood vessel in pericolic tissue OMOP:602305 - Primary adenocarcinoma of left fallopian tube OMOP:602307 - Left ovarian primary mucinous cystadenocarcinoma OMOP:602589 - Deep tissue pressure injury of right heel OMOP:602646 - Furuncle of left forearm OMOP:602647 - Carbuncle of left lower limb OMOP:602649 - Onychia of finger of left hand OMOP:602652 - Bilateral localized swelling of forearms OMOP:602658 - Thrombosis of cerebral venous sinus due to and following surgical procedure OMOP:602677 - Dysplastic nevus of skin of left ear OMOP:602706 - Incarcerated intra-abdominal hernia OMOP:602707 - Acute allergic otitis media of left middle ear OMOP:602719 - Francisella hispaniensis OMOP:602793 - Neonatal hyperbilirubinemia due to metabolic disease OMOP:602878 - Recurrent infection due to immunoglobulin isotype deficiency OMOP:602924 - Intentional poisoning by nicotinic acid OMOP:603049 - Cystic dysplasia of kidney OMOP:603106 - Self efficacy OMOP:603117 - Protoplasmic astrocytoma of brain OMOP:603256 - SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) vaccination fifth dose declined OMOP:603288 - Secure estate healthcare registration OMOP:603304 - Left acquired hallux valgus due to metatarsus primus varus OMOP:603312 - Primary sarcoma of small intestine OMOP:603324 - Abnormal uterine bleeding due to subserous leiomyoma of uterus OMOP:604272 - Double convexity deformity of lower pole of breast due to and following breast augmentation with prosthesis OMOP:604294 - Foreign body in skin of flank with infection OMOP:604348 - Measured quantity of intake of methionine in 24 hours OMOP:604387 - Pseudomonas alkylphenolica OMOP:604410 - Chordoma of vertebral column OMOP:604429 - Acute ST segment elevation myocardial infarction of apex of heart OMOP:604435 - Estimated quantity of intake of bioactive substance OMOP:604469 - Congenital disorder of glycosylation type 1i OMOP:604515 - Education about Food Distribution Program on Indian Reservations OMOP:604523 - Assistance with application for home-delivered meals program OMOP:604530 - Megabothris asio subspecies gregsoni OMOP:604537 - Referral to area agency on aging OMOP:604587 - Medial duplication of long arm of chromosome 9 OMOP:604652 - Pelizaeus-Merzbacher disease null syndrome OMOP:604697 - Agenesis of pubis OMOP:604710 - Agenesis of radius OMOP:604772 - Human leukocyte antigen DQB1*02:02 positive OMOP:604787 - Transperitoneal migration of spermatozoa OMOP:604790 - Transuterine migration of ovum OMOP:604845 - Streptococcus suis serotype 9 OMOP:604852 - Streptococcus suis serotype 21 OMOP:604872 - Pasteurella multocida serogroup E OMOP:604907 - Penile megalourethra OMOP:604948 - Sabinas brittle hair syndrome OMOP:604955 - Proximal deletion of long arm of chromosome 1 OMOP:604956 - Proximal deletion of chromosome 14 OMOP:604982 - Neonatal disorder due to and following sampling of chorionic villus OMOP:605010 - Safeguarding concern OMOP:605036 - Neonatal disorder due to chronic maternal cardiovascular disease OMOP:605112 - Conductive hearing loss of left ear with normal hearing on right side OMOP:605241 - Primary squamous cell carcinoma of superior wall of nasopharynx OMOP:605252 - Primary squamous cell carcinoma of overlapping sites of nasopharynx OMOP:605255 - Traumatic amputation of right lower limb through thigh OMOP:605287 - At increased risk of financial abuse OMOP:605334 - Gonococcal myocarditis OMOP:605340 - Secondary syphilis of nervous system OMOP:605388 - Traumatic amputation through right elbow OMOP:605410 - Arthritis of left hip caused by Streptococcus OMOP:605420 - Left acquired varus deformity of wrist region joint OMOP:605482 - Bilateral acute allergic otitis media of middle ears OMOP:605486 - Bilateral perforation of pars flaccida of tympanic membranes OMOP:605785 - Pulmonary artery autograft failure OMOP:605935 - Crusting of eyelid OMOP:606044 - Parasitic disease due to human immunodeficiency virus infection OMOP:606049 - Anticlockwise cavotricuspid isthmus dependent macroreentry tachycardia OMOP:606060 - Idiopathic junctional ectopic tachycardia OMOP:606065 - Congenital megaloblastic anemia due to transcobalamin II deficiency OMOP:606083 - Sinus bradycardia caused by drug OMOP:606192 - Tyramine intake OMOP:760385 - Closed fracture of phalanx of left lesser toe OMOP:606193 - Measured quantity of intake of tyrosine in 24 hours OMOP:606208 - Knowledge level of alcohol abuse OMOP:606251 - Adequate sanitation OMOP:606361 - Congenital paucity of intrahepatic bile ducts OMOP:606380 - Juvenile polymyositis due to paraneoplastic syndrome OMOP:606399 - Dense adnexal adhesions due to endometriosis OMOP:606406 - Amenorrhea due to congenital gonadotrophin releasing hormone deficiency OMOP:606438 - Gastric ulcer due to Henoch-Schönlein purpura OMOP:606469 - Triclofos overdose OMOP:606475 - Clorazepate poisoning OMOP:606648 - Improvement in nutritional status OMOP:606884 - Hereditary disorder of tooth OMOP:606914 - Follicular lymphoma grade 3b OMOP:607046 - Histologic type of primary malignant neoplasm of vagina OMOP:607062 - Histologic grade of primary malignant neoplasm of nasal sinus OMOP:607260 - Diethyl ether overdose OMOP:607263 - Mice, rats and voles protein OMOP:607289 - AAP/EFP 2017 Classification of Periodontal and Peri‐implant Diseases and Conditions generalized periodontitis Stage 4 Grade C OMOP:607291 - AAP/EFP 2017 Classification of Periodontal and Peri‐implant Diseases and Conditions generalized periodontitis Stage 4 Grade A OMOP:607299 - AAP/EFP 2017 Classification of Periodontal and Peri‐implant Diseases and Conditions generalized periodontitis Stage 1 Grade C OMOP:607376 - Myelopathy due to folate deficiency OMOP:607378 - Relative polycythemia due to acute loss of plasma volume OMOP:607380 - Pseudoxanthomatous nodular cutaneous mastocytosis OMOP:607392 - Acute lead-induced gout OMOP:607395 - Inflammatory pseudoneoplasm of spleen OMOP:607396 - Benign osteogenic neoplasm of bone OMOP:607401 - Monoarticular chronic primary gouty arthritis OMOP:607421 - Homozygous hereditary elliptocytosis OMOP:607565 - Occlusion of left posterior communicating artery OMOP:607566 - Traumatic injury of back of trunk OMOP:607623 - G1: Well differentiated OMOP:607646 - Congenital dilatation of common bile duct OMOP:607693 - Presence of direct invasion by primary malignant neoplasm of duodenum to lymphatic vessel and/or small blood vessel OMOP:607696 - Presence of direct invasion by primary malignant neoplasm of ampulla of Vater to nerve OMOP:607831 - Varicose veins in puerperium OMOP:607913 - Housing instability due to being behind on payments for place of residence OMOP:607929 - Mild androgen insensitivity syndrome OMOP:607951 - Assessment using Pocket Smell Test OMOP:607955 - Fracture of greater horn of hyoid bone OMOP:608057 - Kaposi sarcoma of colon OMOP:608090 - X-linked complex hereditary spastic paraplegia OMOP:608093 - Uveitis due to persistent onset antinuclear antibody positive juvenile idiopathic oligoarthritis OMOP:608176 - Radiculopathy due to multiple-level cervical spondylosis OMOP:608234 - Accidental poisoning caused by substance with benzene structure OMOP:608248 - Self destructive behavior OMOP:608252 - Adverse reaction to COVID-19 non-replicating viral vector vaccine OMOP:608277 - Acute myeloid leukemia with 11q23 abnormality OMOP:608307 - Second dose of inactivated whole SARS-CoV-2 antigen vaccine contraindicated OMOP:608380 - Grade 3 on a scale of 1 to 5 OMOP:608454 - Health visitor follow up planned OMOP:608501 - Screening for risk of falls indicated OMOP:608635 - SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) vaccination fourth dose not given OMOP:608700 - Alirocumab declined OMOP:608795 - Left accessory carpal bone of wrist OMOP:608827 - Bilateral muscle contracture of ankle regions OMOP:608844 - Bilateral osteochondritis dissecans of feet OMOP:608869 - Congenital torsion of left ovary OMOP:608919 - Pendulous right breast OMOP:608935 - Bilateral oncocytoma of kidneys OMOP:608965 - Bilateral iliac vein thrombophlebitis OMOP:608992 - Bilateral eye disorder following cataract surgery OMOP:609025 - Bilateral irregular astigmatism of eyes following operative procedure OMOP:609043 - Primary malignant neoplasm of soft tissue of left hip OMOP:609072 - Bilateral meibomitis of upper eyelids OMOP:609079 - Primary non-small cell carcinoma of right lung OMOP:609080 - Primary non-small cell carcinoma of left lung OMOP:609104 - Moderate nonproliferative retinopathy of left eye due to diabetes mellitus type 2 OMOP:609128 - Primary squamous cell carcinoma of skin of right hand OMOP:609169 - Mioctenopsylla arctica OMOP:609190 - Complex sclerosing lesion of right breast OMOP:609203 - Primary malignant neoplasm of skin of left upper eyelid OMOP:609231 - Urinary tract infection caused by Streptococcus agalactiae OMOP:609241 - Primary squamous cell carcinoma of vestibule of mouth OMOP:609310 - Polyneuropathy due to drug induced diabetes mellitus OMOP:609313 - Cerebrovascular accident due to embolism of right carotid artery OMOP:618498 - Hystrichopsylla OMOP:618528 - Cyberlindnera rhodanensis OMOP:618529 - Ctenophyllus OMOP:618537 - Vibrio metoecus OMOP:618547 - Simplicillium OMOP:618579 - Antigen of live attenuated Brucella melitensis revision one vaccine strain OMOP:618689 - Cerebrovascular accident due to occlusion of bilateral posterior cerebral arteries OMOP:618708 - Superficial injury of scrotum OMOP:618721 - Foreign body in skin of face OMOP:618784 - Adverse reaction to dimethyl sulfoxide and/or idoxuridine OMOP:618863 - Staphylococcus schweitzeri OMOP:618889 - Trichoblastoma OMOP:618900 - Telehealth monitoring for ischemic heart disease OMOP:618986 - Acquired abnormality of right cardiac ventricle OMOP:618989 - Postprocedural right ventricular aneurysm OMOP:618992 - Acquired regurgitation of right ventricular component of common atrioventricular valve following repair of biventricular connection OMOP:619116 - Valine intake OMOP:619119 - Contact with Chinese lacquer tree OMOP:619134 - Acquired abnormality of common atrioventricular valve following procedure OMOP:619135 - Acquired common atrioventricular valve regurgitation following procedure OMOP:619206 - Bilateral postaxial polydactyly of toes OMOP:619225 - Bilateral Madelung deformity OMOP:619234 - Congenital pulmonary airway malformation type 2 OMOP:619310 - Amblyomma dubitatum OMOP:619327 - Measured quantity of intake of fat and oil per kilogram body weight in 24 hours OMOP:619329 - Measured intake of energy via intravenous fluids in 24 hours OMOP:619351 - Gleimia OMOP:619353 - Lancefieldella OMOP:619470 - Inadequate intake of iron OMOP:619675 - Superficial foreign body of lip with infection OMOP:619706 - Congenital absence of bilateral ulnas OMOP:619739 - No leukocytes seen in urine via microscopy OMOP:619756 - Primary acquired melanosis of cornea of left eye OMOP:701362 - EORTC Quality of Life Questionnaire: Did you feel depressed during the past week? OMOP:701365 - EORTC Quality of Life Questionnaire: Has your physical condition or medical treatment interfered with your social activities during the past week? OMOP:703445 - Low risk category for developing complication from COVID-19 infection OMOP:703450 - Survivor of conflagration in residential building or apartment OMOP:705011 - RASS scale: -2 (Light sedation) OMOP:705049 - Measurement of Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) total antibody OMOP:72377 - Shoulder girdle dystocia OMOP:72578 - Neoplasm of uncertain behavior of breast OMOP:72984 - Reactive arthritis of joint of shoulder region due to and following dysentery OMOP:73021 - Bilateral congenital dislocation of hip OMOP:73318 - Polydactyly of fingers OMOP:73366 - Crushing injury of lower leg OMOP:73383 - Full thickness burn of foot OMOP:73550 - Crystal arthropathy of elbow OMOP:73568 - Palindromic rheumatism of shoulder region OMOP:73840 - Localized, primary osteoarthritis of the shoulder region OMOP:73855 - Arrest of bone development AND/OR growth OMOP:738839 - MOS SF-36 (Medical Outcomes Study 36-Item Short Form Health Survey): Mental health score OMOP:738847 - Left ventricular diastolic eccentricity index (dEI) OMOP:738870 - Stroop test: time of second subtask OMOP:742423 - MOS SF-36 Physical functioning: Does your health now limit you in Walking more than a mile: 3 (No, not limited at all) OMOP:742447 - MOS SF-36 Role physical: During the past 4 weeks, have you had following problem with your work or other regular daily activities as a result of your physical health: had difficulty performing the work or other activities: 1 (Yes) OMOP:742514 - MOS SF-36 Mental health: How much of the time during the past 4 weeks have you been a happy person: 1 (All of the time) OMOP:74808 - Injury of saphenous vein OMOP:74816 - Contusion of toe OMOP:75090 - Open fracture of three ribs OMOP:751324 - Measurement of pGP3 antigen for Chlamydia trachomatis OMOP:75387 - Closed lateral dislocation of proximal end of tibia OMOP:75608 - Shoulder dystocia with antenatal problem OMOP:75863 - Chronic interstitial cystitis OMOP:75898 - Loose joint body in multiple joints OMOP:75899 - Traumatic dislocation of shoulder region OMOP:75924 - Osteodystrophy OMOP:759892 - Bilateral arthritis of knees OMOP:759895 - Acquired hammer toe of left foot OMOP:759911 - Pain in right heel OMOP:759912 - Pain of left heel OMOP:760027 - Open fracture of head of right radius OMOP:760050 - Open fracture of shaft of right ulna OMOP:760061 - Chronic nonsuppurative otitis media of bilateral ears OMOP:760065 - Chronic otitis media of bilateral ears OMOP:760124 - Stenosis of bilateral external ear canals due to and following inflammation OMOP:760149 - Chronic nonsuppurative otitis media of left ear OMOP:760166 - Stenosis of left external ear canal due to and following inflammation OMOP:760204 - Rupture of right tympanic membrane due to otitis media OMOP:760234 - Closed bimalleolar fracture of left ankle OMOP:760271 - Closed fracture of right ulna OMOP:760288 - Closed fracture of shaft of metacarpal bone of left hand OMOP:760311 - Closed fracture of anatomical neck of proximal right humerus OMOP:760369 - Closed fracture of metaphysis of metatarsal bone of right foot OMOP:760392 - Closed fracture of medial cuneiform bone of right foot OMOP:760418 - Closed intertrochanteric fracture of left femur OMOP:760420 - Closed fracture of greater trochanter of left femur OMOP:760422 - Closed fracture of lesser trochanter of left femur OMOP:760430 - Closed fracture of condyle of left femur OMOP:760439 - Closed fracture of left lower leg OMOP:760484 - Closed fracture of phalanx of left middle finger OMOP:760485 - Closed fracture of phalanx of right ring finger OMOP:760502 - Closed fracture of proximal epiphyseal plate of right radius OMOP:760530 - Avulsion of fingernail of left hand OMOP:760583 - Pathological fracture of right humerus due to osteoporosis OMOP:760621 - Stress fracture of navicular bone of right foot OMOP:760636 - Pathological fracture of right femur due to osteoporosis OMOP:760639 - Pathological fracture of left femur due to neoplastic disease OMOP:760660 - Pathological fracture of left ulna due to neoplasm OMOP:760699 - Osteoid osteoma of talus OMOP:760705 - Osteoid osteoma of humerus OMOP:760715 - Codependency in remission OMOP:760736 - Subungual hematoma of right thumb OMOP:760762 - Sprain of right hip OMOP:760867 - Nonpuerperal mastitis of right breast OMOP:760888 - Bilateral open-angle glaucoma OMOP:760907 - Plantar wart of right foot OMOP:760918 - Patellofemoral syndrome of bilateral knees OMOP:760936 - Plasma cell leukemia in relapse OMOP:760940 - Benign carcinoid tumor of rectum OMOP:761043 - Chondromatosis of synovium of temporomandibular joint OMOP:761118 - Congenital blocked tear duct of bilateral eyes OMOP:761130 - Spider vein of right lower limb OMOP:761154 - Mammographic mass of right breast OMOP:761202 - Osteonecrosis of bone of left hip OMOP:761226 - Polydactyly of left thumb OMOP:761245 - Congenital talipes equinovarus of left foot OMOP:761282 - Right congenital clinodactyly OMOP:761296 - Tendinitis of right foot OMOP:76130 - Inactive Ménière's disease OMOP:761317 - Chronic inflammation of uveal tract of right eye OMOP:761325 - Iridocyclitis of bilateral eyes OMOP:761330 - Conjunctivitis of right eye caused by virus OMOP:761374 - Chronic osteomyelitis of left pelvis OMOP:761376 - Osteomyelitis of left pelvis OMOP:761377 - Neuritis of left ulnar nerve OMOP:761385 - Post-thrombotic syndrome of left lower extremity OMOP:761403 - Disorder of tendon of right shoulder region OMOP:761435 - Dissection of left iliac artery OMOP:761481 - Enthesopathy of right wrist OMOP:761482 - Enthesopathy of left wrist OMOP:761483 - Chronic bucket handle tear of medial meniscus of right knee OMOP:761513 - Esophoria of right eye OMOP:761520 - Consecutive exotropia of right eye OMOP:761554 - Retinal tear of bilateral eyes without detachment OMOP:761567 - Perforation of cornea of left eye OMOP:761574 - Disorder of cornea of left eye OMOP:761597 - Cataract of right eye due to inflammatory disorder OMOP:761606 - Infection of right eye OMOP:761645 - Swelling of finger of left hand OMOP:761664 - Mass of joint of right knee OMOP:761686 - Mass of soft tissue of left upper limb OMOP:761688 - Mass of muscle of right upper limb OMOP:761748 - Embolism of left iliac artery OMOP:761768 - Recurrent otitis externa of bilateral external auditory canals caused by human herpes simplex virus OMOP:761790 - Nonpyogenic cerebral venous thrombosis with stroke OMOP:761803 - Disorder of nail due to disorder OMOP:761806 - Cellulitis of left elbow OMOP:761830 - Thrombophlebitis of deep vein of left lower limb OMOP:761883 - Awaiting transplantation of pancreas OMOP:761885 - Abscess of parotid masseteric region of face OMOP:761917 - Malignant carcinoid tumor of ileum OMOP:761932 - Granulation of wound bed OMOP:761933 - Subtrochanteric fracture of left femur OMOP:761962 - Induration of periwound skin OMOP:76207 - Scoliosis due to radiation OMOP:762095 - Spontaneous hemorrhage of subarachnoid space from left middle cerebral artery OMOP:762104 - Entrapment neuropathy of peripheral nerve of right hand OMOP:762120 - Disorder of right deep peroneal nerve OMOP:762140 - Neuroma of right lower limb following surgery OMOP:762197 - Abscess of bursa of right shoulder OMOP:762276 - Loose body in joint of right elbow OMOP:762304 - Synovial plica syndrome of left knee OMOP:762319 - Stiffness of left ankle OMOP:762364 - Chalazion of lower eyelid of right eye OMOP:762482 - Pneumococcal vaccination not done OMOP:762485 - Hemodialysis session time OMOP:762522 - Chronic wound care OMOP:762676 - Secondary right vesicoureteral reflux OMOP:762683 - Secondary right vesicoureteral reflux grade 4 OMOP:762704 - Moderate dementia OMOP:762725 - Ophthalmoplegic migraine, refractory OMOP:762730 - Lennox-Gastaut syndrome, non-refractory OMOP:762755 - Arteriosclerosis of carotid artery OMOP:762772 - Hereditary cerebellar atrophy OMOP:762798 - Counseling for risks of driving OMOP:762800 - Narcotic embryopathy OMOP:762938 - Cerebral venous thrombosis of cortical vein with infarction OMOP:763453 - Excessive intake of selenium OMOP:763480 - Unintentional weight gain OMOP:763499 - Fluid consistency type OMOP:763504 - Pudding-thick liquid OMOP:763515 - Chronic disease-related malnutrition OMOP:763659 - Capable of heavy physical activity OMOP:763710 - Receives quite a bit of social support OMOP:763714 - Family history of paternal hip fracture OMOP:763735 - Capable of moderate physical activity OMOP:763771 - Name type OMOP:763917 - Patient transfer to another hospital OMOP:763921 - Herniation of nucleus pulposus of thoracic intervertebral disc OMOP:763960 - Pink-colored urine OMOP:764101 - Abdominal aortic aneurysm greater than 5.0 centimeters in female OMOP:764146 - Needs maximal assistance OMOP:764183 - Patient record scanned into electronic record OMOP:764321 - Adverse drug interaction with dietary supplement OMOP:764334 - Referral for care coordination OMOP:764375 - Medication non-compliance due to excessive pill burden OMOP:764398 - Contraception using lactation amonorrhea method OMOP:764414 - Refuses to discontinue medication OMOP:764504 - Occlusive thrombus of left cerebellar artery OMOP:764542 - Neuromusculoskeletal medicine OMOP:764673 - SP4 broth OMOP:764681 - Stapled skin wound OMOP:764716 - Thrombophlebitis of basal vein of Rosenthal OMOP:764734 - Pseudoaneurysm of vertebral artery OMOP:764760 - Unable to control portion size OMOP:764769 - Risk evaluation and mitigation strategy consultation OMOP:764781 - Acute myeloid leukemia, minimal differentiation, FAB M0 in remission OMOP:764828 - Mucopurulent conjunctivitis of left eye OMOP:764834 - Family history of hemophilia A OMOP:764904 - Pediatric allergy and immunology service OMOP:764911 - Pediatric medical toxicology service OMOP:764914 - Infection of hemodialysis tunneled catheter OMOP:764917 - Optic nerve and photoreceptor degeneration OMOP:764924 - Infection of hemodialysis temporary catheter OMOP:764933 - Virus not detected OMOP:764974 - Congenital arteriovenous malformation of duodenum and jejunum OMOP:764983 - Cellulitis of both external ears OMOP:764986 - Total perforation of bilateral tympanic membranes OMOP:765043 - Swelling of right ear structure OMOP:765073 - Arthritis of left acromioclavicular joint OMOP:765128 - Lesion of right sciatic nerve OMOP:765145 - Swan-neck deformity of finger of right hand OMOP:765182 - Pathological fracture of right humerus due to neoplasm OMOP:765227 - Right subclavian vein stenosis OMOP:765258 - Bilateral arthritis of hip OMOP:765289 - Open fracture of distal phalanx of left little finger OMOP:765292 - Open fracture of base of fifth metacarpal bone of left hand OMOP:765295 - Open fracture of phalanx of ring finger of left hand OMOP:765308 - Open subcapital fracture of left femur OMOP:765383 - Acquired bilateral pes planus OMOP:765445 - Open wound of skin OMOP:765455 - Family history of disorder of skeletal and/or smooth muscle OMOP:765482 - Suspected fracture of spine OMOP:765490 - Secondary right vesicoureteral reflux grade 1 OMOP:765499 - Written consent completed OMOP:765516 - High trans fat food OMOP:765518 - Monoplegia of dominant lower limb due to and following ischemic cerebrovascular accident OMOP:76570 - Burn of elbow OMOP:765715 - Family history of ataxia OMOP:76574 - Full thickness burn of lower leg OMOP:765774 - Occlusion and stenosis of anterior cerebral artery without infarction OMOP:765783 - Ineffective medication administration routine at home OMOP:765791 - Patient reported problems OMOP:765829 - Severe medical complication OMOP:765904 - Bilateral primary open angle glaucoma OMOP:76595 - Full thickness burn of thumb OMOP:76772 - Galactorrhea in pregnancy and the puerperium with antenatal complication OMOP:77069 - Old posterior cruciate ligament disruption OMOP:77071 - Loose body in joint of hand OMOP:77115 - Multiple open fractures of pelvis with disruption of pelvic circle OMOP:77365 - Disuse osteoporosis OMOP:77812 - Malignant neoplasm of anterior wall of urinary bladder OMOP:78238 - Rupture of synovium OMOP:78272 - Sprain of wrist OMOP:78586 - Sprain of interphalangeal joint of toe OMOP:78633 - Heat cramp OMOP:78771 - Labyrinthine dysfunction OMOP:78831 - Disorder of ankle OMOP:79119 - Thoracic spondylosis with myelopathy OMOP:79145 - Ehlers-Danlos syndrome OMOP:79905 - Transient arthropathy of the ankle and/or foot OMOP:80045 - Primary malignant neoplasm of anus OMOP:801290 - Documentation stating the patient has received or is currently receiving palliative or hospice care OMOP:801344 - All inclusive payment for services related to highly coordinated and integrated opioid use disorder (oud) treatment services furnished for the demonstration project OMOP:80482 - Suppurative arthritis OMOP:80512 - Acquired kyphosis OMOP:80819 - Acquired hallux varus OMOP:80860 - Open fracture of vertebral column with spinal cord injury OMOP:80883 - Nonvenomous insect bite of elbow with infection OMOP:81029 - Chronic petrositis OMOP:81096 - Arthropathy associated with mycoses, of the pelvic region and thigh OMOP:81251 - Neoplasm of breast OMOP:81634 - Ptotic breast OMOP:81708 - Closed medial dislocation of elbow OMOP:81988 - Sprain of sternum OMOP:8507 - MALE OMOP:8515 - Asian OMOP:8516 - Black or African American OMOP:8527 - White OMOP:8532 - FEMALE OMOP:8557 - Native Hawaiian or Other Pacific Islander OMOP:8657 - American Indian or Alaska Native OMOP:903667 - Chewing tobacco user OMOP:915696 - Patient evaluated for risk of misuse of opiates by using a brief validated instrument (e.g., opioid risk tool, soapp-r) or patient interviewed at least once during opioid therapy (Deprecated) OMOP:915720 - Preoperative assessment documented (Deprecated) OMOP:915726 - Patient identified as an unhealthy alcohol user when screened for unhealthy alcohol use using a systematic screening method and received brief counseling OMOP:915776 - I intend to report the diabetic retinopathy measures group (Deprecated) OMOP:937625 - Clinician who referred the patient to another clinician received a report from the clinician to whom the patient was referred OMOP:937644 - Patient had cancer, acute fracture or infection related to the lumbar spine or patient had neuromuscular, idiopathic or congenital lumbar scoliosis OMOP:937667 - No screening performed, partial screening performed or positive screen without recommendations and reason is not given or otherwise specified OMOP:953317 - Leg pain was measured by the visual analog scale (vas) within three months preoperatively and at one year (9 to 15 months) postoperatively (Deprecated) OMOP:953323 - Functional status was measured by the oxford knee score (oks) patient reported outcome tool within three months preoperatively and at one year (9 to 15 months) postoperatively (Deprecated)
Search
Reset